See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/268210304

Molecular Identification of Eimeria species Infection in Chickens in Surrounding

Areas of the Red River Delta in Vietnam

Article in International Journal of Livestock Research · October 2014

DOI: 10.5455/ijlr.20140925111501

CITATIONS READS

4 3,342

3 authors:

Tran Duc Hoan Javaid Ali Gadahi

Bacgiang Agriculture and Forestry University, Vietnam Sindh Agriculture University
19 PUBLICATIONS 67 CITATIONS 74 PUBLICATIONS 1,244 CITATIONS

SEE PROFILE SEE PROFILE

Riaz Leghari
Sindh Agriculture University
37 PUBLICATIONS 119 CITATIONS

SEE PROFILE

All content following this page was uploaded by Tran Duc Hoan on 22 July 2016.

The user has requested enhancement of the downloaded file.

 Vol 4(7) Oct’14
International Journal of Livestock Research ISSN 2277-1964 ONLINE

Molecular Identification of Eimeria species Infection in Chickens in

Surrounding Areas of the Red River Delta in Vietnam
Tran Duc Hoan∗, Javaid Ali Gadahia and Riaz Ahmed Legharia
Faculty of Animal Husbandry and Veterinary Medicine, Bacgiang Agriculture and Forestry
University, Vietyen district, Bacgiang province, Vietnam
a
Faculty of Animal Husbandry and Veterinary Science, Sindh Agriculture University, Tandojam, Pakistan
*Corresponding author: hoantd@bafu.edu.vn
Rec. Date: Aug 25, 2014 02:54
Accept Date: Sep 25, 2014 23:15
Published Online: October 31, 2014
DOI 10.5455/ijlr.20140925111501

Abstract
The prevalence of avian coccidiosis in Vietnam has been negligible so far, especially the identification of
Eimeria at species level. Therefore, the present study has been conducted to determine the molecular
identification of Eimeria species infection on chicken (households and farm chickens) in surrounding
areas of the Red River Delta of Vietnam. A total of 72 fecal samples were collected from households and
commercial poultry farms (36 each). Oocysts were collected from the microscopically positive samples
and DNA was isolated for the PCR (Polymerase Chain Reaction) identification. The results showed that
32 (88.89%) and 29 (80.56%) samples were positive in household chickens and commercial farm
chickens, respectively. The infection rate of Eimeria tenella, E. acervulina, E. brunetti, E. maxima, E.
mitis and E. necatrix were 93.75, 90.63, 84.38, 78.13, 59.38 and 37.50%, respectively in the household
chickens. In the case of the commercial farm chickens, the infection rate of E. tenella, E. acervulina, E.
maxima, E. brunetti, E. mitis and E. necatrix were 96.55, 89.66, 86.21, 75.86, 48.28 and 31.03%,
respectively but E. praecox was not identified. The results indicated that the infection of Eimeria species
in this area of Vietnam was prevalent.
Key words: Eimeria species; Chicken; Coccidiosis; The Red River Delta; Vietnam

Introduction

The Red River Delta is the cradle of the Vietnamese nation. Water Puppetry originated in the rice paddies
here. The Delta is the flat plain formed by the Red River and its distributaries joining in the Thai Binh
River in northern Vietnam. The delta measuring some 15,000 km2 is well protected by a network of dikes
(Whitfield, 1976). It is characterized by a strong monsoon influence, a considerable amount of sunny
days, and with a high rate of rainfall and humidity. Average temperatures for the year range from 22 oC to
27oC. Poultry farming is quite common in Vietnam, contributing the majority of income for the rural
population at large scale. In the previous investigations of the infection of Eimeria species on chicken in
9 Page

Vietnam, five species (E. tenella, E. necatrix, E. maxima, E. acervulina and E. mitis) were found in the

Hosted@www.ijlr.org DOI 10.5455/ijlr.20140925111501

 Vol 4(7) Oct’14
International Journal of Livestock Research ISSN 2277-1964 ONLINE

northern provinces of Vietnam by morphological methods (Luc et al, 2003) and two species (E. tenella
and E. necatrix) were most pathogenic (Luc et al, 2011). However, there were no any reports about the
epidemiology of Eimeria spp. on chicken in the Red River Delta of Vietnam.

Coccidiosis is caused by protozoan parasite which causes mortality, morbidity and weight loss in chicken
(Jensen et al, 2000). It is one of the most commonly prevalent and economically important parasitic
diseases in poultry industry all over the world (Donal and Elizabeth, 2007). Nine different species of
Eimeria have been identified. Out of them E. acervulina, E. necatrix, E. tenella, E. maxima and E.
brunetti are the major species infected in chicken (Anders and Jørgen, 2005; Donal and Elizabeth, 2007).
The infection of Eimeria spp. usually mixed due to ingestion of oocysts (Fayer, 1980). These infections
lead to disorders digestion resulting from damage to the intestinal epithelium, mal-absorption of nutrients,
changes in protein metabolism after absorption, reduced efficiency of feed conversion, and reduction in
weight gain (Conway et al, 1993; Shirley et al, 2005). Mortality and economic losses, especially in cases
of outbreaks, are frequent (Morris and Gasser, 2006).

Recent year, PCR assay has been applied for the diagnosis of coccidial parasites of man and animals. A
number of approaches have proved to be both specific and highly sensitive for analyses either of parasites
grown in vitro or present in tissue samples and clinical material (Gautam et al, 2010).

The development of molecular techniques has allowed precise diagnosis of Eimeria species, investigation
of the genetic variability of these pathogens, and a search for molecular characteristics associated with
phenotypical characteristics that may constitute the use of molecular markers (Costa et al, 2001;
Schnitzler et al, 1999). Molecular techniques may also contribute to the development of new vaccines and
selection of anti-coccidial drugs to be used in control programs (Lee et al, 2010; Morris and Gasser, 2006;
Sun et al, 2009).

In this regard, we reported the identification of Eimeria spp. infection on chicken conducted by PCR
method and also looked at the Eimeria species preponderance in the Red River Delta of Vietnam.

Materials and Methods

Sample collection

A total of 72 fecal samples of chickens were collected randomly from individual scavenging native
chickens of house-hold and individual floors of commercial poultry farms at surrounding areas of the Red
10

River Delta of Vietnam (36 in each) (Fig. 1).

Page

Hosted@www.ijlr.org DOI 10.5455/ijlr.20140925111501

 Vol 4(7) Oct’14
International Journal of Livestock Research ISSN 2277-1964 ONLINE

Fig. 1: Map of study area

The sampling was done between the period months of August, October, December 2013 and February,
April 2014. Fresh fecal droppings were collected in sterile universal bottles and carcasses were collected
in polyethylene leather bags and transported to the laboratory immediately for processing.

Laboratory Examination

Laboratory examination was done by wet mount smears of the fecal droppings as described by (Fleck and
Moody, 1993). Concentration technique was also used for counting of oocyst and examined under the
microscope using × 10 objectives. Oocysts were collected from microscopically positive samples
(Daugschies et al, 2002). The sporulation was performed at 24-26oC in a 2.5% aqueous solution of
potassium dichromate (K2Cr2O7). The sporulated oocyst were concentrated by centrifugation and stored in
potassium dichromate at 4oC.

PCR identification

DNA was extracted from sporulated oocysts (Zhao et al, 2001). The present Eimeria species in each
mixture of oocyst was tested by PCR using primer sequences (Table 1).

The extracted DNA was subjected to PCR and the volume of 25 µl was used for PCR amplification.
Thermo-cycling condition reaction was followed: 1 cycle at 95oC, for 7 min; 35 cycles at 95oC for 20 sec,
44 to 60oC for 30 sec, 72oC for 1 min; 1 cycle at 72oC for 5 min (Gautam et al, 2010; Jenkins et al,
11

2006a & b). 200 nM dNTP (Amersham, Piscataway, NJ), 20 mM Tris pH 8.4, 50 mM KCl, 3.0 mM
Page

Hosted@www.ijlr.org DOI 10.5455/ijlr.20140925111501

 Vol 4(7) Oct’14
International Journal of Livestock Research ISSN 2277-1964 ONLINE

MgCl2, 1 U rTaq polymerase (New England Bio-labs, Ipswich, MA) in a PTC200 Mini-cyclerTM (MJ
Research, Watertown, VA) (Haug et al, 2007; Schnitzler et al, 1999; Schnitzler et al, 1998).

Table 1: Primers sequences, annealing temperatures and predicted sizes of products fo r PCR amplification
of Eimeria spp.

Annealing
Eimeria species Primer1 PCR product sequence (5’–3’) Size (nt)
Temperature (C)

1, E. acervulina EaF GGCTTGGATGATGTTTGCTG 60 321

EaR CGAACGCAATAACACACGCT
2, E. brunetti EbF GATCAGTTTGAGCAAACCTTCG 45 310
EbR TGGTCTTCCGTACGTCGGAT
3, E. maxima EmaF CGTTGTGAGAARACTGRAAGGG 51 144
EmaR GCGGTTTCATCATCCATCATCG
4, E. mitis EmiF TATTTCCTGTCGTCGTCTCGC 54 306
EmiR GTATGCAAGAGAGAATCGGGA
5, E. necatrix EnF GTCAGCTTTTTGCCTGGGTG 55 285
EnR ACAGACCGCTACACAACACG
6, E. praecox EpF CATCATCGGAATGGCTTTTTGA 54 368
EpR AATAAATAGCGCAAAATTAAGCA
7, E. tenella EtF AATTTAGTCCATCGCAACCCT 60 271
EtR CGAGCGCTCTGCATACGACA
1
F - Forward primer and R- Reverse primer

PCR products were separated by 1.0% agarose gel electrophoresis (Bio-metra, Göttingen, Germany) The
gels were stained in an aqueous ethidium bromide solution (0.5 µg/ml) and DNA bands were visualized
under UV light (transillumi-nator; UV wavelength, 254 nm; TFX-20 M, Vilber Lourmat, France) and
photographed by a digital camera (CSE-0028, Cybertech, Berlin, Germany) (Tsuji et al, 1997).

Results

The results of microscopic examination of mixed Eimeria spp oocysts were described in Fig. 2.
According to these results, DNA of oocysts was extracted for PCR identification.
12 Page

Hosted@www.ijlr.org DOI 10.5455/ijlr.20140925111501

 Vol 4(7) Oct’14
International Journal of Livestock Research ISSN 2277-1964 ONLINE

In the tested 36 samples of households, 4 fecal samples did not yield positive PCR identification and 32
were positive for Eimeria spp. (Fig. 3). While out of 36 commercial farms fecal samples, 29 were positive
and 7 did not yield positive.

Fig. 2: Microscopic examination of mixed Eimeria oocysts from chicken feces (×40 microscopic)

Fig. 3: Identification of Eimeria species in chickens from the area of Red River Delta in Vietnam by agarose gel
electrophoresis (1%) of PCR products with Eimeria species-specific primers. Lane M 100 bp DNA ladder, Lane 1 E.
acervulina primers (+, 321 bp), Lane 2 E. brunetti primers (+, 310 bp), Lane 3 E. maxima primers (+, 144 bp), Lane
4 E. mitis primers (+, 306 bp), Lane 5 E. necatrix primers (+, 285 bp), Lane 6 E. praecox primers (−, 368 bp), Lane
7 E. tenella primers (+, 271 bp)

The results of the PCR identification of household chickens revealed that E. tenella was identified with
high infection rate as 93.75% followed by E. acervulina, E. brunetti, E. maxima, E. mitis and E. necatrix
(Table 2). The same trend was also found in the case of commercial poultry farms, E. tenella was most
prevalent as 96.55% followed by E. acervulina, E. brunetti, E. maxima, E. mitis and E. necatrix (Table 3)
and E. praecox was not found in both households and commercial poultry farms.
13 Page

Hosted@www.ijlr.org DOI 10.5455/ijlr.20140925111501

 Vol 4(7) Oct’14
International Journal of Livestock Research ISSN 2277-1964 ONLINE

Table 2: Identification of Eimeria species by PCR amplification in households chicken

No. of Microscopically Molecular identification by PCR
Type of (%)
examined positive
bird
samples (%) E.a E.b E.ma E.mi E.n E.p E.t
Colour 10 11 8 8 5 12
14 12 (85.71) 0
broiler (83.33) (91.67) (66.67) (66.67) (41.67) (100.00)
11 10 10 7 5 11
Broiler 13 12 (84.62) 0
(91.67) (83.33) (83.33) (58.33) (41.67) (91.67)
8 6 7 4 2 7
Layer 9 8 (88.89) 0
(100.00) (75.00) (87.50) (50.00) (25.00) (87.50)
29 27 25 19 12 30
Total 36 32 (88.89) 0
(90.63) (84.38) (78.13) (59.38) (37.50) (93.75)

E.a, Eimeria acervulina; E.b, Eimeria brunetti; E.ma, Eimeria maxima; E.mi, Eimeria mitis; E.n, Eimeria necatrix;
E.p, Eimeria praecox; E.t, Eimeria tenella

In household chickens, the infection rate of E. tenella (100%) was recorded as highest in color broiler, E.
tenella and E. acervulina (91.67%) were more prevalent in broiler and in case of layer chicken, E.
acervulina was found with the highest infection rate (100%).

Table 3: Identification of Eimeria species by PCR amplification in commercial chicken farms

No. of Microscopically Molecular identification by PCR

Type of (%)
examined positive
bird
samples (%) E.a E.b E.ma E.mi E.n E.p E.t
Colour 9 8 9 4 2 9
12 10 (83.33) 0
broiler (90.00) (80.00) (90.00) (40.00) (20.00) (90.00)
10 9 8 5 5 11
Broiler 13 11 (84.62) 0
(90.91) (81.82) (72.73) (45.45) (45.45) (100.00)
7 8 5 5 2 8
Layer 11 8 (72.73) 0
(87.50) (100.00) (62.50) (62.50) (25.00) (100.00)
26 25 22 14 9 28
Total 36 29 (80.56) 0
(89.66) (86.21) (75.86) (48.28) (31.03) (96.55)
E.a, Eimeria acervulina; E.b, Eimeria brunetti; E.ma, Eimeria maxima; E.mi, Eimeria mitis; E.n, Eimeria necatrix;
E.p, Eimeria praecox; E.t, Eimeria tenella

In commercial poultry farm chickens, the high infection rate of E. tenella, E. acervulina and E. maxima
(90%) were found in color broiler, E. tenella (100%) was preponderant species in broiler, whereas in
layer chickens E. brunetti and E. tenella were found more prevalent (100%).

All positive samples had multiple infections with 2-6 species of Eimeria. None of them had infections
with single species of Eimeria, or all seven species.

Discussion
14

In this study, six Eimeria spp. were identified in chickens. The overall prevalence of Eimeria spp. was
88.89% (32 of 36 birds) in the households and 80.56% (29 of 36 birds) in the farms. This showed that the
Page

Hosted@www.ijlr.org DOI 10.5455/ijlr.20140925111501

 Vol 4(7) Oct’14
International Journal of Livestock Research ISSN 2277-1964 ONLINE

infection of Eimeria species in the Red River Delta of Vietnam was prevalent. The infection rate of
scavenging native chickens in households and commercial farms in surrounding areas of the Red River
Delta of Vietnam was not significant different visibly (Fig. 4). This indicated that different breeding
conditions did not influence on the infection of Eimeria spp. in chickens. On the other hand, the infection
rate of chickens with the same Eimeria species was not significantly different. However, the infection rate
among Eimeria species in both households and commercial farms were significantly different.
Rate (%)

120,00 Households
Commercial Farms

100,00

80,00

60,00

40,00

20,00

0,00
a

ma

ies
x
i

a
x
ett
in

ti

ell
tri

co
mi
ul

ec
xi
un

ca

ten
ae
erv

ma

sp
Eimeria species
E.

ne
br

pr

E.
ac

ed
E.

E.

E.

E.

ix
E.

Fig. 4: The rate of Eimeria spp. infected on chickens in surrounding areas on the Red River Delta of Vietnam

In the oresesnt stud, six species of Eimeria (E. tenella, E. acervulina, E. maxima, E. brunetti, E. mitis and
E. necatrix) were identified and Eimeria tenella was the most prevalent species in households (93.75%)
and commercial farms (96.55%) in surrounding areas of the Red River Delta of Vietnam. These results
were not coincide with previous reports relying on prevalence estimates or individual species
identification about the preponderance of Eimeria spp. (E. tenella, E. necatrix, E. acervulina, E. maxima
and E. mitis) on chickens in Vietnam (Phan et al, 2005). In another report, five species of oocysts in
Eimeria were found in broiler chicken and the highest infection rate appeared in E. acervulina (44.66%)
followed by E. necatrix (31.62%), E. tenella (21.76%), E. maxima (10,67%) and E. brunetti (7.82%)
(Nguyen, 2010). These reports were different with our report in both species and infection rate.

Some reports of authors about the prevalence of coccidian parasite such as the Eimeria species infecting
chickens mostly in Ethiopia showed E. tenella, E. acervulina, E. maxima, E.brunetti, E. mitis and E.
necatrix (Gari et al, 2008). In another study on the prevalence of Eimeria spp. in China, the infection rate
of identified Eimeria spp. in the farms was 90, 88, 72, 68, 60, 26, and 8% for E. tenella, E. praecox, E.
15

acervulina, E. maxima, E. mitis, E. necatrix, and E. brunetti, respectively (Sun et al, 2009). On other
Page

hand, the nearest report in Nigeria showed that the prevalence of mixed infection was 71 and 57.7% and

Hosted@www.ijlr.org DOI 10.5455/ijlr.20140925111501

 Vol 4(7) Oct’14
International Journal of Livestock Research ISSN 2277-1964 ONLINE

for the single infection was 29 and 42.3% in layer and broiler respectively (Jatau et al, 2012). These
reports are also similar to our report mentioned in the prevalence of Eimeria species in chicken.

The present study also showed that there was poor agreement between PCR and traditional identification
for diagnosis of Eimeria species. Traditional methods are not sufficiently reliable for specific diagnosis of
Eimeria species in chickens. Alternatively, occurrence of multiple infections in a single bird and the fact
that Eimeria species with low oocyst frequency in the mixture may be missed indicates that PCR based
amplification of DNA sequence of parasite, could resolve this problem and overcame the limitation in
analysis of small amounts of oocyst in mixed infections. Hence, in the future, the sufficiently reliable
method for specific diagnosis of Eimeria species in chickens and PCR based amplification of DNA
sequence of parasite would have been on behalf of traditional methods.

In conclusion, the molecular identification of Eimeria species infection in the Red River Delta of Vietnam
was conducted using PCR assay and it is necessary to be instead of conventional methods in molecular
diagnosis the diseases of animals in Vietnam.

Acknowledgements

The authors would like thank to Faculty of Animal Husbandry and Veterinary Medicine, Bacgiang Agriculture
and Forestry University, Vietnam. The households and the poultry farm owners for taking samples.

References

1. Anders, P. and W.J. Hansen. 2005. The Epidemiology, Diagnosis and Control of Poultry Parasites.
The Royal Veterinary and Agricultural University and Food and Agriculture Organization of the
United Nations; Copenhagen, Denmark and Rome, Italy. pp. 48-50.
2. Conway, D.P., K. Sasai, S.M. Gaafar, and C.D. Smothers. 1993. Effects of Different Levels of Oocyst
Inocula of Eimeria acervulina, E. tenella , and E. maxima on Plasma Constituents, Packed Cell
Volume, Lesion Scores, and Performance in Chickens. Avian Dis. 37: 118-123.
3. Costa, C.A, R.F. Gomes, M.N. Melo, and M.F. Ribeiro. 2001. Eimeria Parasites of Domestic Fowl:
Genetic Relationships of Different Isolates Estimated from Random Amplified Polymorphic DNA.
Parasitol res. 87: 459-466.
4. Daugschies, A., R. Bose, J. Marx, K. Teich, and KT. Friedhoff. 2002. Development and Application
of a Standardized Assay for Chemical Disinfection of Coccidia Oocysts. Vet Parasitol. 103: 299-308.
16

5. Donal, P.C. and McKenzie. E.M. 2007. Poultry Coccidiosis, Diagnostic and Testing Proceduces.
Page

Blackwell Publishing; Iowa, USA. pp. 65-73.

Hosted@www.ijlr.org DOI 10.5455/ijlr.20140925111501

 Vol 4(7) Oct’14
International Journal of Livestock Research ISSN 2277-1964 ONLINE

6. Fayer, R. 1980. Epidemiology of Protozoan Infections: The Coccidia. Vet. Parasitol. 6: 75-103.
7. Fleck, S.L, and A.H Moody. 1993. Diagnosistic Technique in Medical Parasitology. Cambidge
University Press, UK. pp. 10-14.
8. Gari, G., G. Tilahun, and Ph. Dorchies. 2008. Study on Poultry Coccidiosis in Tiyo District, Arsi
Zone, Ethiopia. Poultry science. 7(3): 251-256.
9. Gautam, P., M.A. Ali, K.V. Chanu, L. Jonathan, L.K. Joy, M. Prava, R. Ravindran, G. Das, and L.
Inaotombi Devi. 2010. PCR Based Diagnosis of Eimeria tenella Infection in Broiler Chicken. Poultry
science. 9(8): 813-818.
10. Haug, A., P. Thebo, and M. Jens. 2007. A Simplified Protocol for Molecular Identification of Eimeria
Species in field Samples. Vet Parasitol. 146: 35-45.
11. Jatau, J.D., N.H. Sulaiman, I.W. Musa, A.I. Lawal, O.O. Okubanjo, I. Isah, and Y. Magaji. 2012.
Prevalence of Coccidia Infection and Preponderence Eimeria Species in Free Range Indigenous and
Indensively Managed Exotic Chickens Durring Hot-West Season, in Zaria, Nigeria. Asian J of
Poultry Science. 6(3): 79-88.
12. Jenkins, M.C., K. Miska, and S. Klopp. 2006a. Application of Polymerase Chain Reaction Based on
Its1 Rdna to Speciate Eimeria. Avian Dis. 50: 110-114.
13. Jenkins, M.C., K. Miska, and S. Klopp. 2006b. Improved Polimerase Chain Reaction Technique for
Determining the Species Composition of Eimeria in Poultry Litter. Avian Dis. 50: 632-635.
14. Jensen, J., B.D. Hammond and W. Trager. 2000. In Vitro Cultivation of Protozoan Parasites. CRC
Press; United States. pp. 35.
15. Lee, B.H, W.H. Kim, J. Jeong, and J. Yoo. 2010. Prevalence and Cross-Immunity of Eimeria Species
on Korean Chicken Farms. J. Vet. Med. Sci. 72: 985-989.
16. Luc, P., B.M. Dieu, and P.T. Dung. 2003. Eimeria Infection in Chicken in Some Northern Provinces
of Vietnam. Agricultural technique science. 1: 118-120.
17. Luc Phan, Ngo Thi Hoa, and Phan Tan Dung. 2011. Animal Parasites. Hanoi Publishing House;
Hanoi, Vietnam. pp. 139-140.
18. Morris, G.M, and R.B. Gasser. 2006. Biotechnological Advances in the Diagnosis of Avian
Coccidiosis and the Analysis of Genetic Variation in Eimeria. Biotechnol. Adv. 24: 590-603.
19. Nguyen, H.H. 2010. A Servey of Coccidia Infection on Broiler Chicken in Soctrang and Vinhlong
Provinces. Vet Sci. 4: 61-68.
20. Phan, L, T.N. Hoa, and T.P. Dung. 2005. Animal Parasite. Hanoi; Vietnam. pp. 255.
17

21. Schnitzler, B.E., P. Thebo, L.M. Fiona, A. Uggla, and M. Shirley. 1999. PCR Identification of
Chicken Eimeria: A Simplified Read-Out. Avian Pathology. 28: 89-93.
Page

Hosted@www.ijlr.org DOI 10.5455/ijlr.20140925111501

 Vol 4(7) Oct’14
International Journal of Livestock Research ISSN 2277-1964 ONLINE

22. Schnitzler, B.E., P. Thebo, L.J. Mattsson, G.F. Tomley and M. Shirley. 1998. Development of a
Diagnotic Pcr Assay for the Detection and Discrimination of Four Pathogenic Eimeria Species of the
Chicken. Avian Pathology. 27: 490-497.
23. Shirley, M.W., A.L. Smith, and F.M. Tomley. 2005. The Biology of Avian Eimeria with an
Emphasis on Their Control by Vaccination. Adv. Parasitol. 60: 285-330.
24. Sun, X.M., W. Pang, T. Jia, W.C. Yan, G. He, L.L. Hao, M. Bentué, and X. Suo. 2009. Prevalence of
Eimeria Species in Broilers with Subclinical Signs from Fifty Farms. Avian Dis. 53(2): 301-5.
25. Tsuji, N., S. Kawazu, M. Ohta, T. Kamio, T. Isobe, K. Shimura, and K. Fujisaki. 1997.
Discrimination of Eight Chicken Eimeria Species Using the Two-Step Polymerase Chain Reaction.
Parasitol. 83: 966-970.
26. Whitfield, D. 1976. Historical and Cultural Dictionary of Vietnam.
27. Zhao, X., W. D. Duszynski., and S.E. Loker. 2001. A Simple Method of DNA Extraction for Eimeria
Species. Microbiological Method. 44: 131-137.

18 Page

Hosted@www.ijlr.org DOI 10.5455/ijlr.20140925111501

View publication stats