Annals of Microbiology, 58 (2) 233-238 (2008)

Expression of recombinant Pichia pastoris X33 phytase

for dephosphorylation of rice bran fermented liquid

Ming-Hui CHANG1, Chiu-Chung YOUNG*2, Shiuan-Yuh CHIEN1, A.B. ARUN2

1
Agricultural Chemistry Division, Agricultural Research Institute, Wufeng, Taichung, Taiwan; 2College of Agriculture and
Natural Resources, Department of Soil and Environmental Sciences, National Chung Hsing University, 250 Kuo Kuang Rd.,
Taichung, 402 Taiwan, ROC

Received 5 December 2007 / Accepted 3 April 2008

Abstract - The Aspergillus ficuum phytase gene phyA was overexpressed in Pichia pastoris X33 after replacing Buffered
glycerol-complex medium (BMGY medium) using 1% (v/v) glycerol with fresh Buffered methanol-complex medium
(BMMY medium) using 1% (v/v) methanol (on daily basis) as carbon sources. The phytase activity increased evidently
with the induction time, and reached 200 U mL-1 after 9 days of induction. We examined the possibility of employing thus
obtained phytase to recover phosphorus from the fermented liquid of rice bran. When the 0.1 M sodium acetate buffer
was replaced with de-ionised water (pH 5.5 ± 0.1) as an enzyme reaction solution, there was an increase in the pho-
sphorus recovery with respect to time and reached 1.31% after 24 h incubation contributing to 81% release of inorga-
nic P from the rice bran phytate. Studies on hydrolysis of rice bran phytate by the addition of different concentrations of
phytase ranging from 0-200 U mL-1 produced through the recombinant yeast shows no significant effect in the rate of
phytate hydrolysis at enzyme activities of 200, 100, 50 U mL-1. However, rate of hydrolysis varied significantly at 20, 5,
0 U mL-1 enzyme concentrations.

Key words: phytase, Pichia pastoris X33, phosphorus, rice bran, SDS-PAGE.

INTRODUCTION ing an efficient strain of methylotrophic recombi-

Cereals and legumes contain abundant phytic acid
(myo-inositol hexakisphosphate), the major storage
form of phosphorus (Reddy et al., 1982). Phytate-
phosphate in plant-derived foods and feeds are
poorly available to humans and monogastric ani-
mals, such as swine and poultry (Erdman et al.,
1989). Phytic acid is also regarded as an anti-nutri-
tional factor since it easily forms insoluble complex-
es with proteins and binds to several of metal ions
such as calcium, magnesium, iron, and zinc, there-
by, decreasing the bioavailability of phosphorus
(Maga, 1982; Rimbach et al., 1994). Phytases are
phosphohydrolases that can hydrolyze phytic acid
into less-phosphorylated myo-inositol derivates and
free orthophosphoric acid. Microbial phytase
enzymes are commonly used as additives in animal
feeds to enhance the bioavailability and to reduce
the nutritional and environmental problems associ-
ated with phytate (Lei et al., 1993). However, the
higher production cost of phytase limits its wide-
spread use. This limitation was resolved by design-
Corresponding author. Phone: 886-4-22861495; Fax:
886-4-22861495;
E-mail: ccyoung@mail.nchu.edu.tw
nant yeast via genetic engineering in addition to the
optimisation of cultivation conditions. This method
helped to increase the phytase yield and reduced
the production cost (Han and Lei, 1999; Mayer et
al., 1999; Chen et al., 2004). Since the properties
and yield of a phytase are significantly affected by
the expression capability of hosts and their post-
translational modifications, such as glycosylation, a
number of expression hosts and systems have been
tested for improving phytase function and produc-
tion (Haefner et al., 2005). The Pichia pastoris
expression system has been successfully used for
production of various recombinant heterogeneous
proteins (Zhang et al., 2007). Aspergillus niger,
capable of producing phytase (Shieh and Ware,
1968; Howson and Devis, 1983) and its gene phyA,
have been cloned, sequenced (Van Hartingsveldt et
al., 1993) and successfully expressed in Pichia pas-
toris X33, a methylotrophic yeast. Pichia pastoris
-1
X33 produced higher levels of phytase (64 U mL )
at 108 h after methanol induction (Han and Lai,
1999). The hydrolysis of phytate present in native
seeds that were used as feed-additives, by phytase
has been attempted earlier (Han and Wilfred, 1988;
Quan et al., 2001).
234
Rice bran contains abundant phytate that can
be hydrolysed to inorganic phosphate using phy-
tase. The released inorganic phosphate can be sub-
stituted in expensive commercial phosphate fertilis-
er in agriculture. However the major limitation step
is hydrolysis of phytate, which demands the addi-
tion of sodium acetate solution (pH 5.5) as a buffer-
ing agent. Although this method appears attractive,
neither is economical nor environmentally safe for
liquid fertiliser production.
The major objectives of this study was to
express the phytase gene (phyA) of less investigat-
ed member of the genus Aspergillus, A. ficuum
(BCRC 32870) in recombinant Pichia pastoris X33 to
enhance the recovery of phosphorus in rice bran
derived liquid fertiliser.
MATERIALS AND METHODS
Construction of recombinant strains. For
obtaining the recombinant Pichia pastoris the phy-
tase gene phyA of Aspergillus ficuum (BCRC 32870)
was amplified by PCR using primers (upstream,
5’CGGAATTCCTGGCAGTCCCCG3’; downstream,
5’GCTCTAGACTAAGCAAACACTCC3’) (Han and Lei,
1999). The amplified fragment was cloned to EcoRI
and XbaI sites of pPICZ αA (Invitrogen, San Diego,
FIG. 1 - Schematic diagram of culture and enzyme extraction conditions of recombinant Pichia pastoris X33.
M.-H. CHANG et al.
CA). The ligation mixture was transformed into E.
coli DH5α and plated on a low salt LB agar plates
-1
containing 25 µg mL zeocin. Thus constructed
plasmid was purified and linearised with PmeI and
transformed to Pichia pastoris X33 (Invitrogen) by
electroporation using EasyjecT PLUS (Equibio Ltd,
UK). The phytase-producing transformant was used
for further analysis.
Chemicals, culture media and solutions used.
The phytic acid dodecasodium salt and YNB (Yeast
nitrogen base without amino acids and ammonium
sulphate) were purchased from Sigma, while all
other chemicals used were purchased from Merck.
Rice bran was purchased from a local supplier in
Taiwan. The BMGY medium contained 1% yeast
extract, 2% peptone, 100 mM potassium phosphate
-1
(pH 6.0), 1.34% YNB, 0.4 µg mL biotin, 1% glyc-
erol. The BMMY medium used in this study was sim-
ilar to BMGY medium except 1% glycerol in BMGY
medium was replaced by 1% methanol in BMMY. As
the optimal pH required for the expression of phyA
phytase of Pichia pastoris X33 was 5.5 (Han and Lei,
1999), to compare the efficiency of hydrolysis of
rice bran phytate by the recombinant Pichia pastoris
X33 phytase, de-ionised water and 0.1 M sodium
acetate buffer were adjusted to pH 5.5 before use.
Ann. Microbiol., 58 (2) 233-238 (2008)
Growth of recombinant Pichia pastoris X33.
The schematic diagram of culture and enzyme
extraction conditions of recombinant P. pastoris X33
is presented as Fig. 1. Briefly, single colony of
recombinant P. pastoris X33 was selected from the
plates and transferred to 25 ml of BMGY medium in
a 125 ml baffled flask and incubated at 30 °C with
200 rpm for 24 h. One mL of this seed culture was
subsequently inoculated to a 100 mL of BMGY medi-
um in a 250 mL baffled flask and conditions men-
tioned above were maintained. After 48 h of inocu-
lation, cells were harvested by centrifugation (3000
x g for 5 min at 4 °C), and the pellet was resus-
pended in 100 mL of sterile de-ionised water. The
pellet was centrifuged, and resuspended in 100 mL
of BMMY medium. After 24 h of incubation at 30 °C
with 200 rpm, 1 mL of culture media was trans-
ferred to a 1.5 mL Eppendorf microfuge tubes and
centrifuged at 18000 x g for 3 min at 4 °C. The
supernatant or enzyme extract obtained was stored
at –80 °C for phytase activity and SDS-PAGE analy-
ses. Further, 1 mL of 100% methanol was added to
100 mL of BMMY medium each day (9 days) to
maintain the final concentration of 1% methanol for
inducing phytase expression. The final culture after
9 days induction was transferred to 250 mL cen-
trifuge bottle and centrifuged at 3000 x g for 15 min
at 4 °C, the supernatant was collected and stored at
-80 °C for further assays.
Phytase assay. Phytase activity was measured by
the method previously described (Shimizu, 1992;
Bae et al., 1999) with slight modification. The
method was modified to determine the amount of
inorganic phosphate released by the enzyme using
sodium phytate as substrate. Briefly, the reaction
mixture containing 300 µL of 1.5 mM sodium phy-
tate in 0.1 M sodium acetate buffer (pH 5.5) and 75
µL of crude phytase extract was incubated at 37 °C
for 20 min. The reaction was stopped by the addi-
tion of 375 µL of 5% (w/v) trichloroacetic acid. The
inorganic phosphate released was measured after
the addition of 375 µL of freshly prepared coloured
reagent, which was prepared by mixing of 1.5%
(w/v) ammonium molybdate in a 5.5% (v/v) sul-
phuric acid and 2.7% (w/v) ferrous sulphate solu-
tion (4:1). The absorbance was measured at 700
nm. Simultaneously, the crude phytase extract inac-
tivated by the addition of 375 µL of 5% (w/v)
trichloroacetic acid was used as blank and all other
conditions were similar to that followed for experi-
mental group. Similarly, a blank treatment contain-
ing equal volume of sterile de-ionised water instead
of enzyme extract was also taken as control. In both
control sets no blue color was developed, indicating
that the TCA and assay reagent are unable to
hydrolyze the phytic acid and release inorganic
phosphate. One unit (U) of phytase activity was
defined as that releases 1 µmol inorganic phosphate
235
from sodium phytate per minute at pH 5.5 and 37 °C.
SDS-PAGE analysis. SDS-PAGE analysis of crude
phytase extracts at different induction time was
performed using 10% acrylamide as running gel
and 5% acrylamide as stacking gel. The phytase
was stained with Coomassie brilliant blue R250 and
photographed.
Deglycosylation of expressed phytase. The
crude phytase extracts that were collected after 1,
3, 6, 9 days of methanol induction were treated
separately with 0.35 IU of endoglycosylase H (Endo
Hf; New England Biolabs, Beverly, MA). The reaction
mixture was incubated at 37 °C for 1 h. The SDS-
PAGE analyses of the phytase before and after deg-
lycosylation were compared.
Rice bran dephosphorylation by the expressed
phytase in sodium acetate buffer and de-
ionised water conditions. In vitro hydrolysis of
rice bran phytate was carried out (Quan et al.,
2001) with slight modifications. The rice bran con-
tained 1.57% of total P consisting of 76.4% of phy-
tate P. In brief, 10 g of autoclaved rice bran (1 h at
121 °C) was suspended in 100 mL of de-ionised
water (pH 5.5 ± 0.1) and 0.1 M sodium acetate
buffer solution (pH 5.5) separately and incubated
-1
with 1 mL of crude enzyme extract (200 U mL ) at
37 °C on a rotary shaker (110 rpm) for 24 h. The
reaction was stopped by the addition of equal quan-
tity of 10% (w/v) trichloroacetic acid. The control
group was similar to the experimental group with an
exception that crude phytase extract was inactivat-
ed with trichloroacetic acid prior to reaction.
Similarly, a blank treatment was taken, where
enzyme extract was replaced with an equal volume
of sterile de-ionised water. The samples were col-
lected at 0, 12 and 24 h. In addition, hydrolysis of
rice bran phytate was studied after incubation for
different time intervals (0, 1, 3, 6, 9, 12, 16, 20 and
24 h) using de-ionised water (pH 5.5 ± 0.1) instead
of 0.1 M sodium acetate buffer solution to study the
minimum time required for the maximum activity.
Optimisation of the phytase activity for the
dephosphorylation. Hydrolysis of rice bran phy-
tate-phosphorous was compared among six differ-
ent dilutions of phytase extracts (200, 100, 50, 20,
-1
5, 0 U mL ) in 0.1 M sodium acetate buffer (pH
5.5). All the methods adopted here were similar to
the above experiment with an exception of the
enzyme concentrations.
Statistical analysis. All the experiments were in
triplicates and the differences between the treat-
ment means were analysed by students T-test at
5% level.
236 M.-H. CHANG et al.

RESULTS AND DISCUSSION

Expression of recombinant Pichia pastoris X33

The expression of Aspergillus ficuum phyA gene in
Aspergillus niger and its detailed characterisation
has been reported earlier (Ullah and
Sethumadhavan, 2003) and functional expression
of an Aspergillus niger phytase (phyA) in Pichia
pastoris was studied in detail by Han and Lai
(1999). Apart from this, no detailed characterisation
of phytase gene phyA are available on the ability of
other members of the genus Aspergillus. In this
study we used A. ficuum phytase gene phyA to
over-express in methylotrophic yeast Pichia pastoris
FIG. 2 - Expression of phytase activity by the recombinant
X33, after replacing BMGY medium containing 1%
Pichia pastoris X33 after replacement of BMGY
(v/v) glycerol with fresh BMMY medium containing media with BMMY media and 1% methanol induc-
1% (v/v) methanol (on daily basis) as carbon sour- tion in the baffled flask.
ces. The phytase activity increased significantly with
-1
the induction time and reached 200 U mL after 9
days of induction (Fig. 2). Total concentration of A
phytase obtained using recombinant Pichia pastoris kDa M 1 2 3 4 5 6 7 8 9
in our study was higher than the phytase concentra- 200
tion recorded in an earlier study using the same
phytase gene phyA (Han and Lai, 1999). Similar 97
66
observations on the increased induction of phytase
was also recorded when the methylotrophic yeast P. 45
pastoris was used for heterologous expression of
the E. coli phytase gene appA (Chen et al., 2004).
The appA gene was cloned under the control of the
B
kDa M 1 2 3 4 5 6 7 8
AOX1 promoter, which was overexpressed when
200
methanol was used as a sole source of carbon. Quan
et al. (2001) reported that a novel yeast Candida 97
krusei showed maximum enzyme activity of 3.5 U 66
-1
mL . But, in this study we report a several fold 45
increase in the enzyme production by the recombi-
nant P. pastoris X33.
The intensity of phytase production analysed FIG. 3 - SDS-PAGE analysis of the crude phytase extracts.
using SDS-PAGE correlated significantly with induc- A: Different induction time before/without
tion time (Fig. 3A) indicating that methanol induc- deglycosylation by Endo Hf. Lane M: protein
molecular weight marker. Lanes 1-9: induction
tion was vital for the expression of phytase. The
of phytase from day 1-9. Results are represen-
bands obtained on the SDS-PAGE (Fig. 3A) were
tative of three experiments. B: Treatment with
less intense and larger than that of A. niger (80 and without endoglycosylase by Endo Hf. Lane
kDa), possibly due to the glycosylation of phyA phy- M: protein molecular weight marker. Lanes 1, 3,
tase. However, after deglycosylation with Endo Hf, a 5 and 7 samples after 1, 3, 6 and 9 days of
sharp band of about 55 kDa was visualised (Fig. induction. Lanes 2, 4, 6 and 8 the samples trea-
3B). Molecular weight of this band was identical to ted with Endo Hf.
the band obtained in an earlier study (Han and Lai,
1999). Intensity of these bands increased notably treatments during different time intervals (0, 12
with induction time. and 24 h) (Table 1). Only an insignificant change in
the pH value was observed in the de-ionised water
Comparison between the rates of enzymatic added rice bran, after prolonged incubation period
hydrolysis of rice bran phytate in sodium (data not shown). In addition, the concentration of
acetate buffer and de-ionised water inorganic phosphorus increased significantly with
Enzymatic hydrolysis of rice bran phytate phospho- time and at the end of 24 h after incubation concen-
rous requires a pH of 5.5. Generally 0.1 M sodium tration reached 1.31% compared to 0.3% P in con-
acetate buffer is being used for this purpose. When trol (Fig. 4). This amounted to 81% recovery of
0.1 M sodium acetate buffer was replaced with de- inorganic P from the rice bran phytate P. However,
ionised water (pH 5.5), no significant difference was the TCA inactivated enzyme and sterile de-ionised
observed in the rate of hydrolysis between two water controls did not show any hydrolysing activi-
Ann. Microbiol., 58 (2) 233-238 (2008) 237

TABLE 1 - Concentration of inorganic phosphorus hydrolysed in rice ties. Above results indicate that equivalent amounts
bran after incubation of crude phytase extract with De-
H2O and 0.1 M acetate buffer as reaction solutions at dif-
of phosphorus can be hydrolysed from rice bran
ferent time intervals phytate by recombinant P. pastoris X33 phytase
after replacing 0.1 M sodium acetate buffer with de-
Solution Phosphorus content (%)
ionised water (pH 5.5) without producing any objec-
Crude phytase extract* Control**
tionable odour and microbial contamination.
Incubation (0 h) Simulation of the digestive tract conditions for
De-H2O 0.32 ± 0.01 0.30 ± 0.00 biodegradation of phytate using a novel yeast
Acetate buffer 0.1 M 0.31 ± 0.01 0.28 ± 0.00
Candida krusei was attempted (Quan et al., 2001).
Incubation (12 h) Concentration of phosphorus recorded using that
De-H2O 1.04 ± 0.00 0.30 ± 0.02 condition was only 0.8% after 12 h, which is lower
Acetate buffer 0.1 M 0.98 ± 0.03 0.28 ± 0.00 than P released by the recombinant P. pastoris X33
of our study irrespective of the media used (de-
Incubation (24 h)
ionised water or sodium acetate).
De-H2O 1.31 ± 0.04 0.33 ± 0.01
Acetate buffer 0.1 M 1.20 ± 0.03 0.34 ± 0.01
Optimisation of phytase activity for hydrolys-
* 20 U g-1 rice bran. **Control represents inactivated enzyme. No
significant difference was observed when enzyme blank was ing the phytate to inorganic P from rice bran
replaced with sterile de-ionised water as control. Wet sterilisation (autoclaving) of the rice bran did
not dephosporylate the phytate. No significant dif-
ference was observed between the amount of
hydrolysed P (1.16%) after 24 h incubation with
-1
enzyme concentrations of 200, 100 and 50 U mL
while, significant decline in hydrolysis of inorganic P
-1
was recorded when 20 and 5 U mL enzyme con-
centrations were used (Fig. 5). Enzyme concentra-
-1
tion as low as 5 U mL showed significantly higher
levels of P released (0.93%) compared to the con-
trol. No significant difference between the levels of
P released in the sterile de-ionised water-only blank
and inactivated control was observed (data not pre-
sented).
In conclusion, recombinant P. pastoris X33
phytase gene expression can be enhanced by
FIG. 4 - Hydrolysis of rice bran phytate-phosphorous by choosing methanol as the carbon source during the
recombinant Pichia pastoris X33 phytase after induction period. Recombinant P. pastoris X33 also
incubating at different time intervals. Control
represents inactivated enzyme. No significant
has a potential to enhance phytase production, if
difference was observed when enzyme blank was methanol controller is altered in the fermentation
replaced with sterile de-ionised water as control. process, which has been already shown by Chen et
al. (2004). Fermentation of rice bran for the enzy-
matic hydrolysis of phytate can be simplified by
selecting de-ionised water at pH 5.5. Efficiency of
the recombinant P. pastoris X33 phytase is very
high and 81% of the phytate P was released from
the rice bran within 24 hours of incubation with the
crude enzyme extract.

Acknowledgements
Financial support from Council of Agriculture,
Executive Yuan, Republic of China (Grant No. 92AS-
4.2.3-CI-C1; 93AS-4.2.1-CI-C1) is gratefully
acknowledged.

REFERENCES

Bae H.D., Yanke L.J., Cheng K.J. Selinger L.B. (1999). A

novel staining method for detecting phytase activity. J.
Microbiol. Methods, 39: 17-22.
FIG. 5 - Effect of different phytase concentrations on the inor- Chen C.C., Wu P.H., Huang C.T., Cheng K.J. (2004). A
ganic phosphorus released from rice bran phytate. Pichia pastoris fermentation strategy for enhancing the
238
heterologous expression of an Escherichia coli phytase.
Enzyme Microbiol. Technol., 35: 315-320.
Erdman L.W., Poneros S.K. (1989). Phytic acid interaction
with divalent cations in foods and in the gastrointesti-
nal tract. Adv. Exp. Med. Biol., 249:161-171.
Han Y., Lei X.G. (1999). Role of glycosylation in functional
expression of an Aspergillus niger phytase (phyA) in
Pichia pastoris. Arch. Biochem. Biophys., 364:83-90.
Han W.Y., Wilfred, A.G.. (1988). Phytate hydrolysis in soy-
bean and cottonseed meals by Aspergillus ficuum phy-
tase. J. Agric. Food Chem., 36:259-262.
Haefner S., Knietsch A., Scholten E., Braun J., Lohscheidt
M., Zelder O. (2005). Biotechnological production and
applications of phytases. Appl. Microbiol. Biotechnol.,
68:588-597.
Howson S. J., Davis R. P. (1983). Production of phytate-
hydrolysing enzyme by some fungi, Enzyme Microb.
Technol., 5:377-382.
Lei X.G.., Ku P.K., Miller E.R., Yokoyama M.T. (1993).
Supplementing corn-soybean meal diets with microbial
linearly improves phytate P utilization by weanling
pigs. J. Anim. Sci., 71: 3359-3367.
Maga J.A. (1982). Phytate: its chemistry, occurrence, food
interactions, nutritional significance, and methods of
analysis. J. Agric. Food Chem., 30:1-9.
Mayer A.F., Hellmuth K., Schlieker H., Lopez-Ulibarri Oertel
R. S., Dahlems U., Strasser, A. W. M., van Loon A. P. G.
M. (1999). An expression system matures: a highly
efficient and cost-effective process for phytase produc-
tion by recombinant strains of Hansenula polymorpha.
Biotech. Bioeng., 63:373-381.
M.-H. CHANG et al.
Reddy N.R., Sathe S.K., Salunkhe D.K., (1982). Phytates
in legumes and cereals. Adv. Food Res., 28:1-92.
Rimbach G.H., Ingelmann J., Pallauf J. (1994). The role of
phytase in the dietary bioavailability of minerals and
trace elements. Ernahrungsforschung. 39:1-10.
Shieh E.T., Ware J.H. (1968). Survey of microorganisms
for the production of extracellular phytase. Appl
Microbiol., 16:1348-1351.
Shimizu, M. (1992). Purification and characterization of
phytase from Bacillus subtilis (natto) N-77. Biosci.
Biotechnol. Biochem., 56:1266-1269.
Quan C.L., Zhang Y., Wang Y., Ohta Y. (2001). Production
of phytase in low phosphate medium by a novel yeast
Candida krusei. J. Biosci. Bioeng., 92:154-160.
Ullah A.H.J., Sethumadhavan K. (2003). PhyA gene prod-
uct of Aspergillus ficuum and Peniophora lycii produces
dissimilar phytases. Biochem. Biophy. Res. Commun.,
303: 463–468.
Van Hartingsveldt W., van Zeijl C.M.J.G.M., Harteveld M.,
Gouka R.J., Guykerbuyk Luiten M.E.G., van Paridon
R.G.M.M., Selten G.C., Veenstra A.E., van Gorcom
R.F.M., van den Hondel C.A.M.J.J. (1993). Cloning,
characterization and expression of the phytase-encod-
ing gene phyA of Aspergillus niger. Gene. 127; 87-94.
Zhang Y., Liu R., Wu X. (2007). The proteolytic systems
and heterologous proteins degradation in the methy-
lotrophic yeast Pichia pastoris. Ann. Microbiol., 57:
553-560.