Biotechnol Lett (2007) 29:1671–1676
DOI 10.1007/s10529-007-9502-7
ORIGINAL RESEARCH PAPER
Pichia pastoris expressing recombinant tilapia growth
hormone accelerates the growth of tilapia
Jannel Acosta Æ Reynold Morales Æ Antonio Morales Æ
Miriam Alonso Æ Mario Pablo Estrada
Received: 8 May 2006 / Revised: 20 July 2007 / Accepted: 20 July 2007 / Published online: 14 August 2007

Springer Science+Business Media B.V. 2007
Abstract Growth manipulation of fish is an
important task in aquatic biotechnology. The
growth promoting effect of recombinant Pichia
pastoris expressing tilapia growth hormone was
demonstrated in red tilapia fry (Oreochromis sp.),
which were immersed into water containing intact
cells of the recombinant yeast. The weight
increase of the treated group was 171% relative
to the control group after 6 weeks.
Keywords Fish
Growth
Growth hormone

Immersion
Pichia pastoris
Tilapia
Introduction
Pituitary growth hormone (GH) is a prime
candidate for enhancing the growth of fish. It is
involved in the regulation of growth, develop-
ment, metabolism, appetite and osmoregulation
in fish (Tsai et al. 1993ab; Farmanfarmaian and
J. Acosta
R. Morales
A. Morales

M. P. Estrada (&)
Aquatics Biotechnology Project, Animal
Biotechnology Division, Center for Genetic
Engineering and Biotechnology, P.O. Box 6162,
Havana 10600, Cuba
e-mail: mpablo@cigb.edu.cu
M. Alonso
Ministry of fisheries, San José, Havana, Cuba
Sun 1999; Silverstein et al. 2000). GH cDNA of
fish has been cloned, sequenced and the recombi-
nant GHs have been shown to be potent accel-
erators of fish growth rate by injection (Agellon
et al. 1988; Tsai et al. 1993a) or immersion of fish
into water containing this hormone (Agellon et al.
1988; Moriyama and Kawauchi 1990).
Pichia pastoris is an efficient host for heterol-
ogous gene expression using the promoter from
the methanol-induced alcohol oxidase 1 (AOX1)
gene (Tschopp et al. 1987). Recently Li et al.
(2001) investigated the intracellular expression of
carp GH in P. pastoris and that recombinant
P. pastoris cells expressing carp GH, when used as
a food supplement, produced a growth-promoting
effect on tilapia.
The objective of the present study was to
evaluate the effect of transformed P. pastoris cells
expressing tilapia GH (tiGH) on growth of tilapia
fry when immersed in water containing this
recombinant yeast.
Materials and methods
Construction of the expression vector
pP-tiGH
The cDNA encoding tiGH was amplified from
the previously constructed pTTi by PCR
(Guillén et al. 1998) using the following primers:
123
1672
5¢- ATGCCATGGCGAACTCAGTCGTCCTC
CTGCTGTCGG-3¢ (upstream) and 5¢- CCGGA-
ATTCCAATGCAACACATTTATTTC-3¢
(downstream). These primers were designed
from tilapia cDNA growth hormone sequence
(GeneBank Accesion number M26916) for the
amplification of the signal peptide, mature GH
and 200 bp of the non-translated 3¢ end. The
upstream and downstream primers contain the
restriction sites for NcoI and EcoRI restriction
endonucleases (underlined), respectively. The
PCR product of approximately 800 pb was NcoI
and EcoRI digested and cloned into the pNAO
vector previously digested with the same en-
zymes to generate the expression plasmid pP-
tiGH (Fig. 1).
Fig. 1 Schematic diagram of the pP-tiGH expression
vector. Upstream of tiGH cDNA is the AOX1 promoter
(pAOX1), while downstream is the termination signal of
the enzyme glyceraldehide-3P-deshydrogenase (GAPt) of
S. cerevisiae. Additional genetic elements are a fragment
of chromosomal DNA corresponding to the 3¢ AOX
region necessary for the homologous recombination
between the yeast and HIS3 gene of S. cerevisiae which
is the yeast selection marker. The vector has a functional
replication origin in E. coli and the ampicillin resistance
gene as a bacteria selection marker
123
Biotechnol Lett (2007) 29:1671–1676
Transformation of Pichia pastoris
and screening for MutS phenotype
The expression plasmid was linearized with ClaI
and it was used to transform P. pastoris strain
MP36 (HIS3) (Yong et al. 1992) by electropora-
tion (Martı́nez et al. 1993). The transformation
mixture was plated on selective medium [1.34 %
(w/v) yeast nitrogen base, 3 % (w/v) agar, 1 M
sorbitol, 2 % (w/v) glucose]. Colonies were visible
after 2–3 days at 30C. Transformants were iden-
tified by DNA dot-blot analysis using tilapia GH
gene probe. Positive transformants were analyzed
by Southern blot to check for correct integration
by replacement of P. pastoris host AOX1 gene by
the expression cassette from pP-tiGH, corre-
sponding to MutS phenotype. Chromosomal
DNA was digested with EcoRI restriction endo-
nuclease and a fragment corresponding to AOX1
promoter plus tiGH was used as probe.
Methanol-induced tiGH expression
in Pichia pastoris
The selected clones were cultured in a 5 l biore-
actor containing supplemented saline medium
(SSM) [40 g glycerol/l, 15 g (NH4)2SO4/l, 4.3 g
KH2PO4/l, 3.2 g MgSO4.7H2O/l, 0.22 g CaCl2.2-
H2O/l, 5 g yeast extract/l, 0.4 g EDTA/l, 0.25 %
(v/v) vitamins, 0.1 % (v/v) trace elements]
(Rodrı́guez et al. 1994) for 16 h to an OD530 = 5.
The bioreactor was operated in a fed-batch mode
at 30C, pH 5.5 (maintained with NH4OH and
H3PO4), rotational speed of 700 rpm and aeration
rate of 1 vvm. Upon depletion of glycerol as the
carbon source (20 h), 1 % (v/v) methanol was
added to the culture to induce the AOX1
promoter and production of recombinant tiGH
protein. After 4 h, methanol was added continu-
ously to maintain a concentration of 0.5 % (v/v)
within the culture. After 120 h the culture was
stopped. The cells pellet was analyzed by elec-
trophoresis and western bloting.
Electrophoresis and western blot analysis of
tiGH in Pichia pastoris cell pellet
To analyze the intracellular presence of tiGH
protein, cultures expressing tiGH were harvested
Biotechnol Lett (2007) 29:1671–1676
by centrifugation at 8000g for 15 min. Cells were
mechanically disrupted with glass beads. Cells
pellet (0.1 g) was resuspended in 250 ll of Lae-
mmli buffer (0.3 M NaCl; 5 mM EDTA; 1.15 mM
2-mercaptoethanol; 50 mM phosphate buffer, pH
7) and 1 g glass beads (diam. 0.5–0.75 mm) was
added. The cells were disrupted in a 1.5 ml
microcentrifuge tube using a vortex mixer at
2500 rpm. Seven passes of 2 min each with 1 min
intervals in ice were performed. Disrupted cells
were centrifuged at 8000 g for 15 min and the
supernatant discarded. The pellet was resupended
in 500 ll of phosphate buffered saline (PBS) and
500 ll of a solution containing 4% (w/v) SDS,
20% (v/v) glycerol, 10% (v/v) 2-mercaptoethanol,
0.125 M Tris/HCl buffer pH 6.9 were added,
followed by incubation for 20 min at 100C.
Samples were centrifuged at 8000 g for 15 min.
The supernatant comprises the soluble extract.
The soluble extract was subjected to SDS-PAGE
under reducing conditions. The separated pro-
teins were electro-transferred to a nitrocellulose
membrane. The tiGH protein was recognized
with an anti-tiGH monoclonal antibody conju-
gated with peroxidase. The blot was then devel-
oped with an enhanced chemiluminescence
(ECL) detection system (Amersham, USA).
Quantitative analysis of tiGH expression
The quantitative analysis of tiGH expression was
carried out by dot blot. Tilapia GH purified from
E. coli was used for the standard curve. The tiGH
protein was recognized using an anti-tiGH mono-
clonal antibody conjugated with peroxidase. The
blot was then developed with an ECL detection
system (Amersham, USA).
Growth-promoting effects by immersion
of tilapia fry into water containing
transformant Pichia pastoris
Tilapia fry (Oreochromis sp.) at 5 days post-
hatching (n = 500 for each group) were acclima-
tized in tanks (1800 l) with running fresh water for
one week prior to the experiment. Fish were fed at
libitum with a basal diet twice a day. Prior to
treatment the tanks were cleaned and the level of
the water was decreased to 900 l. Fish were
1673
immersed into water containing intact cells of
P. pastoris expressing growth hormone 0.1 mg
tiGH per liter of water. The treatment was done
for 90 min without water recirculation. This was
repeated three times in a week for 6 weeks.
Control fish were immersed into water containing
intact cells of non-transformed P. pastoris. Growth
promoting effect was evaluated by body weight
increase. Data were expressed as mean ± SD and
analyzed by a Student’s t-test.
Results and discussion
Molecular cloning of recombinant GH gene
and transformation of Pichia pastoris
The tilapia growth hormone cDNA was amplified
by PCR from plasmid pTTi previously con-
structed by Guillén et al. (1998). The expression
cassette (pP-tiGH vector) was constructed using
the promoter of the P. pastoris AOX1 gene,
which encodes for alcohol oxidase and the termi-
nation signal of glyceraldehyde-3P-dehydroge-
nase (GAPt) of S. cerevisiae. The 0.8 kb tiGH
cDNA was cloned as a NcoI-EcoRI fragment
between the AOX1 promoter and the GAP
terminator sequence (Fig. 1). The P. pastoris
pP-tiGH expression vector was linearized with
ClaI prior to transformation, to direct the inte-
gration of the expression cassette into the AOX1
locus, resulting in the substitution of the endog-
enous AOX1 structural gene. Southern blot
hybridization analysis of genomic DNA isolated
from three of the transformants showed that the
AOX1 structural gene was replaced by a single
copy of the expression cassette in two of them.
These transformants displayed a band of 2.8 kb
(Fig. 2), indicating the MutS phenotype (Cregg
and Malden 1987). All clones were selected for
the subsequent expression study.
Selection of high expression strain
and western blotting analysis
Upon induction with methanol, all clones
expressed an intracellular specific protein of
22 kDa similar to E. coli-derived tiGH. This
protein band was absent in untransformed MP36
123
1674
Fig. 2 Southern blot analysis of AOX1 loci in recombi-
nant and non-recombinant MP36 P. pastoris strains. The
filter was hybridized with a 32P-labeled AOX1 promoter-
cDNA tiGH probe obtained from the plasmid pP-tiGH by
digestion with the restriction endonuclease EcoRI. The
lines contain 10 lg of EcoRI digested chromosomal DNA
from selected transformants (C7, C9, C12) and MP36
(MP36-) strains
host cells. The yield of the recombinant protein
varied among the three clones analyzed. The
clone expressing the highest levels of tiGH was
named MP36/pP-tiGH12 and was selected for
further experiments. The SDS-PAGE and wes-
tern blot analysis showed that the 22 kDa protein
produced in the 5 l fermentor was recognized
specifically by a monoclonal anti-tiGH antibody.
The percentage of tiGH out of the total protein of
yeast content was 4.3%. The cellular density at
the end of growth was 200–300 g/l (Fig. 3). The
tiGH was 1.5–2 g/l as analyzed by dot-blot (data
not shown). This amount was higher than the
obtained for carp GH in P. pastoris (200 mg/l) (Li
et al. 2001).
Growth stimulation by immersion of red
tilapia fry (Oreochromis sp.) into water
containing recombinant Pichia pastoris
expressing tiGH
Tilapia fry were immersed into water containing
intact P. pastoris cells expressing tiGH at 0.1 mg
tiGH per liter water for 90 min. The exposure to
the recombinant yeast cells was repeated three
times in a week for 6 weeks. The growth rate of
tilapia receiving P. pastoris expressing tiGH was
higher (p < 0.01) than negative control (Fig. 4).
123
Biotechnol Lett (2007) 29:1671–1676
Fig. 3 Expression analysis of recombinant tiGH. (A)
SDS-PAGE (B) Western blot. The tiGH protein (indi-
cated with an arrow) was recognized using an anti-tiGH
monoclonal antibody conjugated with peroxidase. The blot
was then developed with an ECL detection system. Lane 1:
Correspond to the migration of standard molecular weight
markers. Lane 2: Bacterial protein extracts of induced
BL21 (DE3) cells expressing tiGH. Lane 3: Methanol-
induced MP36/pP-tiGH12 clone mechanically disrupted
with glass beads. Lane 4: Methanol-induced non-recombi-
nant MP36 mechanically disrupted with glass beads. Lane
5: E. coli-derived tiGH with a histidine tail purify by metal
affinity chromatography
The weight increase of the treated group was
171% relative to the negative control after
6 weeks.
Although it has been demonstrated the growth
promoting effect of recombinant GH in several
fish species by immersion into water containing
this hormone (Agellon et al. 1988; Moriyama and
Kawauchi 1990), this study is the first report
demonstrating a growth promoting effect using
P. pastoris intact cells expressing tiGH. The
percentage of weight increase in the tiGH treated
Biotechnol Lett (2007) 29:1671–1676
Fig. 4 Growth performance experiment by immersion of
tilapia fry into water containing intact recombinant tiGH
P. pastoris at the dose of 0.1 mg of tiGH per liter of water
(0.1 mg l–1). The treatment was done for 90 min three
times a week for 6 weeks. (A) Body weight increase at 2, 4
and 6 weeks from the beginning of the experiment. Data
were expressed as mean ± SD and analyzed by a Student’s
t-test. The growth rate of tilapia receiving P. pastoris
expressing tiGH was higher (p < 0.01) than negative
control after 6 weeks. (B) Phenotype of treated and
control fish at week 6; size given in cm
group is the highest so far reported in fish
compared to other administration procedures like
injection, dietary administration or immersion
into water containing purified recombinant GH
(Guillén et al. 1998; Moriyama and Kawauchi
1990; Tsai et al. 1993b). The absorption mecha-
nism of GH from water is still unknown.
Although Sherwood and Harvey (1986) showed
that gonadotropin-releasing hormone (GnRH)
appeared quickly in goldfish plasma after GnRH
application to gills. Radiolabeled-BSA can aslo
enter into gills and epidermis of rainbow trout
after its addition into water. Thus, a mechanism
may exist, probably in the gills, which allows the
absorption of GH in growth promoting concen-
trations (Moriyama and Kawauchi 1990). Since
1675
tilapia can eventually eat any kind of microor-
ganism present in the water, we hypothesized that
the fish would eat the yeast and the active
hormone is taken up or transported into the
intestinal cells.
Contrary to the time-consuming and laborious
work of injection (Baile et al. 1983; Chung et al.
1985), implantation (Cheng et al. 1998), and oral-
incubation (Hertz et al. 1991), immersion of fish
into tiGH-rich yeast preparations seems to be a
more efficient and safe way for GH administra-
tion. This approach not only requires less com-
plicated procedures like isolation of inclusion
bodies, renaturation and further processing of
tiGH, but also causes less stress to fish while being
treated.
In the present study, the fish itself is not
genetically modified. Besides, the use of growth
hormone to increase animal farm productivity
had been demonstrated before as a safe proce-
dure (Willard 2006). Therefore, we suggest that
the immersion of fish into recombinant GH-rich
intact yeast preparation is the simplest and
convenient method to promote growth in tilapia.
Acknowledgments The authors thank J. Garcı́a and L.
Varas for helping with the bioreaction.
References
Agellon LB, Emery CJ, Jones JM, Davies SL, Dingle AD,
Chen TT (1988) Promoting of rapid growth of
rainbow trout (Salmo gairdneri) by a recombinant
fish growth hormone. Can J Fish Aquat Sci 45:146–
151
Baile CA, Della-Fera MA, McLaughlin C (1983) Perfor-
mance and carcass quality of swine injected daily with
bacterially-synthesized human growth hormone.
Growth 47:225–236
Cheng WTK, Chen BC, Chiou ST, Chen CM (1998) Use of
nonautologous microencapulated Þbroblasts in
growth hormone gene therapy to improve growth of
midget swine. Hum Gene Ther 9:1995–2003
Chung CS, Etherton TD, Wiggins JP (1985) Stimulation of
swine growth by porcine growth hormone. J Anim Sci
60:118–130
Cregg JM, Malden KR (1987) Development of yeast
transformation system and construction of methanol
utilization defective mutants of Pichia pastoris by
disruption. In: Stewart G.G, Rusel I., Klein R.D,
Heibsch R.R. (eds.), Biological Research on Indus-
trial yeast, CRC Press, Boca Raton, FL, pp. 1–18
123
1676
Farmanfarmaian A, Sun LZ (1999) Growth hormone
effects on essential amino acid absortion, muscle
amino acid profile, N-retention and nutritional
requirement of stripe bass hybrids. Genet Anal
Biomol Eng 15:107–113
Guillén II, Lleonart R, Agramante A, Morales R, Morales
A, Hernández CA, Vázquez MM, Dı́az M, Herrera
MT, Álvarez-Lajonchere L, Hernández O, de la
Fuente J (1998) Physiological changes in the juvenile
euryhaline teleost, the tilapia Oreochromis hornorum,
injected with E. coli-derived homologous growth
hormone. J Mar Biotechnol 6:142–151
Hertz Y, Tchelet A, Madar Z, Gertler A (1991) Absorp-
tion of bioactive human growth hormone after oral
administration in the common carp and its enhance-
ment by deoxycholate. J Comp Physiol 161:159–163
Li YH, Bai JJ, Li XH, Ye X, Jian Q, Luo JR, Liang XF
(2001) Expression of common carp growth hormone
in yeast P. pastoris. Chin J Biochem Mol Biol 17:488–
491
Martı́nez E, Garcı́a C, Grillo JM (1993) Rapid transfor-
mation of non-Saccharomyces yeast by electropora-
tion. Biotechnol Tech 7:895–896
Moriyama S, Kawauchi H (1990) Growth stimulation of
juvenile salmonids by immersion in recombinant
salmon growth hormone. Nippon Suisan Gakkaishi
56:31–34
Rodrı́guez M, Rubiera R, Penichet M, Montesino R,
Cremata J, Falcón V, Sánchez G, Bringas R,
Cordovés C, Valdés M, Lleonart R, Herrera L, de la
Fuente J (1994) High level expression of the Boophi-
123
Biotechnol Lett (2007) 29:1671–1676
lus microplus Bm86 antigen in the yeast Pichia
pastoris forming highly immunogenic particles for
cattle. J Biotechnol 33:135–146
Sherwood NM, Harvey B (1986) Topical absorption of
gonadotropin-releasing hormone (GnRH) in goldfish.
Gen Comp Endocrinol 61:13–19
Silverstein JT, Wolters WR, Shimizu M, Dickhoff WW
(2000) Bovine growth hormone treatment of channel
catfish: strain and temperature effects on growth,
plasma IGF-I levels, feed intake and efficiency, and
body composition. Aquaculture 190:7–88
Tsai HJ, Chi WK, Chang CC, Kuo TT, Chang CF (1993b)
Enhancement of tilapia growth by dietary adminis-
tration of recombinant yeast lysates as a supplement. J
Fish Soc Taiwan 20:339–345
Tsai HJ, Tseng CF, Kuo TT (1993a). Expression of
rainbow trout growth hormone cDNA in yeast. Bull
Inst Zool Acad Sin 32:162–170
Tschopp JF, Sverlow R, Kosson R, Craig W, Grinna L
(1987) High level secretion of glycosylated invertase
in the methylotrophic yeast, Pichia pastoris. Bio/
Technol 5:1305–1308
Willard CL (2006) Welfare effects of the use of recombi-
nant bovine somatotropin in the USA. J Dairy Res
14:1–12
Yong V, González ME, Herrera L, Delgado J (1992) HIS-
3 gene of Saccharomyces cerevisiae complement his
mutation in yeast Pichia pastoris. Biotecnologı́a
Aplicada 9:55–61