PDF hosted at the Radboud Repository of the Radboud University

Nijmegen

The following full text is a publisher's version.

For additional information about this publication click this link.

http://hdl.handle.net/2066/175269

Please be advised that this information was generated on 2023-02-21 and may be subject to
change.
Immunometabolic pathways
regulating innate immune
adaptation

Rob Johannes Wilhelmus Arts

Colofon
The research presented in this thesis was performed at the Department of Internal
Medicine in the Radboud University Medical Center, The Netherlands.
The production of this thesis was financially supported by Radboud University
Nijmegen.

Copyright © 2017, Rob Johannes Wilhelmus Arts. All rights reserved. No part of this
thesis may be reproduced, stored in a retrieval system or transmitted in any form or
by any means without the prior written permission of the copyright owners.

ISBN
978-94-9238-045-6

Printed by
Proefschrift-AIO
Immunometabolic pathways
regulating innate immune
adaptation

Proefschrift
ter verkrijging van de graad van doctor
aan de Radboud Universiteit Nijmegen
op gezag van de rector magnificus prof. dr. J.H.J.M. van Krieken,
volgens besluit van het college van decanen
in het openbaar te verdedigen op

donderdag 31 augustus 2017

om 14.30 uur precies

door

Rob Johannes Wilhelmus Arts

geboren op 22 juli 1988
te Venray
Promotoren
Prof. dr. M.G. Netea
Prof. dr. R. van Crevel
Prof. dr. L.A.B. Joosten

Manuscriptcommissie
Prof. dr. I. Joosten
Prof. dr. R.W. Sauerwein
Prof. dr. T.H.M. Ottenhoff (Universiteit Leiden)

Paranimfen
Drs. L.C.J. de Bree
R.H.A.C. Rademakers, MSc
 “Man’s mind is his basic tool of survival. Life is given to him,
survival not. His body is given to him, its sustenance is not.
His mind is given to him, its content not. To remain alive, he
must act, and before he can act he must know the nature
and purpose of his action. He cannot obtain his food without
a knowledge of food and of the way to obtain it. He cannot
dig a ditch -or build a cyclotron- without a knowledge of his
aim and of the means to achieve it. To remain alive, he must
think.”

Ayn Rand,
Atlas shrugged
Table of contents

Chapter 1 General introduction and outline of the thesis 9

Part I: Trained Immunity induced by BCG

Chapter 2 Long term in vitro and in vivo effects of γ-irradiated BCG on

innate and adaptive immunity 19
J Leukoc Biol 2015;6:995-1001

Chapter 3 Gamma-irradiated bacille Calmette-Guérin vaccination does

not modulate the innate immune response during
experimental human endoxemia in adult males 33
J Immunol Res 2015;2015:261864

Chapter 4 Vitamin A induces inhibitory histone methylation modifications

and down-regulates trained immunity in human monocytes 49
J Leukoc Biol 2015;1:129-36

Chapter 5 Bacillus Calmette Guérin-induced trained immunity reduces

yellow fever vaccine viraemia 67
Submitted

Chapter 6 Trained innate immunity as underlying mechanism for the

long-term, non-specific effects of vaccines 83
J Leukoc Biol 2015;3:347-56

Part II: Immunometabolic Pathways in Trained Immunity

Chapter 7 Immunometabolic pathways in BCG-induced trained immunity 105

Cell Reports 2016;17:1-10

Chapter 8 Glutaminolysis and fumarate accumulation integrate immuno-

metabolic and epigenetic programs in trained immunity 131
Cell Metab 2016;24:1-13
Chapter 9 The mevalonate pathway drives metabolic and epigenetic
reprogramming during induction of trained immunity 161
Submitted

Chapter 10 Broad defects in the energy metabolism of leukocytes

underlie immunoparalysis in sepsis 185
Nat Immunol 2016;4:406-13

Chapter 11 Transcriptional and metabolic reprogramming induce an

inflammatory phenotype in non-medullary thyroid
carcinoma-induced macrophages 213
Oncoimmunol 2016;12:e1229725

Chapter 12 Immunometabolic circuits in trained immunity 241

Semin Immunol 2016;5:425-30

Chapter 13 General discussion 255

Chapter 14 Nederlandse samenvatting 271

Chapter 15 Epilogue 279

Acknowledgements, List of publications, Curriculum vitae
 Chapter 1

General introduction and outline of thesis

Chapter 1

The immune system is typically divided into innate and adaptive immunity. T-
and B-lymphocytes mediate the adaptive immune responses, while monocytes,
macrophages, neutrophils, and NK-cells are considered to be the main cellular
effectors of innate immunity. It is generally thought that only the adaptive immune
responses can build immunological memory, while this property is missing from
the cells of innate immune responses. However, this paradigm has recently been
challenged. In recent years there is increasing evidence showing that also the
innate immune system possesses adaptive characteristics (1). Interestingly, in non-
vertebrates and even plants, both lacking an adaptive immune system, it has already
been known for several decades that a memory response can be built, protecting from
secondary infections (2). Interestingly, in contrast to adaptive immune responses,
the innate immune memory (also called trained immunity) is not strictly specific, as
infection with one pathogen often also protects from other non-related pathogens
(3). The molecular substrate for the induction of trained immunity has been shown to
be epigenetically regulated (4).
During the last few years it was shown that human monocytes and macrophages
can build trained immunity after certain infections or vaccinations. When monocytes
are exposed in vitro for 24h to microbial structures such as β-glucan (a component
of the Candida albicans cell wall) or muramyl dipeptide (MDP) or to the tuberculosis
vaccine BCG, and a week later restimulated with non-related pathogens, they display
a significant increase in cytokine production (5, 6). This non-specific memory was
shown to be the result of a rearranged epigenetic landscape of these cells. Improved
DNA accessibility due to histone modifications leads to increased capacity of the
cells to respond with gene transcription (6-8). Also in mice, an in-vivo challenge with
β-glucan protected from a subsequent S. aureus challenge (5, 9, 10), and infection
with cytomegalovirus improved effector function of NK-cells (11). Similar effects were
reported in vivo in young infants vaccinated with Bacillus Calmette-Guérin (BCG),
who showed non-specific protection from all-cause mortality, mainly as a result of
reduced mortality due to neonatal sepsis and respiratory tract infections (12, 13). To
further assess this effect of BCG vaccination, and to determine whether this could be
the result of modulation of the innate immune system, healthy volunteers received
the BCG vaccine and ex-vivo cytokine responses of PBMCs were assessed at later
time points. In this well-controlled setting, innate cytokine production was increased
after vaccination as a result of epigenetic reprogramming in myeloid cells (6).
Taking these data together, this shows that the innate immune system is able to
adapt through functional and epigenetic reprogramming, a process termed trained
immunity or innate immune memory (1, 14). Trained immunity can be considered an
important host defense mechanism contributing to and mediating the maturation of
the innate immune system of infants and mediating protection after certain infections

10 |
 1
Introduction

or vaccinations. On the other hand, one should however not underestimate that when
induced inappropriately, trained immunity might also play a role in the pathogenesis
of autoinflammatory diseases or atherosclerosis (1, 14, 15). Better understanding of
the molecular mechanisms of trained immunity is crucial for designing novel more
effective vaccines, as well as developing new ways of immunotherapy and targeting
inflammatory disorders (1).
In this thesis I will examine in the first place the immunomodulatory effect of the
BCG vaccine on the innate immune system in humans. So far it was only shown
that BCG vaccination increases cytokine production by epigenetic modulation
of monocytes. Whether this indeed results in an infectious-disease protective
phenotype and whether this can be applied in e.g. immune compromised patients,
will be examined in the first part of this thesis. In the second part of this thesis
I will investigate the mechanisms that underlie the induction of trained immunity,
with a focus on the interaction between immune and metabolic pathways. Since,
by understanding which molecular mechanisms are important for the induction of
trained immunity, these pathways could specifically be enhanced or inhibited to
induce or inhibit trained immunity in certain disease processes.

Induction of trained immunity by BCG in humans

As BCG is a live-attenuated vaccine it cannot be used in patients with immune
deficiencies. In order to tackle this problem, I will assess the immunomodulatory
potential of γ-irradiated BCG (γBCG): can it induce similar specific and trained
immunological memory as the normal BCG vaccine? I therefore γ-irradiated the
vaccine and tested its ability to induce trained immunity. In Chapter 2 I will examined
the capacity of γBCG to induce trained immunity in vitro, as well as in vivo in a
vaccination trial in healthy volunteers. Furthermore, in Chapter 3 I will investigate
the capacity of γBCG to restore immune function in an experimental human model of
LPS-induced tolerance (immunoparalysis), used as a model for sepsis.
WHO recommends high-dose vitamin A supplementation in countries at risk of
vitamin A deficiency (16). Observational data suggest that vitamin A might have non-
specific effects itself as well, just as seen for BCG (17). In Chapter 4 I will therefore
assess the non-specific effects of vitamin A on monocytes and macrophages and
examine whether vitamin A influences the induction of trained immunity by BCG.
This might give important clues for vitamin A supplementation policy and future trials.
It is hypothesized that BCG-induced trained immunity can protect against infections
with non-related pathogens, based on the observational data and the immunological
results so far. In order to test this hypothesis in a controlled setting, in Chapter 5 we
will use yellow fever vaccination as a human infection model, as vaccination with this
live-attenuated vaccine will result in viraemia. Healthy volunteers will be vaccinated

| 11
Chapter 1

with placebo or the BCG vaccine and a month later challenged with the yellow fever
vaccine. The in-vivo effects of BCG on a viral infection will be assessed, and how
these correlate with the in-vivo induction of trained immunity. This would be the first
trial examining the link between the induction of trained immunity and an infection in
an in-vivo human situation.
In Chapter 6 I will review the (potential) non-specific effects of all commonly
administered vaccines and discuss the potential effects of changes in the current
schedule.

Mechanisms for the induction of trained immunity: the interaction between

immune and metabolic pathways
In recent years it has become clear that cellular metabolism is crucial for the
functional state of immune cells (18). This started with the observation that different
lymphocyte subsets display markedly different activation of metabolic pathways (19,
20). Once a T-cell becomes activated it shows high rates of both glycolysis and
oxidative phosphorylation (OxPhos) and mainly metabolizes glucose to lactate (21,
22). Memory T-cells on the other hand rely more on lipid synthesis by mitochondrial
citrate production. Citrate is subsequently used to produce triacylglycerides (TAGs)
for degradation by β-oxidation to fuel OxPhos via acetyl-CoA production (23).
This in contrast to regulatory T-cells that use exogenously derived fatty acids to
fuel β-oxidation and OxPhos (24). Later studies show that different macrophages
subtypes also display distinct metabolic pathways. The anti-inflammatory (M(IL-4) or
formerly M2) macrophages rely on OxPhos (25, 26) and show increased β-oxidation
of fatty acids (27), while pro-inflammatory (M(IFNγ) or formerly M1) macrophages
largely depend on glycolysis with disruption of the tricarboxylic acid (TCA) cycle (28,
29).
A metabolic switch from OxPhos to glycolysis resulting in more lactate production,
called the Warburg effect, was first described in highly metabolic active cancer
cells (30). A similar switch was found to be essential in the induction of β-glucan
trained monocytes (31). The benefit from the Warburg effect lies in the fact that
glycolysis can be more strongly upregulated than OxPhos. Therefore, the Warburg
effects results in a faster production of ATP, which is essential in activated cells
(30). Under such circumstances the TCA cycle is no longer used catabolically, but
only to shift citrate towards production of acetyl-CoA necessary for production of
phospholipids and cholesterol. Glucose consumption and lactate production by
β-glucan-trained monocytes and macrophages is increased, whereas oxygen
consumption is significantly decreased compared to control macrophages (31).
Transcriptional and epigenetic (H3K4me3 and H3K27ac) analysis of β-glucan-
trained monocytes revealed that genes in the Akt/mTOR/HIF-1α signaling pathway

12 |
 1
Introduction

and several metabolic pathways, especially glycolysis, were highly induced (7, 31).
Inhibiting these pathways at several levels, or making use of myeloid cell specific
Hif-1α knockout mice, abrogated induction of trained immunity both at cytokine and
epigenetic level (31).
In the second part of this thesis I will examine additional metabolic changes
induced during activation of trained immunity, since for example from the field of
cancer metabolism it is very well know that other metabolic pathways apart from
glycolysis play important roles for changes in cellular phenotype. In this second
part I will also assess the metabolic changes in immune tolerance in human
sepsis, an almost unexplored field, which could give important clues for potential
‘immunometabolic therapy’.
Whether metabolic changes occur in BCG-induced trained immunity is unknown,
just as the potential interaction with epigenetic changes. In Chapter 7 potential
metabolic changes in BCG-induced trained immunity are being studied, just as the
concurrently occurring epigenetic changes. Furthermore, I will assess whether these
changes also take place in vivo in humans after BCG vaccination, translating our
previous findings into a more clinically relevant condition.
An interesting and relatively new field of research is metaboloepigenetics, where
the influence of metabolites or metabolic pathways on the epigenome is being
assessed. This, as certain metabolites can serve as donors (e.g. acetyl CoA) or
cofactors (e.g. α-ketoglutarate) in epigenetic modulations (32, 33). In Chapter 8 I
will therefore examine whether glutamine metabolism and TCA cycle metabolites
play a role in the induction of trained immunity by β-glucan. Hence, examining
other ways of modulating the induction of trained immunity. Apart from glutamine
metabolism and the TCA cycle, also the cholesterol synthesis pathway is highly
induced in β-glucan-induced trained immunity. In Chapter 9 I will examine whether
this induction is essential for the induction of trained immunity and we assess the
role of intermediates in this pathway, in this process. In addition, we will examine
whether modulation of the cholesterol synthesis pathway could be the underlying
mechanism in the pathophysiology of hyper-IgD syndrome (HIDS). In other words,
whether trained immunity could be the cause of the pro-inflammatory profile of the
monocytes of these patients and therefore causing the disease symptoms. This
approach could give new insights into the pathophysiology of this disease, and
therefore open a new therapeutic avenue.
Apart from trained immunity, metabolic changes could also play a role in
innate immune tolerance. Although, this is a completely unexplored field. Immune
tolerance can be considered as the opposite of trained immunity, as monocytes and
macrophages become less responsive due to epigenetic changes. This is a well-
known cause of mortality in sepsis patients at intensive care units. As metabolic

| 13
Chapter 1

changes play a role in trained immunity, it is likely that the same is true for innate
immune tolerance. This might lead to hypotheses for therapeutic options in innate
immune tolerance. In Chapter 10 I will examine the metabolic changes in monocytes
in in-vitro induced immune tolerance and in monocytes from septic patients and
assess whether they can be reversed.
Also in the tumor microenvironment macrophages are reprogrammed, resulting
in long-term changes in the phenotypes of the macrophages. As a result of exposure
to the tumor and to the changed microenvironment, tumor-associated macrophages
might also undergo epigenetic and metabolic changes that are essential in this
reprogramming. These changes are examined and discussed in Chapter 11 in a
model for thyroid cancer, again also exploring potential therapeutic interventions. In
Chapter 12 I will give an overview of all known metabolic pathways essential for the
induction of trained immunity and summarize the chapters of the second part of this
thesis.
Finally, I will discuss the findings presented in this thesis in Chapter 13 and
give an overview of important future experiments to be performed and the potential
clinical applications of innate immune memory.

REFERENCES
1. Netea MG, Joosten LA, Latz E, Mills KH, Natoli G,
Stunnenberg HG, et al. Trained immunity: A program
of innate immune memory in health and disease.
Science. 2016;352(6284):aaf1098.
2. Milutinovic B, Kurtz J. Immune memory in
invertebrates. Seminars in immunology.
2016;28(4):328-42.
3. Quintin J, Cheng SC, van der Meer JW, Netea
MG. Innate immune memory: towards a better
understanding of host defense mechanisms. Curr
Opin Immunol. 2014;29:1-7.
4. Fu ZQ, Dong X. Systemic acquired resistance:
turning local infection into global defense. Annual
review of plant biology. 2013;64:839-63.
5. Quintin J, Saeed S, Martens JH, Giamarellos-
Bourboulis EJ, Ifrim DC, Logie C, et al. Candida
albicans infection affords protection against
reinfection via functional reprogramming of
monocytes. Cell Host Microbe. 2012;12(2):223-32.
6. Kleinnijenhuis J, Quintin J, Preijers F, Joosten LA,
Ifrim DC, Saeed S, et al. Bacille Calmette-Guerin
induces NOD2-dependent nonspecific protection
from reinfection via epigenetic reprogramming of
monocytes. Proceedings of the National Academy
of Sciences of the United States of America.
2012;109(43):17537-42.
7. Saeed S, Quintin J, Kerstens HH, Rao NA,
Aghajanirefah A, Matarese F, et al. Epigenetic
programming of monocyte-to-macrophage
differentiation and trained innate immunity. Science.
2014;345(6204):1251086.
8. Arts RJ, Blok BA, Aaby P, Joosten LA, de Jong D,
van der Meer JW, et al. Long-term in vitro and in
vivo effects of gamma-irradiated BCG on innate and
adaptive immunity. J Leukoc Biol. 2015;98(6):995-
1001.
9. Bistoni F, Vecchiarelli A, Cenci E, Puccetti P, Marconi
P, Cassone A. Evidence for macrophage-mediated
protection against lethal Candida albicans infection.
Infect Immun. 1986;51(2):668-74.
10. Kleinnijenhuis J, Quintin J, Preijers F, Benn CS,
Joosten LA, Jacobs C, et al. Long-lasting effects of
BCG vaccination on both heterologous Th1/Th17
responses and innate trained immunity. J Innate
Immun. 2014;6(2):152-8.
11. Marcus A, Raulet DH. Evidence for natural killer cell
memory. Curr Biol. 2013;23(17):R817-20.
12. Biering-Sorensen S, Aaby P, Napirna BM, Roth A,
Ravn H, Rodrigues A, et al. Small randomized trial
among low-birth-weight children receiving bacillus
Calmette-Guerin vaccination at first health center
contact. Pediatr Infect Dis J. 2012;31(3):306-8.
13. Aaby P, Roth A, Ravn H, Napirna BM, Rodrigues A,
Lisse IM, et al. Randomized trial of BCG vaccination
at birth to low-birth-weight children: beneficial
nonspecific effects in the neonatal period? The
Journal of infectious diseases. 2011;204(2):245-52.
14. Netea MG, Quintin J, van der Meer JW. Trained
immunity: a memory for innate host defense. Cell
host & microbe. 2011;9(5):355-61.
15. Bekkering S, Joosten LA, van der Meer JW, Netea
MG, Riksen NP. Trained innate immunity and
atherosclerosis. Curr Opin Lipidol. 2013;24(6):487-
92.
16. Mayo-Wilson E, Imdad A, Herzer K, Yakoob MY,
Bhutta ZA. Vitamin A supplements for preventing
mortality, illness, and blindness in children aged
under 5: systematic review and meta-analysis. Bmj.
2011;343:d5094.
17. Benn CS. Combining vitamin A and vaccines:
convenience or conflict? Dan Med J.
2012;59(1):B4378.
18. Ganeshan K, Chawla A. Metabolic regulation
of immune responses. Annu Rev Immunol.
2014;32:609-34.
19. Loftus RM, Finlay DK. Immunometabolism; cellular
metabolism turns immune regulator. The Journal of
biological chemistry. 2015.
20. Gerriets VA, Rathmell JC. Metabolic pathways in
T cell fate and function. Trends in immunology.
2012;33(4):168-73.
21. Wang R, Dillon CP, Shi LZ, Milasta S, Carter R,
Finkelstein D, et al. The transcription factor Myc
controls metabolic reprogramming upon cyte
activation. Immunity. 2011;35(6):871-82.
22. Donnelly RP, Finlay DK. Glucose, glycolysis and
lymphocyte responses. Molecular immunology. 2015.
23. van der Windt GJ, O’Sullivan D, Everts B, Huang SC,
Buck MD, Curtis JD, et al. CD8 memory T cells have
a bioenergetic advantage that underlies their rapid

14 |
 1
Introduction

recall ability. Proceedings of the National Academy

of Sciences of the United States of America.
2013;110(35):14336-41.
24. Michalek RD, Gerriets VA, Jacobs SR, Macintyre AN,
MacIver NJ, Mason EF, et al. Cutting edge: distinct
glycolytic and lipid oxidative metabolic programs
are essential for effector and regulatory CD4+ T cell
subsets. Journal of immunology. 2011;186(6):3299-
303.
25. Hu X, Liu G, Hou Y, Shi J, Zhu L, Jin D, et al.
Induction of M2-like macrophages in recipient NOD-
scid mice by allogeneic donor CD4(+)CD25(+)
regulatory T cells. Cellular & molecular immunology.
2012;9(6):464-72.
26. Van Dyken SJ, Locksley RM. Interleukin-4- and
interleukin-13-mediated alternatively activated
macrophages: roles in homeostasis and disease.
Annual review of immunology. 2013;31:317-43.
27. Odegaard JI, Chawla A. Alternative macrophage
activation and metabolism. Annual review of
pathology. 2011;6:275-97.
28. Tannahill GM, Curtis AM, Adamik J, Palsson-
McDermott EM, McGettrick AF, Goel G, et
al. Succinate is an inflammatory signal that
induces IL-1beta through HIF-1alpha. Nature.
2013;496(7444):238-42.
29. Jha AK, Huang SC, Sergushichev A, Lampropoulou
V, Ivanova Y, Loginicheva E, et al. Network integration
of parallel metabolic and transcriptional data reveals
metabolic modules that regulate macrophage
polarization. Immunity. 2015;42(3):419-30.
30. Warburg O, Wind F, Negelein E. The Metabolism
of Tumors in the Body. The Journal of general
physiology. 1927;8(6):519-30.
31. Cheng SC, Quintin J, Cramer RA, Shepardson KM,
Saeed S, Kumar V, et al. mTOR- and HIF-1alpha-
mediated aerobic glycolysis as metabolic basis for
trained immunity. Science. 2014;345(6204):1250684.
32. Donohoe DR, Bultman SJ. Metaboloepigenetics:
interrelationships between energy metabolism and
epigenetic control of gene expression. Journal of
cellular physiology. 2012;227(9):3169-77.
33. Kaelin WG, Jr., McKnight SL. Influence of metabolism
on epigenetics and disease. Cell. 2013;153(1):56-69.

| 15
 Part I

Trained Immunity induced

by BCG
 Chapter 2

Long-term in-vitro and in-vivo effects of

γ-irradiated BCG on innate and adaptive
immunity

Rob J.W. Arts*, Bastiaan A. Blok*, Peter Aaby, Leo A.B. Joosten, Dirk de Jong, Jos
W.M. van der Meer, Christine S. Benn, Reinout van Crevel, Mihai G. Netea.

*These authors contributed equally to this work

J Leukoc Biol 2015;6:995-1001

Chapter 2

ABSTRACT

BCG vaccination is associated with a reduced mortality from non-mycobacterial

infections. This is likely to be mediated by a combination of innate immune memory
(‘trained immunity’) and heterologous effects on adaptive immunity. As such, BCG
could be used to boost host immunity, but not in immunocompromised hosts, as it
is a live-attenuated vaccine. We therefore assessed whether inactivated γ-irradiated
BCG (γBCG) has similar potentiating effects. In an in-vitro model of trained immunity,
human monocytes were incubated with γBCG for 24h and restimulated after 6
days. Cytokine production and the role of pattern recognition receptors and histone
methylation markers were assessed. The in-vivo effects of γBCG vaccination were
studied in a proof-of-principle trial in 15 healthy volunteers. γBCG induced trained
immunity in vitro, via the NOD2 receptor pathway and upregulation of H3K4me3
histone methylation. However, these effects were less strong than those induced
by live BCG. γBCG vaccination in volunteers had only minimal effects on innate
immunity, whereas a significant increase in heterologous Th1/Th17 responses was
observed. γBCG induces long-term training of innate immunity in vitro. In vivo, γBCG
induces mainly heterologous effects on the adaptive immune system, while effects
on innate cytokine production are limited.

20 |
 Long-term Effect of γBCG on Immunity

The live-attenuated Bacillus Calmette-Guérin (BCG) vaccine protects against 2

extrapulmonary infection with Mycobacterium tuberculosis and against leprosy (1,
2). In addition, mounting evidence shows that vaccination with BCG also has non-
specific protective effects: early administration of BCG vaccination at birth leads to
reduced child mortality, mainly as a result of reduced neonatal sepsis, respiratory
infections, and fever (3-5). Furthermore, BCG is used in patients with bladder cancer
to induce immune stimulating effects and slow tumor progression (6) and the vaccine
is also being investigated for potential protective effects against atopic diseases (7).
Two main effects have been suggested to mediate the non-specific effects of BCG
vaccination: potentiating effects on adaptive immune responses (‘heterologous
immunity’) and epigenetic reprogramming with functional priming of human
monocytes (‘trained immunity’) (8-10). Upon stimulation with non-mycobacterial
pathogens of cells isolated from BCG-vaccinated individuals, both the adaptive and
the innate immune system demonstrate a primed status and are able to react faster
and more efficient to a secondary (and non-related) stimulus (8, 9, 11).
A major drawback of BCG being used for eliciting these effects clinically, is that
it is a live microorganism that cannot be used for vaccination in immunodeficient
individuals (e.g. HIV-infected, post-sepsis immunoparalysis), who are the group of
patients most likely to benefit from such effects (12). Vaccination with γ-irradiated
BCG (γBCG) could be an attractive alternative, in case that the γBCG would
demonstrate similar potentiation of heterologous and/or trained immunity. In this
study we investigated the non-specific long-term in-vitro and in-vivo effects of γBCG
on the innate and adaptive immune responses.

MATERIALS AND METHODS

Subjects - The in-vitro experiments were performed on cells isolated from healthy
blood donors. For the in-vivo BCG vaccination study, fifteen healthy individuals
(age range 20-34 years, 9 female and 6 male) were included after they had given
informed consent between November and December of 2013. One volunteer was
lost to follow-up after 8 weeks, because she moved abroad, therefore the time point
3 months after vaccination contains only data of 14 volunteers. Blood was drawn
before, and 2 weeks, and 3 months after vaccination with 0,075mg γBCG. The
study was approved by the Arnhem-Nijmegen Medical Ethical Committee and was
registered at ClinicalTrials.gov as NCT02259608.
γ-Irradiation - Vials with live-attenuated BCG (Statens Serum Institut, Denmark)
were irradiated in the original packaging with an average dose of at least 30kGy (13,
14) in a JS6500 Tote Box Irradiator. γ-irradiation was performed by Synergy Health
Ede B.V., Ede, The Netherlands. The inactivated BCG was cultured for 6 weeks to
confirm inactivation.

| 21
Chapter 2

In-vitro monocyte stimulation - For the in-vitro model of trained immunity,

PBMCs were isolated by density gradient using Ficoll-Paque of buffy coats from
healthy volunteers (Sanquin, Nijmegen), after which monocytes were obtained by
1h adherence and washing in 96-well flat-bottom culture plates (5x10^5 PBMCs
per well in 100µl volume). Monocytes were stimulated for 24h with either RPMI
(control culture medium), live-attenuated BCG (10µg/ml, Statens Serum Institut,
Denmark), heat-killed BCG (1h at 100oC), or γBCG. In some experiments the
histone methyltransferase inhibitor MTA (1mM, Sigma-Aldrich, MO, USA) or a
demethylase inhibitor pargyline (3µM, Sigma), or Bartonella quintana LPS (a potent
TLR4 antagonist (15), 20ng/ml) was added. After 24h, cells were washed with PBS
to remove the stimuli and cells were rested in RPMI 1640 supplemented with 10%
human serum for 6 days. On day 7 monocytes were restimulated with different stimuli
including E. coli LPS (10ng/ml, Sigma), Pam3Cys (10µg/ml, EMC microcollections,
Tuebingen, Germany) or heat-killed Staphylococcus aureus (1x10^7 organisms/ml,
clinical isolate). In TLR4-blocking experiments cells were restimulated with PolyI:C
(50µg/ml, Invivogen, San Diego, CA, USA) and flagellin (5µg/ml, Sigma) to assess
non-TLR4 driven cytokine responses. After 24h, supernatant was collected and
cytokines were measured by ELISA.
PBMC isolation and ex-vivo stimulation of leukocytes isolated from the
vaccinated volunteers - Isolation and stimulation was performed as described
before (8, 9). Briefly, PBMCs were isolated from the healthy volunteers before and
after BCG vaccination by density centrifugation of Ficoll-Paque and diluted to a
concentration of 5x10^6/ml. 100µl/well was added to 96-well plates and cells were
incubated for 24h (IL-6, TNFα, IL-1β), 48h (IFNγ) or 7d (IL-17, IL-22) with RPMI,
sonicated Mycobacterium tuberculosis H37Rv (1µg/ml), heat-killed Candida albicans
(1x10^6/ml, strain UC820) or Staphylococcus aureus (1x10^6/ml) in the trial.
Cytokine Measurements - Cytokine measurements were performed in the
supernatants using commercial ELISA kits from R&D Systems (TNFα, IL-1β, IL-
17 and IL-22; Minneapolis, MN, USA) or Sanquin (IL-6, IFNγ; Amsterdam, The
Netherlands).
Chromatin immunoprecipitation - To assess epigenetic markers associated with
inflammatory changes, monocytes (10x10^6 cells/well in 2ml volume) were cultured
in vitro in 6-well plates. Cells were stimulated for 24h with RPMI or γBCG (10µg/ml),
after which the stimuli were washed away. After resting for 6 days in culture medium,
the control and γBCG-primed cells were harvested and fixed in methanol-free
formaldehyde 1%. Afterwards, cells were sonicated and immunoprecipitation was
performed using antibodies against H3K4me3 (Diagenode, Seraing, Belgium). After
ChIP, DNA was processed further for qPCR analysis. Samples were analyzed by a
comparative Ct method in which myoglobulin was used as a negative control and H2B

22 |
 Long-term Effect of γBCG on Immunity

as a positive control according to the manufacturer’s instructions. The following primers 2

were used for this analysis: myoglobulin forward AGCATGGTGCCACTGTGCT;
myoglobulin reverse GGCTTAATCTCTGCCTCATGAT; H2B forward
TGTACTTGGTGACGGCCTTA; H2B reverse CATTACAACAAGCGCTCGAC;
TNFA forward GTGCTTGTTCCTCAGCCTCT; TNFA reverse
ATCACTCCAAAGTGCAGCAG; IL6 forward AGGGAGAGCCAGAACACAGA; IL6
reverse GAGTTTCCTCTGACTCCATCG.
Statistical analysis - Differences were analysed using Wilcoxon signed-rank test or
Mann-Whitney U test where applicable. All calculations were performed in Graphpad
prism 5 (CA, USA). p < 0.05 was considered statistically significant. Data are shown
as means ± SEM.

RESULTS
Inactivated BCG induces trained immunity in vitro
Preincubation of monocytes with live BCG and inactivated γBCG led to a significant
2- to 4-fold increase in IL-6 and TNFα production upon restimulation with LPS one
week later, compared to preincubation with culture medium only (Figure 1A,B).
Cytokine production directly after BCG stimulation did not differ between the different

Figure 1. BCG and γBCG priming of monocytes increases cytokine production upon restimulation
with LPS. (A,B) Adherent monocytes from healthy volunteers were incubated with γBCG (A), live BCG
(B) or RPMI for 24h, then washed with PBS and rested for 6 days. On day 7 monocytes were rechallenged
for 24h with LPS or culture medium. Cytokine production in supernatant was assessed with ELISA. (C,D)
Training cells with live-attenuated, heat-killed and γBCG increased IL-6 (C) and TNFα (D) production upon
stimulation with LPS compared to priming with medium. Cytokine levels in RPMI restimulated samples
were all below detection limit. Wilcoxon matched pairs signed rank test. To compare fold changes between
live BCG and γBCG the Mann-Whitney U test was used. (n≥6, * p < 0.05).

| 23
Chapter 2

forms of BCG (data not shown). Inactivation of BCG by γ-irradiation or heat-killing

had similar effects as live BCG, although in a lower magnitude (Figure 1C,D).

Training of monocytes with γBCG is NOD2 dependent and not TLR4 depen-
dent
To address the role of TLR2, TLR4 and NOD2 in BCG-induced trained monocytes,
the following experiments were performed. Firstly, blocking of TLR4 or TLR2 by the
addition of a potent TLR4 inhibitor (LPS derived from Bartonella quintana) or an
αTLR2 antibody during pre-incubation with live BCG and γBCG did not significantly
influence the magnitude of trained immunity (Figure 2A-D). Addition of B. quintana
LPS alone did not lead to priming of cytokine responses (data not shown). Secondly,
previous studies have shown an important role for NOD-like receptor 2 in the
immune recognition of BCG and the induction of trained immunity by live BCG (8). A
potential role of NOD2 for the induction of trained immunity by γBCG was validated
by experiments showing that monocytes isolated from NOD2-deficient patients
(homozygous for the 3020insC; rs2066847 mutation) have decreased induction
of trained immunity when preincubated with γBCG and restimulated with LPS or
Pam3Cys (Figure 2E,F).

γBCG induces epigenetic changes in histone methylation

Pre-incubation of monocytes with live BCG and γBCG led to a significant upregulation
of histone trimethylation at the histone 3 lysine 4 (H3K4) position of the TNFA and IL6
promoters, a histone mark previously associated with trained immunity. The effect of
live BCG was stronger than that of γBCG (Figure 3A and B). The importance of histone
methylation for the induction of trained immunity was further demonstrated by the
inhibition of both live BCG and γBCG effects by the addition of a methyltransferase
inhibitor MTA during the preincubation period. In contrast, the demethylase inhibitor
pargyline had no effects on monocyte training (Figure 3C and D).

Vaccination with γBCG induces heterologous immunity, but no trained im-

munity in vivo
A group of healthy volunteers were vaccinated with γBCG to assess its effect on both
innate and adaptive immune responses. γBCG vaccination significantly increased
the production of innate immune cytokine IL-1β and IL-6 induced by M. tuberculosis,
but not by the other microbial stimuli, showing that vaccination with inactivated BCG
has only minimal effects on innate immune responses (Figure 4).
In contrast, heterologous immune responses represented by the production of
IFNγ and IL-22 was significantly upregulated 2 weeks and 3 months after vaccination
with γBCG compared to baseline, when restimulation was performed with either S.

24 |
 Long-term Effect of γBCG on Immunity

Figure 2. Training with γBCG is dependent on the NOD2-receptor. (A,B) TLR4 was blocked during
priming with live BCG and γBCG by use of LPS derived from B. quintana, one week later cells were
rechallenged with flagellin and polyI:C. Blocking of TLR4 gave a non-significant increase of IL-6 (A) and
TNFα (B) production upon restimulation with flagellin. Depicted are fold changes compared to no training
(n=5). TLR2 was blocking during priming with live BCG and γBCG by use of an αTLR2 antibody. One
week later cells were rechallenged with LPS. (C,D) Blocking of TLR2 did not significantly influence IL-6
(C) and TNFα (D) production upon restimulation with LPS. Depicted are fold changes compared to no
training (n=5). (E,F) Adherent monocytes from NOD2-deficient patients and healthy controls were used
in the in-vitro training model. Macrophages from NOD2-deficient patients did not show increased IL-6 (E)
and TNFα (F) production upon restimulation with LPS, Pam3Cys and S. aureus one week after training,
whereas cells from healthy controls showed an upregulation of cytokine production. Cytokine levels in
RPMI restimulated samples were below detection limit. Depicted is fold of change compared to no training
(n=4 patients vs. 4 controls). Mann-Whitney U test was used for analysis of TLR4 blocking.

| 25
Chapter 2

Figure 3. Training induced by γBCG is epigenetically mediated. (A,B) Adherent monocytes were
trained in vitro with γBCG. On day 6 cells were harvested and processed for chromatin immunoprecipitation.
qPCR was performed on ChIPed DNA. Depicted is H3K4me3 % of total input for the IL6 (A) and TNFA
promoter (B). Preincubation with γBCG led to increased H3K4me3 of TNFA and IL6 promoter region.
Wilcoxon matched-pairs signed rant test. (n=8, * p < 0.05, ** p < 0.01).
(C,D) In a separate set of experiments, the histone methyltransferase inhibitor MTA or the demethylase
inhibitor pargyline were added during the first 24h, while incubating with γBCG. One week later monocytes
were rechallenged using LPS. Incubation with MTA abrogated the induction of IL-6 (C) and TNFα (D) after
training with live BCG and γBCG, whereas incubation with pargyline did not lead to an altered cytokine
response. Depicted are fold changes compared to no training. Mann-Whitney U test. (n=6, * p < 0.05).

aureus or C. albicans, demonstrating strong non-specific heterologous effects of

γBCG (Figure 4). Surprisingly, the specific effect of γBCG was relatively weak, as the
upregulation of IFNγ production after M. tuberculosis stimulation was only marginally
increased (Figure 4). As prevaccination IFNγ response to M. tuberculosis was low
in all volunteers (which makes pre-exposure to mycobacterial antigens unlikely),
this finding argues that γBCG cannot be used as a tuberculosis vaccine, as it will
probably not induce enough immunological protection, as shown previously (16).
After vaccination, cells of the volunteers were still capable to respond ex vivo to
training by γBCG (Figure S1).
Several studies have shown that among BCG-vaccinated children, those having
a BCG scar have better survival than those without a scar (17, 18). But since all
but one of the γBCG-vaccinated volunteers had developed a scar 3 months after
vaccination, we were not able to perform such an analysis.

26 |
 Long-term Effect of γBCG on Immunity

Figure 4. Vaccination of Healthy volunteers with γBCG induces heterologous immunity, but no
trained immunity. Healthy volunteers were vaccinated with γBCG. PBMCs were collected before and
after vaccination, and stimulated ex vivo with sonicated M. tuberculosis, heat-killed S. aureus or C.
albicans. Cytokine production was assessed by ELISA in supernatants. γBCG vaccination increased
only the MTB-induced innate cytokine responses (A-C), while strongly increasing heterologous T-helper
responses represented by IFNγ (D) and IL-22 (F) production. Cytokine level in RPMI-stimulated samples
was all below detection level. Depicted are fold changes as compared to prevaccination. Wilcoxon
matched-pairs signed rank test. (* p < 0.05, ** p < 0.01).

DISCUSSION
In the present study we assessed the capacity of γBCG to stimulate heterologous
and trained immunity, the two immunological mechanisms hypothesized to mediate
the protective non-specific effects of BCG vaccination. While γBCG induced trained
immunity in an in-vitro experimental model, this effect was less strong compared to
the live-attenuated BCG vaccine. In line with this, vaccination of healthy volunteers
with γBCG had only limited effects on innate immunity. However, γBCG strongly
potentiated heterologous Th1 and Th17 immunity, suggesting that this approach
may have clinical applications.
A large body of epidemiological studies, as well as a number of randomized
clinical trials, reported significant non-specific protective effects of BCG vaccination
(3-5, 17-19). While very beneficial in young children, and potentially also in the
elderly (20), BCG vaccination cannot be used in patients with immune deficiencies
due to the fact that it contains live microorganisms. It would therefore be useful
to explore alternative approaches that would avoid the danger of a disseminated
infection in an immunocompromised host, and also decrease side effects as
lymphadenitis in healthy persons, while retaining heterologous beneficial effects on

| 27
Chapter 2

infection susceptibility. We thus hypothesized that γ-irradiation of BCG, which kills

the microorganism while preserving the structure of the cell wall, may be a viable
alternative to the live vaccine.
The results of the in-vitro and in-vivo experiments reported here demonstrate a
consistent pattern when comparing γ-irradiated and live BCG. In in-vitro models of
trained immunity, γBCG was able to induce priming of monocytes towards increased
cytokine production, but the effect was weaker than that of live BCG. As previously
demonstrated with live vaccine (8), γBCG induced these effects in a NOD2-dependent
manner, and were mediated by histone methylation at the level of H3K4. However,
these effects were not strong enough to induce an effective trained immunity in vivo
in all the volunteers: the innate immune responses were largely unaffected when
assessed in the entire group, with the exception of M. tuberculosis-induced IL-1β
and IL-6.
There are several possible reasons for the low effects of γBCG on trained
immunity in vivo. Firstly, we cannot exclude that subtle changes of mycobacterial cell
wall were induced during irradiation, and that may result in partial loss of biological
activity. Differential effects of live and inactivated forms of BCG on TLR2 signalling
and pro-inflammatory cytokine release have been noted in vitro before, showing
a more potent effect of live BCG compared to inactivated forms (21). Secondly,
in-vivo replication of BCG may be needed in order to release enough bacterial
products (such as peptidoglycans that are recognized by NOD2) that would induce
immunostimulatory effects at distance (22, 23). Finally, another possibility might be
that the administered dose of γBCG, which was identical with that of the live vaccine,
should have been increased in order to insure the same effect as observed with the
live BCG vaccine. Multiple subsequent vaccinations could represent an alternative
strategy to obtain the desired effect.
In contrast to the effects on the innate immune system, γBCG vaccination induced
strong heterologous effects on the Th1 and Th17 response, as demonstrated by
the clear increase in the production of IFNγ, IL-22 and to some extent IL-17 upon
stimulation of cells from vaccinated individuals with unrelated pathogens. Protective
heterologous effects of infections and vaccinations have been described before, for
example in mouse models where it has been shown that priming with one virus can
enhance cytokine production and clearance of a second non-related virus (24, 25). In
addition, immunizing mice with live BCG has been shown to enhance immunity against
vaccinia virus, which was dependent on IFNγ production by CD4 cells (26). Human
vaccination with live-attenuated BCG has been shown to enhance Th1 responses of
other vaccinations as well (27). As a possible mechanism for heterologous effects on
adaptive immunity, it has been shown that naturally occurring CD8+ T-lymphocytes
expressing memory markers are able to rapidly produce vast amounts of IFNγ upon

28 |
 Long-term Effect of γBCG on Immunity

incubation with IL-12, which could be boosted by co-incubation with IL-18, all in 2
absence of a pathogen (28, 29). In addition, specific CD8+ T-lymphocytes were
also shown to produce IFNγ during an infection with a nonrelated pathogen (30),
and also CD4+ T-lymphocytes can produce IFNγ upon stimulation with IL-12 in an
antigen-independent manner (31, 32). Similar mechanisms have been envisaged
for the increased Th17 response: PstS1, a mycobacterial lipoprotein that has the
same positive effect as BCG in a bladder cancer mice model (33), is able to induce
an antigen-independent amplification of the IFNγ and IL-17/IL-22 response. When
PstS1 induced memory CD4+ T-lymphocytes were incubated with activated DCs, in
absence of a pathogen, increased production of IFNγ, IL-17 and IL-22 by the memory
T-lymphocytes was observed, which was partly dependent on IL-6 production of the
DCs (34). These studies demonstrate several putative mechanisms through which
heterologous Th1 and Th17 responses to non-related pathogens can be boosted
after vaccination with γBCG. In our study we unfortunately have not analysed which
type of cell was the main producer of IFNγ or IL-17/22 in the ex-vivo stimulation
experiments. However, it can be hypothesized that memory T-cells induced by γBCG
vaccination are the source of increased Th1/Th17 responses upon stimulation with
a non-related pathogen. Future studies are warranted to evaluate these biological
processes in human volunteers with γBCG vaccination.
In conclusion, in this study we report that γBCG induces strong heterologous
effects on Th1/Th17 immunity, and these effects could be harnessed for the therapy
of immunocompromised patients. Although probably not useful in HIV-infected
patients with very low CD4 counts, in other clinical situations in which T-lymphocytes
are still present (such as post-sepsis immunoparalysis, HIV-infected patients with
CD4 counts higher than 200/mm3), vaccination with γBCG may represent a novel
strategy to boost the immune system and increase the resistance of the host to
infections, thus potentially limiting morbidity and mortality in these vulnerable groups
of patients. Although vaccination with the standard dose of γBCG induced only
poorly trained immunity in vivo, higher or repeated dosages may represent additional
possible strategies to be explored in the future to increase the efficacy of this novel
approach.

REFERENCES
1. Zumla A, Raviglione M, Hafner R, von Reyn CF.
Tuberculosis. The New England journal of medicine. 4.
2013;368(8):745-55.
2. Colditz GA, Brewer TF, Berkey CS, Wilson ME,
Burdick E, Fineberg HV, et al. Efficacy of BCG vaccine
in the prevention of tuberculosis. Meta-analysis of
the published literature. JAMA : the journal of the
American Medical Association. 1994;271(9):698-702. 5.
3. Aaby P, Roth A, Ravn H, Napirna BM, Rodrigues A,
Lisse IM, et al. Randomized trial of BCG vaccination
at birth to low-birth-weight children: beneficial
nonspecific effects in the neonatal period? The
Journal of infectious diseases. 2011;204(2):245-52.
Biering-Sorensen S, Aaby P, Napirna BM, Roth A,
Ravn H, Rodrigues A, et al. Small randomized trial
among low-birth-weight children receiving bacillus
Calmette-Guerin vaccination at first health center
contact. The Pediatric infectious disease journal.
2012;31(3):306-8.
Roth A, Jensen H, Garly M-L, Djana Q, Martins
CL, Sodemann M, et al. Low Birth Weight Infants
and Calmette-Guerin Bacillus Vaccination at Birth:
Community Study from Guinea-Bissau. Pediatric
Infectious Disease Journal. 2004;23(6):544-50.

| 29
Chapter 2

6. Han RF, Pan JG. Can intravesical bacillus Calmette- during viral infections. Autoimmunity. 2011;44(4):328-
Guerin reduce recurrence in patients with superficial 47.
bladder cancer? A meta-analysis of randomized 25. Chen AT, Cornberg M, Gras S, Guillonneau C,
trials. Urology. 2006;67(6):1216-23. Rossjohn J, Trees A, et al. Loss of anti-viral
7. Steenhuis TJ, van Aalderen WM, Bloksma N, Nijkamp immunity by infection with a virus encoding a cross-
FP, van der Laag J, van Loveren H, et al. Bacille- reactive pathogenic epitope. PLoS pathogens.
Calmette-Guerin vaccination and the development 2012;8(4):e1002633.
of allergic disease in children: a randomized, 26. Mathurin KS, Martens GW, Kornfeld H, Welsh RM.
prospective, single-blind study. Clinical and CD4 T-cell-mediated heterologous immunity between
experimental allergy : journal of the British Society for mycobacteria and poxviruses. Journal of virology.
Allergy and Clinical Immunology. 2008;38(1):79-85. 2009;83(8):3528-39.
8. Kleinnijenhuis J, Quintin J, Preijers F, Joosten LA, 27. Ota MO, Vekemans J, Schlegel-Haueter SE,
Ifrim DC, Saeed S, et al. Bacille Calmette-Guerin Fielding K, Sanneh M, Kidd M, et al. Influence of
induces NOD2-dependent nonspecific protection Mycobacterium bovis bacillus Calmette-Guerin
from reinfection via epigenetic reprogramming of on antibody and cytokine responses to human
monocytes. Proceedings of the National Academy neonatal vaccination. Journal of immunology.
of Sciences of the United States of America. 2002;168(2):919-25.
2012;109(43):17537-42. 28. Lertmemongkolchai G, Cai G, Hunter CA, Bancroft
9. Kleinnijenhuis J, Quintin J, Preijers F, Benn CS, GJ. Bystander activation of CD8+ T cells contributes
Joosten LA, Jacobs C, et al. Long-lasting effects of to the rapid production of IFN-gamma in response
BCG vaccination on both heterologous Th1/Th17 to bacterial pathogens. Journal of immunology.
responses and innate trained immunity. Journal of 2001;166(2):1097-105.
innate immunity. 2014;6(2):152-8. 29. Berg RE, Cordes CJ, Forman J. Contribution of CD8+
10. Benn CS, Netea MG, Selin LK, Aaby P. A small jab T cells to innate immunity: IFN-gamma secretion
- a big effect: nonspecific immunomodulation by induced by IL-12 and IL-18. European journal of
vaccines. Trends in immunology. 2013. immunology. 2002;32(10):2807-16.
11. Netea MG, Quintin J, van der Meer JW. Trained 30. Berg RE, Crossley E, Murray S, Forman J. Memory
immunity: a memory for innate host defense. Cell CD8+ T cells provide innate immune protection
host & microbe. 2011;9(5):355-61. against Listeria monocytogenes in the absence
12. von Reyn CF, Mtei L, Arbeit RD, Waddell R, Cole of cognate antigen. The Journal of experimental
B, Mackenzie T, et al. Prevention of tuberculosis in medicine. 2003;198(10):1583-93.
Bacille Calmette-Guerin-primed, HIV-infected adults 31. Hashiguchi T, Oyamada A, Sakuraba K, Shimoda
boosted with an inactivated whole-cell mycobacterial K, Nakayama KI, Iwamoto Y, et al. Tyk2-dependent
vaccine. Aids. 2010;24(5):675-85. bystander activation of conventional and
13. Madan-Lala R, Peixoto KV, Re F, Rengarajan nonconventional Th1 cell subsets contributes to
J. Mycobacterium tuberculosis Hip1 dampens innate host defense against Listeria monocytogenes
macrophage proinflammatory responses by limiting infection. Journal of immunology. 2014;192(10):4739-
toll-like receptor 2 activation. Infection and immunity. 47.
2011;79(12):4828-38. 32. Hu J, August A. Naive and innate memory phenotype
14. Warwick-Davies J, Watson AJ, Griffin GE, Krishna CD4+ T cells have different requirements for active
S, Shattock RJ. Enhancement of Mycobacterium Itk for their development. Journal of immunology.
tuberculosis-induced tumor necrosis factor alpha 2008;180(10):6544-52.
production from primary human monocytes by an 33. Sanger C, Busche A, Bentien G, Spallek R, Jonas
activated T-cell membrane-mediated mechanism. F, Bohle A, et al. Immunodominant PstS1 antigen
Infection and immunity. 2001;69(11):6580-7. of Mycobacterium tuberculosis is a potent biological
15. Popa C, Abdollahi-Roodsaz S, Joosten LAB, response modifier for the treatment of bladder
Takahashi N, Sprong T, Matera G, et al. Bartonella cancer. BMC cancer. 2004;4:86.
quintana lipopolysaccharide is a natural antagonist of 34. Palma C, Schiavoni G, Abalsamo L, Mattei F, Piccaro
Toll-like receptor 4. Infect Immun. 2007;75(10):4831- G, Sanchez M, et al. Mycobacterium tuberculosis
7. PstS1 amplifies IFN-gamma and induces IL-17/IL-
16. Tuberculosis Program PHS. Experimental studies 22 responses by unrelated memory CD4+ T cells
of vaccination, allergy, and immunity in tuberculosis: via dendritic cell activation. European journal of
3. Effect of killed BCG vaccine. Bull World Health immunology. 2013;43(9):2386-97.
Organ. 1955;12(1-2):47-62.
17. Garly ML, Martins CL, Bale C, Balde MA, Hedegaard
KL, Gustafson P, et al. BCG scar and positive
tuberculin reaction associated with reduced child
mortality in West Africa. A non-specific beneficial
effect of BCG? Vaccine. 2003;21(21-22):2782-90.
18. Roth A, Gustafson P, Nhaga A, Djana Q, Poulsen A,
Garly ML, et al. BCG vaccination scar associated
with better childhood survival in Guinea-Bissau. Int J
Epidemiol. 2005;34(3):540-7.
19. Stensballe LG, Nante E, Jensen IP, Kofoed PE,
Poulsen A, Jensen H, et al. Acute lower respiratory
tract infections and respiratory syncytial virus in
infants in Guinea-Bissau: a beneficial effect of BCG
vaccination for girls community based case-control
study. Vaccine. 2005;23(10):1251-7.
20. Wardhana, Datau EA, Sultana A, Mandang VV,
Jim E. The efficacy of Bacillus Calmette-Guerin
vaccinations for the prevention of acute upper
respiratory tract infection in the elderly. Acta medica
Indonesiana. 2011;43(3):185-90.
21. Moreira J, Aragao-Filho WC, Barillas SG, Barbosa
SM, Pedroza LA, Condino-Neto A. Human leucocytes
response to viable, extended freeze-drying or heat-
killed Mycobacterium bovis bacillus Calmette-Guerin.
Scandinavian journal of immunology. 2012;75(1):96-
101.
22. Shann F. Nonspecific effects of vaccines and the
reduction of mortality in children. Clinical therapeutics.
2013;35(2):109-14.
23. Minassian AM, Satti I, Poulton ID, Meyer J, Hill
AV, McShane H. A human challenge model for
Mycobacterium tuberculosis using Mycobacterium
bovis bacille Calmette-Guerin. The Journal of
infectious diseases. 2012;205(7):1035-42.
24. Selin LK, Wlodarczyk MF, Kraft AR, Nie S, Kenney
LL, Puzone R, et al. Heterologous immunity:
immunopathology, autoimmunity and protection

30 |
 Long-term Effect of γBCG on Immunity

Figure S1. (A,B) Adherent monocytes of γBCG vaccinated volunteers were ex-vivo primed with γBCG or
RPMI for 24h and after 6 days of resting restimulated with LPS. Production of IL-6 (A) and TNFα (B) was
determined in the supernatant, showing that monocytes of the healthy volunteers ex vivo can be trained
by γBCG both before and after γBCG vaccination . Cytokine levels in RPMI restimulated samples were
below detection level. Wilcoxon matched-pairs signed rank test. (* p < 0.05, ** p < 0.01).

| 31
 Chapter 3

γ-irradiated Bacille Calmette-Guérin

vaccination does not modulate the innate
immune response during experimental
human endotoxemia in adult males

Linda A.C. Hamers, Matthijs Kox, Rob J.W. Arts, Bastiaan A. Blok, Jenneke
Leentjens, Mihai G. Netea, Peter Pickkers.

J Immunol Res 2015;2015:261864

Chapter 3

ABSTRACT

Bacille Calmette-Guérin (BCG) vaccine exerts non-specific immunostimulatory

effects, and may therefore represent a novel therapeutic option to treat sepsis-
induced immunoparalysis. We investigated whether BCG vaccination modulates
the systemic innate immune response in humans in vivo during experimental
endotoxemia. We used inactivated γ-irradiated BCG vaccine because of the potential
risk of disseminated disease with the live vaccine in immunoparalyzed patients. In
a randomized double blind placebo-controlled study, healthy male volunteers were
vaccinated with γ-irradiated BCG (n=10) or placebo (n=10) and received 1 ng/kg
lipopolysaccharide (LPS) intravenously on day 5 after vaccination to assess the in-
vivo immune response. Peripheral blood mononuclear cells were stimulated with
various related and unrelated pathogens 5, 8 to 10, and 25 to 35 days after vaccination
to assess ex-vivo immune responses. BCG vaccination resulted in a scar in 90%
of vaccinated subjects. LPS administration elicited a profound systemic immune
response, characterized by increased levels of pro- and anti-inflammatory cytokines,
hemodynamic changes, and flu-like symptoms. However, BCG neither modulated
this in-vivo immune response, nor ex-vivo leukocyte responses at any time point. In
conclusion, γ-irradiated BCG is unlikely to represent an effective treatment option to
restore immunocompetence in patients with sepsis-induced immunoparalysis.

34 |
 γBCG and Endotoxemia

Sepsis is a clinical condition that represents a major medical challenge due to its
high mortality rate. Related to this, it is a major clinical challenge also because it
may be difficult to diagnose in due time, and difficult to treat. Previous adjunctive
therapeutic strategies, aiming to treat sepsis by inhibition of pro-inflammatory 3
mediators have failed, likely related to the recent insight that the majority of septic
patients do not succumb to the initial pro-inflammatory “hit”, but die at a later time-
point in a pronounced immunosuppressive state (1-3). This so-called ‘sepsis-induced
immunoparalysis’ results from counter-regulatory anti-inflammatory pathways that
are activated simultaneously with pro-inflammatory mechanisms (2-4). This renders
patients unable to clear the initial infection and increased vulnerable to secondary
infections (2, 3, 5). As a consequence, reconstitution of immunocompetence is
emerging as a new and promising therapeutic target to improve outcome in sepsis
patients (2, 3, 6, 7).
Bacille Calmette-Guérin (BCG) is the most widely used vaccine worldwide.
In addition to protection against tuberculosis (8), both observational studies
and randomized clinical trials have shown that BCG vaccination is associated
with beneficial effects on other infectious diseases as well. In this regard, early
administration of BCG vaccination leads to strongly reduced infant mortality,
mainly as a result of lower incidence of neonatal sepsis, respiratory infection, and
fever (9-15). These non-specific effects of BCG are suggested to be mediated by
two mechanisms: potentiation of adaptive immune responses against unrelated
pathogens, so-called ‘heterologous immunity’ (16), and epigenetic functional
reprogramming of innate immune cells to an enhanced phenotype, a process
described as ‘trained immunity’ (17-20). The latter process is characterized by
enhanced production of pro-inflammatory cytokines by monocytes that have been
previously primed by BCG, and is apparent upon stimulation with either specific
or unrelated pathogens (17, 21). In line with this, mononuclear cells isolated from
healthy volunteers and stimulated with unrelated pathogens show enhanced innate
immune responses after BCG vaccination (17), and some of these effects even
persist for up to one year (21). These effects largely rely on innate immune cells,
as BCG vaccination enhances resistance against Candida infection and increased
lipopolysaccharide (LPS)-induced cytokine production in splenocytes of mice lacking
T- and B-cells (17).
Considering its potentiating effects on host defense, BCG could represent a
therapeutic option to prevent or treat sepsis-induced immunoparalysis. Nevertheless,
as patients with sepsis have an increased susceptibility to secondary infections,
vaccination with live BCG may be associated with unwarranted risks for dissemination
(22). As recent data showed that γ-irradiated BCG has similar potentiating effects
on trained immunity in vitro (23), but does not present any risk for infection, this

| 35
Chapter 3

inactivated form of BCG represents a clinically relevant alternative in these patients.

However, the effects of BCG vaccination on the immune response in humans have
hitherto only been shown ex vivo (17, 21). It has yet to be established whether these
findings can be extrapolated to the human in-vivo situation, because ex-vivo data
might not always reflect in-vivo responses (24, 25). The human endotoxemia model,
in which healthy volunteers are administered a low dose of LPS, represents a unique
model to study modulation of the systemic inflammation in humans in vivo in a safe,
highly standardized, and reproducible manner (26).
The aim of the present study was to investigate the effects of vaccination with
γ-irradiated BCG on the systemic innate immune response in adult males in vivo
during experimental endotoxemia.

MATERIALS AND METHODS

Subjects - After approval from the Arnhem-Nijmegen Ethics Committee, 20 healthy
non-smoking male volunteers gave written informed consent to participate in this
study that was registered at ClinicalTrials.gov as NCT02085590. Subjects were
screened before the start of the experiment and had a normal physical examination,
electrocardiography, and routine laboratory values. Exclusion criteria were febrile
illness during the 2 weeks before start of the study, prior BCG vaccination, any
vaccination other than BCG within 3 months before start of the study, and a tuberculin
skin test within 1 year prior to the start of the study. Throughout the study period,
subjects were not allowed to take any drugs, including acetaminophen, and were
asked to refrain from alcohol and caffeine 24h, and from food 12h before the start
of the endotoxemia experiment. All study procedures were conducted in accordance
with the declaration of Helsinki including current revisions and Good Clinical Practice
guidelines.
Study design and procedures - We performed a randomized double-blind
placebo-controlled study. The study design is schematically depicted in Figure 1.
For reasons detailed in the introduction, γ-irradiated (and therefore inactivated)
BCG vaccine was used in this study. Irradiated BCG was cultured for 6 weeks using
Mycobacteria Growth Indicator Tubes according to Dutch national guidelines to
confirm inactivation, and no growth was observed. Subjects were randomly assigned
to receive either 0.075 mg (0.1 ml) γ-irradiated BCG-vaccine intracutaneously (BCG-
vaccine SSI; Statens Serum Institut, γ-irradiation (25-30 kGy) performed by Synergy
Health Ede, The Netherlands; n=10) or 0.1 ml placebo (BCG-reconstitution fluid:
Sauton; Statens Serum Institut; n=10) in a double-blind fashion. Five days after
vaccination, all subjects received an intravenous injection of LPS (lipopolysaccharide
derived from Escherichia coli O:113, Clinical Center Reference Endotoxin, National
Institutes of Health (NIH), Bethesda, MD), 1 ng/kg. Endotoxemia experiments were

36 |
 γBCG and Endotoxemia

conducted as described previously (25). Heart rate (three-lead electrocardiogram),

blood pressure, respiratory rate, and oxygen saturation (pulse oximetry) data were
recorded from a Philips MP50 patient monitor every 30 seconds by a custom in-
house-developed data recording system. LPS-induced flu-like symptoms (headache, 3
nausea, shivering, muscle and back pain) were scored every 30 min on a six-point
Likert scale (0 = no symptoms, 5 = worst ever experienced), resulting in a total score
of 0–25 points. After the endotoxemia experiment, additional blood samples were
drawn on days 8-10 and days 25-30 after vaccination. During the last visit, BCG scar
formation was measured by an independent research nurse (to maintain blinding)
using a centimeter ruler.
Cytokine Measurements - To analyze plasma cytokines, ethylenediaminetetraacetic
acid (EDTA) anticoagulated blood was centrifuged at 2,000xg at 4°C for 10min
immediately after withdrawal, and plasma was stored at -80°C until analysis.
Concentrations of TNFα, IL-6, IL-8, IL-10, IL-1β, IL-1 receptor antagonist (IL-1RA),
MCP-1, and IFNγ were measured in plasma batch-wise using a Luminex assay
according to the manufacturer’s instructions (Milliplex; Millpore, Billerica, MA, USA).
Leukocyte counts and differentiation - Analysis of leukocyte counts and
differentiation was performed in EDTA-anticoagulated blood using routine analysis
methods also used for patient samples (flow cytometric analysis on a Sysmex XE-
5000).
Peripheral mononuclear cell stimulation assays - The mononuclear cell fraction
was isolated by density centrifugation of EDTA-anticoagulated blood, diluted 1:1
in pyrogen-free saline over Ficoll-Paque (Pharmacia Biotech, Uppsala, Sweden).

ex vivo stimulations
plasma cytokines

time (days) day 1 day 6 between days 8-10 between days 25-35
vaccination
• γ-irradiated BCG (n=10)
• placebo (n=10)

LPS (1 ng/kg i.v.)

hospitalization
ex vivo stimulations
plasma cytokines

time (hours) -2 -1 0 1 2 3 4 5 6 7 8
Continuous monitoring

prehydration

Figure 1 - Experimental design. BCG: Bacille Calmette-Guérin; LPS: lipopolysaccharide.

| 37
Chapter 3

Isolated cells were washed twice in PBS and resuspended in culture medium (RPMI,
Invitrogen, Carlsbad, California, USA) supplemented with 50μg/ml gentamicin, 2mM
glutamax, and 1mM pyruvate. Cell counts were performed in a Coulter counter
(Coulter Electronics). A total of 5x10^5 mononuclear cells in 100μl were added
to round-bottomed 96-well plates (Greiner) with RPMI, sonicated Mycobacterium
tuberculosis (MTB) (1μg/ml, strain H37Rv), Escherichia coli lipopolysaccharide
(LPS; 1ng/ml; Sigma-Aldrich, St. Louis, MO, USA), heat-killed Staphylococcus
aureus (1x10^6 microorganisms/ml, clinical isolate), or heat-killed Candida albicans
(1x10^6 microorganisms/ml, strain UC820). After 24h (for determination of TNFα,
IL-1β, and IL-6) or 48h (for determination of IFNγ and IL-10) of incubation, plates
were centrifuged and supernatants were stored at -20°C until analysis. Cytokines
were measured batch-wise using commercially available ELISAs (R&D Systems,
MN, USA and Sanquin, Amsterdam, The Netherlands) according to the protocols
supplied by the manufacturers.
Calculations and Statistical Analysis - Data are represented as median and
interquartile range or mean and SEM, based on their distribution (calculated by
the Shapiro–Wilk test). The area under the curve (AUC) of cytokine levels during
experimental endotoxemia, representing an integrated measure of the cytokine
response, was calculated using time points 0-8h post-LPS. Comparisons were
made using Mann-Whitney U tests (non-normally distributed data, between-group
comparisons) or repeated measures two-way ANOVA (normally distributed data,
where the time factor represents differences across both groups over time and
the interaction factor represents between-group differences over time). Ex-vivo
cytokine data were log-transformed to obtain a normal distribution. A p-value ˂ 0.05
was considered statistically significant. Calculations and statistical analyses were
performed using Graphpad Prism version 5.0 (Graphpad Software, San Diego, CA,
USA).

RESULTS
Baseline characteristics
No differences in baseline characteristics between both groups were present (Table
1). γ-irradiated BCG vaccination resulted in a scar at the vaccination site in 9 out
10 subjects (median (range) size of 6 (1-9) mm). In the placebo group, 1 subject
developed a small scar (1 mm). BCG vaccination did not result in fever or other
clinical symptoms and no serious adverse events occurred during the trial.

Hemodynamic parameters and symptoms

LPS administration resulted in a typical increase in heart rate and flu-like symptoms,
and a decrease in mean arterial blood pressure (MAP) in all subjects, with no

38 |
 γBCG and Endotoxemia

Figure 2 - Blood pressure, heart rate, and symptoms during experimental endotoxemia in subjects
vaccinated with γ-irradiated BCG or placebo. Data are expressed as mean±SEM (n=10 per group).
P-values calculated using repeated measures two-way analysis of variance (ANOVA). MAP: mean arterial
pressure; HR: heart rate; bpm: beats/min.
differences between groups (Figure 2).

Plasma cytokines and circulating leukocyte counts

BCG-vaccination did not result in increased plasma levels of any of the measured
cytokines in the days following vaccination (Figure 3). As expected, administration of
LPS resulted in a sharp increase in plasma levels of the pro-inflammatory cytokines
TNFα, IL-6, IL-8 and MCP-1, as well as the anti-inflammatory cytokines IL-10 and
IL-1RA (Figure 3). However, no differences were observed between the BCG and
placebo groups. Similar to previous human endotoxemia studies (27), plasma
levels of IL-1β and IFNγ were below the lower detection limits in the majority of the
subjects at most time points. In some subjects and/or time-points, very low levels
(approximately 10 pg/mL) were found, but no clear patterns over time or differences
between groups were observed.
As described earlier, scar size differed substantially between BCG-vaccinated
subjects, which might represent vaccination efficacy, and is associated with non-
specific beneficial effects of BCG (28, 29). Therefore, we stratified the BCG-
vaccinated group according to scar size (≤5 mm, n=5; >5 mm, n=5). These stratified
analyses did not reveal notable differences in cytokine responses either (Figure S1).
After LPS administration, transient leukocytosis developed, reaching maximum
levels at t=8h, with no differences between groups (mean ± SEM of BCG and placebo
groups, respectively: 10.2 ± 0.7 vs. 9.7 ± 0.7 x 10^9/L, p=0.62). At the first visit
after the endotoxemia day (day 8-10), leukocyte numbers were normalized in both
groups (5.2 ± 0.4 vs. 5.7 ± 0.6 x 10^9/L in the BCG and placebo groups, respectively,
p=0.50).

Cytokine production by peripheral blood mononuclear cells

Five days after vaccination with BCG or placebo, but before LPS administration
in vivo, there were no differences between groups in ex-vivo cytokine responses

| 39
Chapter 3

Figure 3 - Plasma cytokine concentrations in subjects vaccinated with γ-irradiated BCG or

placebo. In the panels A-D, median values of pro-inflammatory cytokines TNFα, IL-6, IL-8, and MCP-1
are depicted while in panels E and F median values of anti-inflammatory cytokines IL-10 and IL-1RA are
shown (n=10 per group). Panels G-L depict median ± interquartile range of area under curve (AUC) the
respective cytokines (n=10 per group, Mann-Whitney U test).
induced by specific (Mycobacterium tuberculosis) or unrelated (LPS, Staphylococcus
aureus, and Candida albicans) pathogens or stimuli (fold change data (compared
with baseline) of IFNγ, TNFα, and IL-1β are depicted in Figure 4, and fold change
data of IL-6 and IL-10 in Figure S2. Absolute values of all cytokines are depicted
in Figure S3). Similar to previous endotoxemia experiments (25, 30), 4h after LPS
administration, an overall profound decrease in ex-vivo cytokine production was
observed, indicative of immunoparalysis. BCG vaccination did not influence the
development or magnitude of immunoparalysis. Likewise, no differences between
groups in ex-vivo cytokine responses to any of the pathogens or stimuli were found
on days 8-10 and 25-35 after vaccination. Of note, LPS-induced production of IFNγ,
as well as LPS- and Mycobacterium tuberculosis-induced production of IL-10, was
absent in many subjects and very low in others. Therefore, the endotoxemia-induced
decrease in ex-vivo cytokine production was less noticeable and did not always
reach statistical significance for these combinations. Staphylococcus aureus- and
Candida albicans-induced IL-10 production was absent in virtually all subjects and
was therefore not analyzed.

DISCUSSION
In the present study, we demonstrate that γ-irradiated BCG vaccination does not
influence the LPS-induced innate immune response in adult males in vivo five

40 |
 γBCG and Endotoxemia

Figure 4 - Ex-vivo cytokine production. Production of IFNγ, TNFα, and IL-1β by peripheral blood
mononuclear cells stimulated ex vivo with Mycobacterium tuberculosis (MTB), LPS, Staphylococcus
aureus (SA), and Candica albicans (CA) of subjects vaccinated with γ-irradiated BCG or placebo. Data
expressed as median and interquartile range of the fold change compared with day 1 (before vaccination)
(n=10 per group). p-values calculated using repeated measures two-way analysis of variance (ANOVA)
on log transformed data. Day 6 was the endotoxemia experiment day.

days later. Furthermore, no effects of BCG vaccination on cytokine production of

leukocytes stimulated ex vivo with specific and unrelated pathogens were observed.
As all measured parameters were similar between groups, we can conclude that five
days after vaccination, γ-irradiated BCG has no effect on the innate immune system
and therefore does not induce trained immunity. This is evident from both the lack of
an effect on LPS-induced plasma cytokine levels in vivo, as well as from the similar
ex-vivo innate cytokine responses (TNFα, IL-1β, IL-6, and IL-10) against unrelated
pathogens five days after vaccination in both groups. Previous epidemiological
studies have shown that scar formation after vaccinia or BCG vaccination is
associated with improved survival, possibly related to improved resistance against
infections (28, 29). Therefore, we stratified subjects based on scar size, but no
effects were found in these analyses either. Furthermore, no effects indicative of
trained immunity induction were found at later time-points, ranging from 8-10 days to
25-35 days after vaccination.
Our results are different from previous studies that used the live-attenuated BCG
vaccine (17, 21) instead of the γ-irradiated BCG. There are several reasons and/
or limitations of the present study that might explain these differences. First and
foremost, we used γ-irradiated BCG in the present study because our target treatment

| 41
Chapter 3

population consists of immunoparalyzed septic patients who may be at risk for

disseminated mycobacterial infection (22). We hypothesized that γ-irradiated BCG
would be effective in inducing trained immunity in vivo because recent unpublished
data of our group showed that γ-irradiated BCG exerts monocyte training in vitro.
Furthermore, previous in-vitro studies showed that monocytes could be trained with
live BCG, as well as with the inert NOD2 ligand MDP (17), highlighting that live BCG
persistence is not mandatory for inducing trained immunity in vitro. Nevertheless,
inactivating the vaccine could have reduced or abrogated the “training capacity” of
BCG. While live vaccines can replicate and/or disseminate in the host’s body and
thereby trigger the immune response to a greater extent, inactivated vaccines only
activate immune responses locally (31). Although the scar formation in γ-irradiated
BCG-vaccinated subjects indicates a local immune response, it could be envisioned
that possible training effects of γ-irradiated BCG are much less sustained and
widespread, and thus less pronounced. Along these lines, it was demonstrated
that two and four weeks after vaccination with live BCG, 83 and 50% of individuals
still displayed viable BCG at the vaccination site (32), respectively, indicative of a
relatively long-lasting “active infectious pool” of bacteria (or their products) and/or
cytokines that trigger a variety of responses. This is likely not relevant for the in-vitro
situation, where cells are continuously exposed to bacteria and/or their products
irrespective of whether they are alive or inactivated. Also, others have shown that
viable bacteria elicit more potent immune responses compared to killed bacteria, due
to recognition of so called ‘vita-PAMPs’ such as prokaryotic mRNA by innate immune
cells (33). The absent effects of γ-irradiated BCG on ex-vivo cytokine responses to
stimulation with M. tuberculosis further substantiate the hypothesis that γ-irradiation
results in functional inactivation of BCG, resulting not only in abrogation of trained
immunity but also of “classic” specific protection against M. tuberculosis.
Secondly, the timing of the interventions in our study might have precluded effects
of γ-irradiated BCG. We chose to assess in-vivo and ex-vivo responses already five
days after vaccination, in order to assess potential short-term effects that may be
most relevant during sepsis. We hypothesized that this period would be sufficient to
induce trained immunity based on the fact that in-vitro training by BCG only takes
one day and that non-specific beneficial effects of BCG-vaccination in neonates were
already apparent within 3 days (15). Nevertheless, in previous studies enhancing
effects of BCG on leukocytes were found 2 weeks, 3 months, and one year after
vaccination (17, 21). No earlier time-points were assessed in these earlier studies.
Thirdly, we only included young male volunteers in this study. There are
considerable differences in the cytokine response to LPS between males and
females (34). This is likely influenced by menstrual cycle-related hormonal variations
that can affect the immune response. Because we wanted our study population to

42 |
 γBCG and Endotoxemia

be as homogenous as possible, we therefore included only males, analogous to

virtually all of our previous endotoxemia studies. This might have biased our results,
because the majority of the studies on non-specific effect of the BCG vaccine point
to important sex-differential non-specific effects, and often the most pronounced 3
effects were observed among females (12, 35, 36). Non-specific effects may also
vary with age, nevertheless, live BCG exerted profound effects in a similarly aged
study population (17, 21).
Fourthly, possible training effects of γ-irradiated BCG on monocytes in the long-
term might have been obscured by the LPS administration five days after vaccination.
BCG-induced trained immunity has been shown to be mediated through epigenetic
reprogramming of monocytes (17). Interestingly, exposure to LPS results in opposite
epigenetic changes in monocytes and/or macrophages (20). Therefore, possible
training effects induced by γ-irradiated BCG might have been nullified by the LPS
administration.
Fifthly, the human endotoxemia model employed in this study is relatively mild
and does not replicate the severe sepsis-induced immunoparalysis observed
in actual patients. Therefore, although unlikely based on the complete absence
of effects in the present study, we cannot exclude the possibility that γ-irradiated
BCG exerts immunomodulatory effects in a true model of immunoparalysis or in
immunoparalyzed septic patients.
Finally, our study is limited by the fact that, apart from medical history, we did
not screen for previous exposure to Mycobacterium tuberculosis. We chose not to
perform a tuberculin skin test since this could trigger trained immunity effects on
its own which would confound our study results. However, the infectious pressure
of tuberculosis in the Netherlands is very low (37), and this possibility is unlikely to
explain the absent effects of γ-irradiated BCG.
In view of the points raised above, a study using live BCG and possibly other
timing of the interventions could be considered. While such as study would be
warranted to elucidate the mechanisms behind the important nonspecific beneficial
effects of BCG vaccination in neonates (9-15), it may be less relevant with regard to
sepsis patients, in which the use of live BCG vaccine would be associated with too
high risks.

CONCLUSIONS
γ-irradiated BCG does not modulate the in-vivo innate immune response in adult
male volunteers five days after vaccination. Furthermore, vaccination did not induce
trained immunity ex vivo. Therefore, γ-irradiated BCG is unlikely to represent a viable
treatment option to restore immunocompetence in patients with sepsis-induced
immunoparalysis.

| 43
Chapter 3
REFERENCES
1. Boomer JS, To K, Chang KC, Takasu O, Osborne
DF, Walton AH, et al. Immunosuppression in patients
who die of sepsis and multiple organ failure. JAMA.
2011;306(23):2594-605.
2. Hamers L, Kox M, Pickkers P. Sepsis-induced
immunoparalysis: mechanisms, markers, and
treatment options. Minerva anestesiologica. 2014.
3. Leentjens J, Kox M, van der Hoeven JG, Netea
MG, Pickkers P. Immunotherapy for the adjunctive
treatment of sepsis: from immunosuppression to
immunostimulation. Time for a paradigm change? Am
J Respir Crit Care Med. 2013;187(12):1287-93.
4. Le Tulzo Y, Pangault C, Amiot L, Guilloux V, Tribut O,
Arvieux C, et al. Monocyte human leukocyte antigen-
DR transcriptional downregulation by cortisol during
septic shock. American journal of respiratory and
critical care medicine. 2004;169(10):1144-51.
5. Otto GP, Sossdorf M, Claus RA, Rodel J, Menge
K, Reinhart K, et al. The late phase of sepsis is
characterized by an increased microbiological burden
and death rate. Crit Care. 2011;15(4):R183.
6. Angus DC, van der Poll T. Severe sepsis and septic
shock. N Engl J Med. 2013;369(9):840-51.
7. Meisel C, Schefold JC, Pschowski R, Baumann T,
Hetzger K, Gregor J, et al. Granulocyte-macrophage
colony-stimulating factor to reverse sepsis-
associated immunosuppression: a double-blind,
randomized, placebo-controlled multicenter trial. Am
J Respir Crit Care Med. 2009;180(7):640-8.
8. Colditz GA, Brewer TF, Berkey CS, Wilson ME,
Burdick E, Fineberg HV, et al. Efficacy of BCG vaccine
in the prevention of tuberculosis. Meta-analysis of the
published literature. JAMA. 1994;271(9):698-702.
9. Levine MI, Sackett MF. Results of BCG immunization
in New York City. American review of tuberculosis.
1946;53:517-32.
10. Rosenthal SR, Loewinsohn E, Graham ML, Liveright
D, Thorne MG, Johnson V. BCG vaccination in
tuberculous households. The American review of
respiratory disease. 1961;84:690-704.
11. Breiman RF, Streatfield PK, Phelan M, Shifa N,
Rashid M, Yunus M. Effect of infant immunisation on
childhood mortality in rural Bangladesh: analysis of
health and demographic surveillance data. Lancet.
2004;364(9452):2204-11.
12. Roth A, Jensen H, Garly ML, Djana Q, Martins
CL, Sodemann M, et al. Low birth weight infants
and Calmette-Guerin bacillus vaccination at birth:
community study from Guinea-Bissau. The Pediatric
infectious disease journal. 2004;23(6):544-50.
13. Kristensen I, Aaby P, Jensen H. Routine vaccinations
and child survival: follow up study in Guinea-Bissau,
West Africa. BMJ. 2000;321(7274):1435-8.
14. Aaby P, Roth A, Ravn H, Napirna BM, Rodrigues A,
Lisse IM, et al. Randomized trial of BCG vaccination
at birth to low-birth-weight children: beneficial
nonspecific effects in the neonatal period? The
Journal of infectious diseases. 2011;204(2):245-52.
15. Biering-Sorensen S, Aaby P, Napirna BM, Roth A,
Ravn H, Rodrigues A, et al. Small randomized trial
among low-birth-weight children receiving bacillus
Calmette-Guerin vaccination at first health center
contact. Pediatr Infect Dis J. 2012;31(3):306-8.
16. Flanagan KL, van Crevel R, Curtis N, Shann F, Levy
O, Optimmunize N. Heterologous (“nonspecific”) and
sex-differential effects of vaccines: epidemiology,
clinical trials, and emerging immunologic
mechanisms. Clinical infectious diseases : an official
publication of the Infectious Diseases Society of
America. 2013;57(2):283-9.
17. Kleinnijenhuis J, Quintin J, Preijers F, Joosten LA,
Ifrim DC, Saeed S, et al. Bacille Calmette-Guerin
induces NOD2-dependent nonspecific protection
from reinfection via epigenetic reprogramming of
monocytes. Proceedings of the National Academy
of Sciences of the United States of America.
2012;109(43):17537-42.
18. Netea MG, van Crevel R. BCG-induced protection:
Effects on innate immune memory. Seminars in
immunology. 2014;26(6):512-7.
19. Quintin J, Cheng SC, van der Meer JW, Netea
MG. Innate immune memory: towards a better
understanding of host defense mechanisms. Current
opinion in immunology. 2014;29:1-7.
20. Saeed S, Quintin J, Kerstens HH, Rao NA,
Aghajanirefah A, Matarese F, et al. Epigenetic
programming of monocyte-to-macrophage
44 |
differentiation and trained innate immunity. Science.
2014;345(6204):1251086.
21. Kleinnijenhuis J, Quintin J, Preijers F, Benn CS,
Joosten LA, Jacobs C, et al. Long-lasting effects of
BCG vaccination on both heterologous Th1/Th17
responses and innate trained immunity. J Innate
Immun. 2014;6(2):152-8.
22. Talbot EA, Perkins MD, Silva SF, Frothingham R.
Disseminated bacille Calmette-Guerin disease after
vaccination: case report and review. Clinical infectious
diseases : an official publication of the Infectious
Diseases Society of America. 1997;24(6):1139-46.
23. Arts RJ, Blok BA, Aaby P, Joosten LA, de Jong D,
van der Meer JW, et al. Long-term in vitro and in
vivo effects of gamma-irradiated BCG on innate and
adaptive immunity. J Leukoc Biol. 2015;98(6):995-
1001.
24. Dorresteijn MJ, Draisma A, van der Hoeven JG,
Pickkers P. Lipopolysaccharide-stimulated whole
blood cytokine production does not predict the
inflammatory response in human endotoxemia.
Innate immunity. 2010;16(4):248-53.
25. Kox M, de Kleijn S, Pompe JC, Ramakers BP, Netea
MG, van der Hoeven JG, et al. Differential ex vivo
and in vivo endotoxin tolerance kinetics following
human endotoxemia. Critical care medicine.
2011;39(8):1866-70.
26. Bahador M, Cross AS. From therapy to experimental
model: a hundred years of endotoxin administration
to human subjects. J Endotoxin Res. 2007;13(5):251-
79.
27. Kox M, van Eijk LT, Zwaag J, van den Wildenberg
J, Sweep FC, van der Hoeven JG, et al. Voluntary
activation of the sympathetic nervous system and
attenuation of the innate immune response in humans.
Proc Natl Acad Sci U S A. 2014;111(20):7379-84.
28. Jensen ML, Dave S, Schim van der Loeff M, da Costa
C, Vincent T, Leligdowicz A, et al. Vaccinia scars
associated with improved survival among adults in
rural Guinea-Bissau. PloS one. 2006;1:e101.
29. Roth A, Gustafson P, Nhaga A, Djana Q, Poulsen A,
Garly ML, et al. BCG vaccination scar associated
with better childhood survival in Guinea-Bissau. Int J
Epidemiol. 2005;34(3):540-7.
30. de Vos AF, Pater JM, van den Pangaart PS, de
Kruif MD, van ‘t Veer C, van der Poll T. In vivo
lipopolysaccharide exposure of human blood
leukocytes induces cross-tolerance to multiple TLR
ligands. Journal of immunology. 2009;183(1):533-42.
31. Cox RJ, Brokstad KA, Ogra P. Influenza virus:
immunity and vaccination strategies. Comparison
of the immune response to inactivated and live,
attenuated influenza vaccines. Scandinavian journal
of immunology. 2004;59(1):1-15.
32. Minassian AM, Satti I, Poulton ID, Meyer J, Hill
AV, McShane H. A human challenge model for
Mycobacterium tuberculosis using Mycobacterium
bovis bacille Calmette-Guerin. J Infect Dis.
2012;205(7):1035-42.
33. Sander LE, Davis MJ, Boekschoten MV, Amsen D,
Dascher CC, Ryffel B, et al. Detection of prokaryotic
mRNA signifies microbial viability and promotes
immunity. Nature. 2011;474(7351):385-9.
34. van Eijk LT, Dorresteijn MJ, Smits P, van der Hoeven
JG, Netea MG, Pickkers P. Gender differences in
the innate immune response and vascular reactivity
following the administration of endotoxin to human
volunteers. Crit Care Med. 2007;35(6):1464-9.
35. Stensballe LG, Nante E, Jensen IP, Kofoed PE,
Poulsen A, Jensen H, et al. Acute lower respiratory
tract infections and respiratory syncytial virus in
infants in Guinea-Bissau: a beneficial effect of BCG
vaccination for girls community based case-control
study. Vaccine. 2005;23(10):1251-7.
36. Aaby P, Jensen H, Rodrigues A, Garly ML, Benn
CS, Lisse IM, et al. Divergent female-male mortality
ratios associated with different routine vaccinations
among female-male twin pairs. International journal
of epidemiology. 2004;33(2):367-73.
37. Murray CJ, Ortblad KF, Guinovart C, Lim SS, Wolock
TM, Roberts DA, et al. Global, regional, and national
incidence and mortality for HIV, tuberculosis, and
malaria during 1990-2013: a systematic analysis for
the Global Burden of Disease Study 2013. Lancet.
2014;384(9947):1005-70.
 γBCG and Endotoxemia

Figure S1 - Area under curve (AUC) of plasma concentrations of pro-inflammatory cytokines TNFα,
IL-6, IL-8, and MCP-1, and anti-inflammatory cytokines IL-10 and IL-1RA in subjects vaccinated with
γ-irradiated BCG stratified according to vaccination scar size (≤5 mm or >5 mm, n=5 per group). Data are
presented as median ± interquartile range of the respective cytokines. p-values calculated using Mann-
Whitney U test.

| 45
Chapter 3

Figure S2 - Production of IL-6 and IL-10 by peripheral blood mononuclear cells stimulated ex vivo with
Mycobacterium tuberculosis (MTB), LPS, Staphylococcus aureus (SA), and Candica albicans (CA) of
subjects vaccinated with γ-irradiated BCG or placebo. SA- and CA-induced IL-10 production was absent
in virtually all subjects and was therefore not analyzed. Data expressed as median and interquartile range
of the fold change compared with day 1 (before vaccination) (n=10 per group). p-values calculated using
repeated measures two-way analysis of variance (ANOVA, time and interaction terms) on log transformed
data. Day 6 was the endotoxemia experiment day.

46 |
 γBCG and Endotoxemia

Figure S3 - Production of IFNγ, TNFα, IL-1β, IL-6, and IL-10 by peripheral blood mononuclear cells
stimulated ex vivo with Mycobacterium tuberculosis (MTB), LPS, Staphylococcus aureus (SA), and
Candica albicans (CA) of subjects vaccinated with γ-irradiated BCG or placebo. Data expressed as
median and interquartile range (n=10 per group). Day 6 was the endotoxemia experiment day. For
statistical analyses, see Figures 4 and Figure S2, which depict the same data expressed as fold change
compared with day 1.

| 47
 Chapter 4

Vitamin A induces inhibitory histone

methylation modifications and
downregulates trained immunity in
human monocytes
Rob J.W. Arts, Bastiaan A. Blok, Reinout van Crevel, Leo A.B. Joosten, Peter Aaby,
Christine S. Benn, Mihai G. Netea.

J Leukoc Biol 2015;1:129-36

Chapter 4

ABSTRACT

Epidemiological studies suggest that vitamin A supplementation (VAS) has long-

lasting immunomodulatory effects. We hypothesized that all-trans retinoic acid
(ATRA) inhibits inflammatory cytokines in a model of trained immunity in monocytes,
by inducing epigenetic reprogramming through histone modifications. We used an
earlier described in-vitro model of trained immunity, in which adherent monocytes of
healthy volunteers were incubated for 24h with BCG in the presence or absence of
ATRA. After washing the cells, cells were incubated for additional 6 days in culture
medium, were thereafter restimulated with microbial ligands, and cytokine production
was assessed. ATRA inhibited cytokine responses upon restimulation of monocytes,
and this effect was exerted through increased expression of SUV39H2, a histone
methyltransferase that induces the inhibitory mark H3K9me3. H3K9me3 at promoter
sites of several cytokines was upregulated by ATRA, and inhibition of SUV39H2
restored cytokine production. In addition to H3K9me3, the stimulatory histone mark
H3K4me3 was downregulated by ATRA at several promoters of cytokine genes. We
can therefore conclude that ATRA inhibits cytokine production in models of direct
stimulation or BCG-induced trained immunity, and that these effects are mediated
by histone modifications.

50 |
 ATRA induces Epigenetic Changes in Monocytes

Vitamin A is a collective term for several essential nutrients, which can be obtained
from the diet either as retinyl esters or as carotenoids. The liver stores vitamin A as
esters, which can be converted into retinol and distributed through the whole body
carried by retinol binding protein. Once reaching its target tissue, retinol is converted
into the biological active form of vitamin A, retinoic acid. Retinoic acid can bind to one
of the three retinoic acid receptors (α, β, γ), that form a heterodimer with a retinoic X
receptor to bind a response element and promote transcription of the target genes 4
(1).
Vitamin A plays an important role in the immune system, influencing both the
innate and the adaptive immune system (2). In innate immunity, retinoic acid mainly
inhibits cytokine production of monocytes, macrophages and dendritic cells, and
regulates cell differentiation (2-4).
WHO recommends high-dose vitamin A supplementation (VAS) in countries
at risk of vitamin A deficiency; it is estimated that this intervention reduces overall
child mortality by 24% (5). However, the effect of VAS may not always be beneficial.
Attempts to extend the beneficial effect of VAS to infants by providing VAS at birth
have shown conflicting results (6), with some studies showing a tendency for
higher mortality, in particular in females in the second half of infancy (7, 8). Several
studies have also noted interactions between VAS and routine vaccinations, with
a potential negative effect of vitamin A in females who receive diphtheria-tetanus-
pertussis vaccine (DTP) (9, 10). These results suggest that the effect of vitamin
A supplementation may not merely be a question of restoring vitamin A levels to
normal levels, but that these high-dose supplements may have long-lasting effects
on the immune system (11).
Therefore, it is important to elucidate the potential long-lasting effects of vitamin
A on the immune system. An increasing number of studies support the concept
that BCG vaccination has beneficial heterologous effects and can reduce overall
child mortality in low-income countries due to protection from sepsis and respiratory
infections (12, 13). It has been proposed that these non-specific effects of BCG
vaccine are mediated via training of the innate immune system: a non-specific
priming of innate immune function exerted through epigenetic reprogramming.
Recently, we have shown that vaccinating healthy volunteers with BCG leads to long
term epigenetic changes in monocytes, which lead to higher cytokine response upon
stimulation with a nonrelated pathogens (14, 15).
Until now, studies have mainly focussed on short-term effects of all-trans retinoic
acid (ATRA) on innate immune cells, showing inhibitory effects on the induction
of inflammation in human and rodent PBMCs and monocytes (16-20). Several
mechanisms have been proposed for these effects, among which the downregulation
of TLR2 (but not TLR4) expression (20), or inhibition of ERK/MAPK pathway and

| 51
Chapter 4

nuclear translocation of NF-κB, the latter as a result of STAT-1 repression (18,

19, 21). ATRA has also been found to downregulate PGE2 production in mouse
peritoneal macrophages (3) and adding retinoic acid to human monocytes inhibited
differentiation, maturation and function of dendritic cells (22, 23). However, the
long-lasting effects of vitamin A have been little studied, and whether epigenetic
reprogramming is the underlying cause of these functional changes is unknown.
We therefore hypothesised that vitamin A could induce epigenetic changes in
innate immune cells, leading to long-term immunomodulatory effects on the immune
system. To examine this hypothesis we assessed in the present study the in-vitro
effect of ATRA (the most common vitamin A metabolite) on the function of monocytes/
macrophages both in direct stimulation assays and in an experimental model of
BCG-induced trained immunity.

MATERIALS AND METHODS

Monocyte stimulation - Monocyte isolation and the experimental model of trained
immunity was performed as described previously (15, 24). In short, adherent
monocytes were incubated at 37oC with different concentrations of ATRA (dissolved
in pure ethanol, Sigma-Aldrich, MO, USA) with or without BCG (SSI, Denmark, 5μg/
ml). After 24h, the supernatant was discarded and cells were washed once with
200μl warm PBS. Then cells were incubated for 5 days in 200μl RPMI with 10%
human serum, which was changed once during incubation. At day 6 the cells were
restimulated with Escherichia coli LPS (serotype 055:B5, Sigma-Aldrich, 10 ng/ml),
or RPMI as a control and after 24h supernatants were stored at -20oC until ELISA
experiments were performed to assess cytokine production.
For the inhibition experiments, 1h before addition of ATRA, monocytes were
preincubated with the SUV39H2 inhibitor chaetocin (50μmol/l, Sigma-Aldrich).
Cytokine measurement - Cytokine production was determined in supernatants
using commercial ELISA kits for IL-1RA, TNFα (R&D systems, MN, USA) and IL-6,
IL-8, IL-10 (Sanquin, Amsterdam, The Netherlands) following the instructions of the
manufacturer.
mRNA expression - For quantitative RT-PCR (qPCR), adherent monocytes
were incubated in 24-well plates (Corning) with ATRA for 4h or 24h, after which
supernatant was discarded and TRIzol Reagent (Invitrogen) was added. For re-
stimulation experiments, 12-well plates were used. The experiment was performed
as described above. On day 6 cells were restimulated with LPS for 4h and then
stored in TRIzol for assessment of mRNA transcription. Total RNA purification was
performed and concentrations of RNA were assessed using a Nanodrop (Thermo
Fisher Scientific, MA, USA). Isolated RNA was reverse transcribed into cDNA using
iScript cDNA Synthesis Kit (Bio-Rad, CA, USA). qPCR was performed by using the

52 |
 ATRA induces Epigenetic Changes in Monocytes

SYBR Green method on a RT-PCR machine (OneStep, Applied Biosystems, CA,

USA). The primers used (Biolegio, Nijmegen, Netherlands) can be found in Table S1.
Samples were analysed by the ΔΔCT method, using HPRT as a housekeeping gene.
Western blots - Adherent monocytes were incubated in 6-well plates with different
concentrations of ATRA. After 20h cells were lysed and stored at -20oC. The amount
of protein was assessed using a BCA assay (Thermo Fisher Scientific) and equal
amounts of protein were loaded to 7.5% gels. The separated proteins were transferred 4
to a nitrocellulose membrane (GE-healthcare), which was treated with a signal
enhancer (Thermo Fisher Scientific) before it was blocked in 5% milk (Campina,
The Netherlands). Rabbit polyclonal antibodies against SUV39H2 (Santa Cruz, TX,
USA) and actin (Sigma) were used to determine the protein expression, which were
visualized using SuperSignal West Femto Substrate (Thermo Fisher Scientific) and
ECL (GE Healthcare), respectively. Normalised expression was analysed by Image
Lab Sofware 5.0 (Bio-Rad, CA, USA).
ChIP analysis - Detailed methods have been described before (25). In short,
adherent monocytes were incubated in 6-well plates (Corning) for 24h with 1nM of
ATRA or RPMI and treated as described above. At day 6 cells were fixated in 1%
formaldehyde (Thermo Fisher Scientific) and stored at 40C in PBS until sonication
was performed (Bioruptor, Diagenode, Belgium). Sonicated chromatin was stored
at -80oC until further analysis. Half of the chromatin of 1x10^6 cells was incubated
overnight with an H3K9me3 antibody (Diagenode, 1µg) to yield only H3K9me3
positive chromatin and the other half was used as total input. DNA from both samples
was purified over DNA purification columns (Qiagen, NJ, USA) and qPCR was
performed to determine the percentage of H3K9me3 DNA for cytokine promoters
(see Table S1), with ZFN274_3UTR as a positive control and GAPDH as a negative
control.
Gene accessibility - This was assessed by the EpiQ Chromatin Analysis kit (Bio-
rad). In short, cells were cultured in duplicate for 6 days and then treated (or not) with
DNase. DNA was isolated over purification columns and qPCR was performed as
described above using a control and reference gene provided by the manufacturer.
Calculations were performed as suggested by the manufacturer.
Statistical analysis - Differences were analysed using a paired t-test, Wilcoxon
signed-rank test, or one-way Anova where applicable, in Graphpad prism 5 (CA,
USA). p < 0.05 was considered statistically significant. Data are shown as means ±
SEM.

RESULTS AND DISCUSSION

ATRA priming downregulates cytokine production by macrophages
Preincubation of monocytes during the first 24h with ATRA inhibited the capacity of

| 53
Chapter 4

macrophages to release cytokines upon stimulation with LPS on day 6 in a dose-

dependent manner (Figure 1A,B). The control and trained monocytes restimulated
with RPMI did not display any cytokine production. No difference in effect of ATRA
between male and female volunteers was found (data not shown).
Cell death was excluded as an explanation for the observed effects, as LDH
release and Annexin V/PI staining, demonstrating cell death, were only induced using
the highest concentrations of ATRA (Figure S1). Therefore, we used a low dose of
1nM in all 7-day experiments. In a separate analysis, using various differentiation
markers, it was found that ATRA does not induce differentiation of monocytes
towards an M1, M2 or DC phenotype (Figure S2).

Figure 1 - ATRA
downregulates cytokine
production.
(A,B) Monocytes that were
incubated for 24h with
different concentrations
of ATRA, followed by a
washing step thereafter,
showed lower production
of IL-6 and TNFα upon
24h restimulation with
LPS at day 6. (C-G)
This downregulation
was not specific for
LPS restimulation, nor
cytokine specific. The
RPMI restimulated cells
did not show any cytokine
production. (H-L) The
inhibition of cytokine
production by ATRA (1nM) was caused by decreased gene transcription, as lower mRNA levels of 4h
after LPS restimulation were observed. (M,N) Training of monocytes with BCG for 24h potentiated the
response of the cells to LPS 6 days later. Adding ATRA during the first 24h inhibited the stimulating effect
of BCG on LPS-induced cytokines. (n=6, * p < 0.05, ** p < 0.01, *** p < 0.001).

54 |
 ATRA induces Epigenetic Changes in Monocytes

In order to assess whether the effects of ATRA were specific to LPS restimulation
and for IL-6 and TNFα production, macrophages were restimulated for 24h with
different ligands or pathogens and additional macrophage-derived cytokines were
measured. It was shown that ATRA reduces cytokine production of both pro- and
anti-inflammatory cytokines to all ligands (Figure 1C-G). Upon restimulation with
LPS on day 6, qPCR demonstrated that the decrease of cytokine production was a
result of lower transcription (Figure 1H-L). 4
ATRA inhibits the training effect of BCG on the innate immune system
Monocytes trained by BCG in an in-vitro 7-day culture system, produced more
cytokines upon restimulation on day 6 with LPS (Figure 1M,N) compared to cells
cultured without BCG (Figure 1A,B), as previously described (15). Adding ATRA to
BCG during the first 24h of monocyte priming, inhibited the potentiating effect of
BCG on restimulation with LPS, in a dose-dependent manner (Figure 1M,N).

ATRA enhances expression of histone methyltransferase SUV39H2

As incubation of monocytes for 24h with ATRA has an effect on the cytokine
production 6 days later, and as ATRA is known to modulate epigenetic marks in
other cells (26-28), it is likely that epigenetic mechanisms play a role in this long-
lasting effect of ATRA. Two important inhibitory histone marks are the methylation
of histone 3 at lysine 9 or 27 (H3K9 or H3K27) (29). We firstly determined whether
transcription of one of the methyltransferases inducing methylation of H3K9 or H3K27
was induced upon stimulation of monocytes with ATRA. mRNA was isolated after
4h and 24h stimulation of monocytes with 1μM of ATRA: qPCR analysis of several
methyltransferases showed a 2-fold induction of mRNA production of SUV39H2,
a methyltransferase inducing trimethylation of H3K9 (H3K9me3) (Figure 2A). In
contrast, the expression of other methyltransferases was not influenced by ATRA.
The increase of gene expression was accompanied by increased SUV39H2 protein,
measured by Western blot, showing a dose dependent increase upon stimulation
with ATRA (Figure 2B,C). The exact mechanism through which ATRA causes an
increase of SUV39H2 remains to be assessed in future studies. As ATRA binds to
the retinoic acid receptor, a nuclear receptor which can bind DNA at a response
element, it is conceivable that ATRA could exert a direct effect to the transcription of
SUV39H2. However, an indirect effect via other intermediates cannot be excluded
without further studies (1).

ATRA leads to increased H3K9me3 and decreased H3K4me3 at the promoter

sites of cytokines
To determine whether ATRA indeed leads to a long-term increase of H3K9me3,

| 55
Chapter 4

Figure 2 - ATRA induces transcription and production

of SUV39H2. (A) Monocytes were incubated for 4h or
24h with 1μM of ATRA, after which mRNA was isolated
and the production of methyltransferases inducing
methylation of H3K27 (EZH2) or H3K9 (others) was
determined. Only the transcription of SUV39H2, which
induces H3K9me3, was significantly upregulated. (n=6,
* p < 0.01). (B) Monocytes were incubated for 20h with
different concentrations of ATRA. Then cells were lysed
and SUV39H2 production was assessed by Western
blot showing an increased production of SUV39H2 while
using higher concentrations of ATRA. (C) Average of
normalised SUV39H2 expression by Western blot of 5
independent representative experiments. (* p < 0.05, **
p < 0.01 vs both RPMI/EtOH).

monocytes were incubated with ATRA for 24h,

after which they were washed and incubated
in culture medium. When DNA was isolated
6 days later, chromatin immunoprecipitation
and PCR assessment showed a significant
increase of H3K9me3 at the gene promoters
of the cytokines measured (Figure 3A),
and this increase was also found at day 10
(Figure S3). As for TNFA gene, all primers
covering almost the whole promoter showed
an increase in H3K9me3, for the other
promoters (IL6, IL8, IL10, IL1RA) only one primer was used, showing the same
effect (Figure 3A).
There are several arguments for a relevant role of SUV39H2 in the observed
increase of H3K9me3 by ATRA. Firstly, SUV39H2 is a histone methyltransferase
that specifically induces H3K9me3. H3K9me3 is traditionally considered a strong
repressive mark, which creates constitutive heterochromatin, a highly inactive form
of chromatin that is both long-lasting and difficult to reverse. In contrast, H3K27me3
and H3K9me1/2 result in facultative heterochromatin, which is more easily reversible
(29, 30). As the mRNA level of other methyltransferases was not upregulated, we
did not investigate H3K27me3 and H3K9me1/2, but we cannot exclude a potential
role of these or other epigenetic marks as well. Secondly, H3K9me3 is associated
with recruitment of heterochromatin protein 1 (HP1), which in turn can induce DNA
methylation by recruitment of DNA methyltransferases (31). Furthermore, it has
also been shown that ATRA itself can modulate DNA methylation status in different
cell types (26, 32-34). Therefore, it seems plausible that DNA methylation status of
cytokines genes can play a role as well in the inhibitory effect of ATRA.
Interestingly, we did not observe a complete gene silencing (Figure 1), although

56 |
 ATRA induces Epigenetic Changes in Monocytes

Figure 3 - ATRA caused an increase of H3K9me3 and decrease of H3K4me3 at the promoter sites
of cytokines. (A,B) Monocytes were incubated for 24h with 1nmol/L of ATRA. At day 6 DNA was isolated
to determine the amount of H3K9me3 at the promoter sites of IL6, IL8, IL10, IL1RA and TNFA. For TNFA
5 primers were used to cover whole promoter region, as no clear differences were seen, only one primer
was used for the other cytokines. ATRA significantly increased the repressive H3K9me3 mark at the
promoters of the genes of interest and decreased the activating histone mark H3K4me3. (n=6, * p < 0.05).
(C) Also gene accessibility was determined at the promoters. Accessibility of GAPDH (the reference
gene) was set at 100% and accessibility of the cytokine promoters was assessed relative to GAPDH. A
decreased accessibility in ATRA primed cells was observed. (n=5, * p < 0.05, ** p < 0.01).

H3K9me3 was upregulated. This might be due to an incomplete upregulation of

H3K9me3 at the pro-inflammatory promoter sites. But it could also be a result of
the HP1 paradox, which shows that genes bound by HP1 (which traditionally has
a repressive signature) can be transcriptionally active (35). The specific underlying
mechanism has not been elucidated, but in myoblasts/myocytes it was shown that
HP1α is able to recruit JHDM3A, a H3K9 demethylase, which would lead to gene
activation (36). However, this is less likely to occur for ATRA as H3K9me3 remained
upregulated at day 10 (Figure S3). Furthermore, it was shown that H3K9me3 may

| 57
Chapter 4

suppress or activate gene transcription in cancer cells, depending on the DNA

methylation profiles, the site of H3K9me3, and other histone marks present (37).
Also the sub form HPγ has been proposed to play a role in transcription activity, as it
can be both present in eu- and heterochromatin (38). Hence, more study is needed
to elucidate the precise role of DNA methylation and HP1 recruitment in this context.
Furthermore, until now we have only looked at repressive histone marks. However,
BCG has already been shown to prime monocytes by inducing epigenetic changes by
increasing H3K4me3 at pro-inflammatory cytokine promoters, both in vitro and in vivo
(15). As ATRA also decreased the cytokine production of BCG trained macrophages,
we also determined the effect of ATRA on H3K4me3. Therefore, monocytes were
incubated with ATRA for 24h and at day 6 H3K4me3 at cytokine promoters was
determined. It appeared that for IL8, IL10 and IL1RA a decrease of H3K4me3 was
present in ATRA-primed macrophages. For IL6 and TNFA no significant differences
were found (Figure 3B). This shows that the downregulation of cytokine production
by ATRA is not solely dependent on H3K9me3 and supports the hypothesis that
ATRA can also influence other epigenetic marks, and that the downregulation of
cytokine production is a result of a complex interplay of these changes.
To finally show that the overall effect of epigenetic changes induced by ATRA
results in more dense chromatin, gene accessibility at the promoter sites was
assessed by DNase treatment. At day 6 of the culture protocol, cells primed with
ATRA showed a decreased gene accessibility, in line with the observed epigenetic
changes (Figure 3C).

Inhibition of SUV39H2 can partially restore cytokine production and epigene-

tic changes
Finally, we wanted to assess whether methylation of H3K9 is indeed involved in the
effects of ATRA, by blocking it with the SUV39H2 inhibitor chaetocin. When chaetocin
was added for the 24h incubation period with ATRA +/- BCG, it restored cytokine
responses upon restimulation of the cells, suggesting a causative role for SUV39H2
in the inhibition of cytokine production by ATRA (Figure 4A,B), which was due to
restored transcription (Figure 4C,D). To validate the mechanism, we additionally
showed that chaetocin reversed the increase of H3K9me3 at the promoters of IL6
and TNFA induced by ATRA. This effect was present in both macrophages and BCG-
trained macrophages (Figure 4E,F, and S4).
Interestingly, we also observed that H3K9me3 was downregulated by BCG
training of the cells: this suggests that a combination of increased activation markers
(e.g. H3K4me3) and decreased repression markers (e.g. H3K9me3) contribute to
monocyte training by BCG, and this should be assessed in other models of trained
immunity as well.

58 |
 ATRA induces Epigenetic Changes in Monocytes

Figure 4 - Inhibition of
cytokine production
induced by ATRA and
epigenetic changes are
restored by a SUV39H2
inhibitor. (A-D) When
chaetocin, a SUV39H2
inhibitor, was added during
the first 24h incubation of
monocytes with ATRA and/
or BCG, the production of
4
IL-6 and TNFα upon LPS
restimulation at day 6 was
restored (A,B), as a result of
restored transcription (C,D).
(n=6, * p < 0.05, ** p < 0.01).
(E,F) Also the increase of
H3K9me3 induced by ATRA
was restored by incubation
with chaetocin in both the
normal and BCG-trained
macrophages (n=3). See
Figure S4 for H3K9me3
assessed using additional
TNFA primers.

The epigenetic reprogramming induced by ATRA that leads to a decreased

cytokine production as shown in the present study may account at least partially for
the contrasting effects on mortality reported in epidemiological studies of VAS (11).
BCG vaccination has opposite immunological effects to ATRA (15) and is associated
with strong reductions in all cause mortality (12, 13). Our observations support the
hypothesis that BCG vaccination and VAS interact (39). It is still speculative to directly
link our in-vitro ATRA experiments with in-vivo VAS, but it could be hypothesized that
VAS also leads to long-term downregulation of cytokine production, and -depending
on the situation- this could have harmful of beneficial effects. Thus, our findings
could help explain why VAS may increase overall mortality in some situations.

| 59
Chapter 4

Nevertheless, to truly assess the long-term effects of VAS on the innate immune
system a study should be performed with immunological endpoints, e.g. ex-vivo
monocytes stimulations and determination of epigenetic changes at different time
points before and after VAS.
In conclusion, short-term exposure of human monocytes to ATRA results in long-
term immune inhibition characterized by lower cytokine responses upon stimulation
with a second stimulus. These immunomodulatory effects of ATRA are induced by a
decreased H3K4me3 and an activation of the histone methyltransferase SUV39H2,
which increases H3K9me3 at the promoter sites of several cytokines, leading to
epigenetic reprogramming and inhibition of gene transcription.

REFERENCES
1. McKenna NJ. EMBO Retinoids 2011: Mechanisms,
biology and pathology of signaling by retinoic acid
and retinoic acid receptors. Nucl Recept Signal.
2012;10:e003.
2. Pino-Lagos K, Guo Y, Noelle RJ. Retinoic acid: a key
player in immunity. Biofactors. 2010;36(6):430-6.
3. Kim BH, Kang KS, Lee YS. Effect of retinoids on LPS-
induced COX-2 expression and COX-2 associated
PGE(2) release from mouse peritoneal macrophages
and TNF-alpha release from rat peripheral blood
mononuclear cells. Toxicol Lett. 2004;150(2):191-
201.
4. Stephensen CB. Vitamin A, infection, and immune
function. Annu Rev Nutr. 2001;21:167-92.
5. Mayo-Wilson E, Imdad A, Herzer K, Yakoob MY,
Bhutta ZA. Vitamin A supplements for preventing
mortality, illness, and blindness in children aged
under 5: systematic review and meta-analysis. Bmj.
2011;343:d5094.
6. Haider BA, Bhutta ZA. Neonatal vitamin A
supplementation: time to move on. Lancet. 2014.
7. Benn CS, Diness BR, Roth A, Nante E, Fisker AB,
Lisse IM, et al. Effect of 50,000 IU vitamin A given
with BCG vaccine on mortality in infants in Guinea-
Bissau: randomised placebo controlled trial. BMJ.
2008;336(7658):1416-20.
8. Benn CS, Fisker AB, Napirna BM, Roth A, Diness
BR, Lausch KR, et al. Vitamin A supplementation and
BCG vaccination at birth in low birthweight neonates:
two by two factorial randomised controlled trial. BMJ.
2010;340:c1101.
9. Benn CS, Rodrigues A, Yazdanbakhsh M, Fisker
AB, Ravn H, Whittle H, et al. The effect of high-dose
vitamin A supplementation administered with BCG
vaccine at birth may be modified by subsequent DTP
vaccination. Vaccine. 2009;27(21):2891-8.
10. Benn CS, Aaby P, Nielsen J, Binka FN, Ross DA.
Does vitamin A supplementation interact with
routine vaccinations? An analysis of the Ghana
Vitamin A Supplementation Trial. Am J Clin Nutr.
2009;90(3):629-39.
11. Benn CS. Combining vitamin A and vaccines:
convenience or conflict? Dan Med J.
2012;59(1):B4378.
12. Aaby P, Roth A, Ravn H, Napirna BM, Rodrigues A,
Lisse IM, et al. Randomized trial of BCG vaccination
at birth to low-birth-weight children: beneficial
nonspecific effects in the neonatal period? J Infect
Dis. 2011;204(2):245-52.
13. Biering-Sorensen S, Aaby P, Napirna BM, Roth A,
Ravn H, Rodrigues A, et al. Small randomized trial
among low-birth-weight children receiving bacillus
Calmette-Guerin vaccination at first health center
contact. Pediatr Infect Dis J. 2012;31(3):306-8.
14. Kleinnijenhuis J, Quintin J, Preijers F, Benn CS,
Joosten LAB, Jacobs C, et al. Long-lasting effects
of BCG vaccination on both heterologous Th1/Th17
responses and innate trained immunity. J Innate
Immun. 2014;6(2):152-8.
15. Kleinnijenhuis J, Quintin J, Preijers F, Joosten LA,
Ifrim DC, Saeed S, et al. Bacille Calmette-Guerin
induces NOD2-dependent nonspecific protection
from reinfection via epigenetic reprogramming
of monocytes. Proc Natl Acad Sci U S A.
2012;109(43):17537-42.
16. Kolseth IB, Forland DT, Risoe PK, Flood-Kjeldsen
S, Agren J, Reseland JE, et al. Human monocyte
responses to lipopolysaccharide and 9-cis retinoic
acid after laparoscopic surgery for colon cancer.
Scand J Clin Lab Invest. 2012;72(8):593-601.
17. Kolseth IB, Agren J, Sundvold-Gjerstad V,
Lyngstadaas SP, Wang JE, Dahle MK. 9-cis retinoic
acid inhibits inflammatory responses of adherent
monocytes and increases their ability to induce
classical monocyte migration. J Innate Immun.
2012;4(2):176-86.
18. Tsai YC, Chang HW, Chang TT, Lee MS, Chu YT,
Hung CH. Effects of all-trans retinoic acid on Th1- and
Th2-related chemokines production in monocytes.
Inflammation. 2008;31(6):428-33.
19. Austenaa LM, Carlsen H, Hollung K, Blomhoff HK,
Blomhoff R. Retinoic acid dampens LPS-induced NF-
kappaB activity: results from human monoblasts and
in vivo imaging of NF-kappaB reporter mice. J Nutr
Biochem. 2009;20(9):726-34.
20. Liu PT, Krutzik SR, Kim J, Modlin RL. Cutting edge: all-
trans retinoic acid down-regulates TLR2 expression
and function. J Immunol. 2005;174(5):2467-70.
21. Ko J, Yun CY, Lee JS, Kim JH, Kim IS. p38 MAPK
and ERK activation by 9-cis-retinoic acid induces
chemokine receptors CCR1 and CCR2 expression
in human monocytic THP-1 cells. Exp Mol Med.
2007;39(2):129-38.
22. Wada Y, Hisamatsu T, Kamada N, Okamoto S, Hibi
T. Retinoic acid contributes to the induction of IL-12-
hypoproducing dendritic cells. Inflammatory bowel
diseases. 2009;15(10):1548-56.
23. Jin CJ, Hong CY, Takei M, Chung SY, Park JS,
Pham TN, et al. All-trans retinoic acid inhibits the
differentiation, maturation, and function of human
monocyte-derived dendritic cells. Leuk Res.
2010;34(4):513-20.
24. Quintin J, Saeed S, Martens JH, Giamarellos-
Bourboulis EJ, Ifrim DC, Logie C, et al. Candida
albicans infection affords protection against
reinfection via functional reprogramming of
monocytes. Cell Host Microbe. 2012;12(2):223-32.
25. Bekkering S, Quintin J, Joosten LA, van der Meer
JW, Netea MG, Riksen NP. Oxidized low-density
lipoprotein induces long-term proinflammatory
cytokine production and foam cell formation
via epigenetic reprogramming of monocytes.
Arteriosclerosis, thrombosis, and vascular biology.
2014;34(8):1731-8.
26. Gudas LJ. Retinoids induce stem cell differentiation
via epigenetic changes. Seminars in cell &
developmental biology. 2013;24(10-12):701-5.
27. Kashyap V, Laursen KB, Brenet F, Viale AJ,
Scandura JM, Gudas LJ. RARgamma is essential
for retinoic acid induced chromatin remodeling and
transcriptional activation in embryonic stem cells. J
Cell Sci. 2013;126(Pt 4):999-1008.

60 |
 ATRA induces Epigenetic Changes in Monocytes
28. Kashyap V, Gudas LJ, Brenet F, Funk P, Viale A,
Scandura JM. Epigenomic reorganization of the
clustered Hox genes in embryonic stem cells induced
by retinoic acid. J Biol Chem. 2011;286(5):3250-60.
29. Li B, Carey M, Workman JL. The role of chromatin
during transcription. Cell. 2007;128(4):707-19.
30. Fodor BD, Shukeir N, Reuter G, Jenuwein T.
Mammalian Su(var) genes in chromatin control. Annu
Rev Cell Dev Biol. 2010;26:471-501.
31. Mateescu B, Bourachot B, Rachez C, Ogryzko V,
Muchardt C. Regulation of an inducible promoter
by an HP1beta-HP1gamma switch. EMBO Rep.
2008;9(3):267-72.
32. Fazi F, Travaglini L, Carotti D, Palitti F, Diverio
D, Alcalay M, et al. Retinoic acid targets DNA-
methyltransferases and histone deacetylases
during APL blast differentiation in vitro and in vivo.
Oncogene. 2005;24(11):1820-30.
33. Stefanska B, Rudnicka K, Bednarek A, Fabianowska-
Majewska K. Hypomethylation and induction of
retinoic acid receptor beta 2 by concurrent action
of adenosine analogues and natural compounds in
breast cancer cells. Eur J Pharmacol. 2010;638(1-
3):47-53.
34. Cheong HS, Lee HC, Park BL, Kim H, Jang MJ, Han
YM, et al. Epigenetic modification of retinoic acid-
treated human embryonic stem cells. BMB reports.
2010;43(12):830-5.
35. Hediger F, Gasser SM. Heterochromatin protein 1:
don’t judge the book by its cover! Current opinion in
genetics & development. 2006;16(2):143-50.
36. Sdek P, Oyama K, Angelis E, Chan SS, Schenke-
Layland K, MacLellan WR. Epigenetic regulation
of myogenic gene expression by heterochromatin
protein 1 alpha. PloS one. 2013;8(3):e58319.
37. Wiencke JK, Zheng S, Morrison Z, Yeh RF.
Differentially expressed genes are marked by histone
3 lysine 9 trimethylation in human cancer cells.
Oncogene. 2008;27(17):2412-21.
38. Eissenberg JC, Shilatifard A. Leaving a mark: the
many footprints of the elongating RNA polymerase
II. Current opinion in genetics & development.
4
2006;16(2):184-90.
39. Benn CS, Bale C, Sommerfelt H, Friis H, Aaby
P. Hypothesis: Vitamin A supplementation and
childhood mortality: amplification of the non-specific
effects of vaccines? Int J Epidemiol. 2003;32(5):822-
8.
Figure S1 - Lower
concentrations of ATRA do
not induce apoptosis.
Monocytes were incubated for
24h with different concentrations
of ATRA or EtOH as a solvent
control. After 24h incubation
LDH was measured by a
cytotox 96 cytotoxicity assay in
the supernatant following the
instructions of the manufacturer
(Promega, WI, USA). At
different time points cells were
harvested, stained for Annexin
V-FITC and PI (Biovision, CA,
USA) and measured on a
flowcytometer (Coulter Cytomics
FC500, Beckman Coulter) to
determine apoptosis. Depicted
is the percentage of Annexin V
positive or double positive cells.
There was no direct cell toxicity
as shown by non-increased LDH
levels. And in the lower ATRA
concentrations no delayed
apoptosis was seen. Therefore,
for the 7-day experiments a
dose of 1nM was used.
| 61
Chapter 4

Figure S2 - ATRA does not cause a predominant M1,

M2 or DC phenotype. Monocytes were incubated for 24h
with 1nmol/L of ATRA. At day 6 cells were stored in TRIzol
and mRNA isolation was performed. qPCR was performed
on the reverse transcribed cDNA. None of the M1, M2, or
DC markers was significantly up- or downregulated. iNOS
transcription, as a marker for M1 differentiation, was too low
in both the RPMI and ATRA primed cells and is therefore not
depicted in the figure. (n=6).

Figure S3 - Epigenetic
time course. Monocytes
were incubated for
24h in the presence or
absence of 1nM ATRA.
At different time points
(also before incubated
with ATRA or RPMI,
marked by 0) cells
were harvested and
DNA was isolated to
determine H3K9me3
at the promoters of IL6
and TNFA. (n=4, * p <
0.05). H3K9me3 was
not upregulated during
the first 3 days. At day 6
ATRA primed cells had a
higher H3K9me3 at the
promoter sites of IL6 and
TNFA. The upregulation
of histone methylation
remained present at day
10.

62 |
 ATRA induces Epigenetic Changes in Monocytes

Figure S4 - Additional primers for assessing H3K9me3 for the TNFA promoter (extra
to Figure 4E,F). Additional parts of the TNFA promoter H3K9me3 were assessed, and this
induction could also be inhibited by chaetocin. This accounts for both the normal and BCG-
trained monocytes. (n=3)

| 63
Chapter 4

qPCR experiments

Gene 5’-3’ sequence

Forward Reverse

HPRT CCTGGCGTCGTGATTAGTGAT AGACGTTCAGTCCTGTCCATAA

IL6 AACCTGAACCTTCCAAAGATGG TCTGGCTTGTTCCTCACTACT

TNFA CCTCTCTCTAATCAGCCCTCTG GAGGACCTGGGAGTAGATGAG

IL8 ACTGAGAGTGATTGAGAGTGGAC AACCCTCTGCACCCAGTTTTC

IL18 TGTCGCAGGAATAAAGATGGCT CCTTGGTCAATGAAGAGAACTTGGT

IL10 CAACCTGCCTAACATGCTTCG TCATCTCAGACAAGGCTTGGC

IL1RA GAAAATCCAGCAAGATGCAA GTCCTTGCAAGTATCCAGCA

SUV39H1 CCTGCCCTCGGTATCTCTAAG ATATCCACGCCATTTCACCAG

SUV39H2 TCTATGACAACAAGGGAATCACG GAGACACATTGCCGTATCGAG

SETDB1 AGGAACTTCGGCATTTCATCG TGTCCCGGTATTGTAGTCCCA

SETDB2 TGCTCTGGTGCTTGTCTGATG TGCATGTCGTCTTTGGAAGTG

EHMT1 GCTGTGTGAAAACCGAGCTG TCCGCTATCCGAGTTAGTGTG

EHMT2 CTGTCAGAGGAGTTAGGTTCTGC CTTGCTGTCGGAGTCCACG

EZH2 GGACCACAGTGTTACCAGCAT GTGGGGTCTTTATCCGCTCAG

TLR2 GAATCCTCCAATCAGGCTTCTCT GCCCTGAGGGAATGGAGTTTA

TLR4 GGCATGCCTGTGCTGAGTT CTGCTACAACAGATACTACAAGCACACT

iNOS TTCAGTATCACAACCTCAGCAAG TGGACCTGCAAGTTAAAATCCC

ARG1 GATTCCCGATGTGCCAGGATT GCCAATTCCTAGTCTGTCCACTT

CD163 TGAAGACTCTGGATCTGCTGA GAACTGGTGACAAAACAGGCA

CD83 AAGGGGCAAAATGGTTCTTTCG GCACCTGTATGTCCCCGAG

HLA-DRB1 CGGGGTTGGTGAGAGCTTC AACCACCTGACTTCAATGCTG

DC-SIGN TCAAGCAGTATTGGAACAGAGGA CAGGAGGCTGCGGACTTTTT

ChIP experiments

Gene 5’-3’ sequence

(promoter) Forward Reverse

GAPDH CACCGTCAAGGCTGAGAACG ATACCCAAGGGAGCCACACC

ZNF274_3UTR AAGCACTTTGACAACCGTGA GGAGGAATTTTGTGGAGCAA

IL6 TCGTGCATGACTTCAGCTTT GCGCTAAGAAGCAGAACCAC

TNFA1 AGAGGACCAGCTAAGAGGGA AGCTTGTCAGGGGATGTGG

TNFA2 CAGGCAGGTTCTCTTCCTCT GCTTTCAGTGCTCATGGTGT

TNFA3 GTGCTTGTTCCTCAGCCTCT ATCACTCCAAAGTGCAGCAG

TNFA4 TGTCTGGCACACAGAAGACA CCCTGAGGTGTCTGGTTTTC

64 |
 ATRA induces Epigenetic Changes in Monocytes

TNFA5 AGCCAGCTGTTCCTCCTTTA TTAGAGAGAGGTCCCTGGGG

IL8 TGGCAGCCTTCCTGATTTCT ACATAGGAAAACGCTGTAGGTCA

IL18 ATGCACTGGGAGACAATTCC CTCCCTCCACCTTCTTCCTC

IL10 GGGACAGCTGAAGAGGTGGA CCTCAAAGTTCCCAAGGAGC

IL1RA AGCATATGCAAAAGCCACGG ATGTGCAGAGCCTGTCTTGG

Table S1. Primers

4

| 65
 Chapter 5

Bacillus Calmette-Guérin-induced trained

immunity reduces yellow fever vaccine
viraemia

Rob J.W. Arts, Boris Novakovic, Leo A.B. Joosten, Chantal B.E.M. Reusken,
Marion P. Koopmans, Hendrik G. Stunnenberg, Reinout van Crevel, Mihai G.
Netea.

Submitted
Chapter 5

ABSTRACT

Bacillus Calmette-Guérin, the vaccine against tuberculosis has been shown to have
non-specific beneficial effects against other infections than tuberculosis. We have
previously shown that the BCG is able to induce trained immunity by epigenetically
reprograming human monocytes, which results in higher cytokine responses to non-
mycobacterial stimuli after vaccination. However, no earlier studies have demonstrated
a direct effect of BCG on a human infection in a controlled setting. The present
study demonstrates that BCG vaccination reduces yellow fever vaccine viraemia
after vaccination. Reduction of viraemia is highly correlated with the upregulation
of IL-1β production to non-mycobacterial pathogens after BCG vaccination, but not
to the specific IFNγ response to stimulation with the virus. Furthermore, epigenetic
analysis of monocytes reveals that also in vivo broad epigenetic changes are induced
in monocytes, suggesting that the genome-wide changes lead to epigenetic and
functional reprogramming responsible for the nonspecific beneficial effects of BCG.

68 |
 BCG reduces Yellow Fever Viremia

Bacillus Calmette-Guérin (BCG) is a live-attenuated vaccine that protects against

miliary tuberculosis, tuberculous meningitis, and leprosy, and has now been used for
almost a century (1, 2). Interestingly enough, the BCG vaccine also has non-specific
protective effects. Several observational studies have shown that vaccination at
birth results in reduced child mortality (3-6). In two later randomized controlled trials,
these beneficial effects of BCG could be reproduced, and the reduced mortality
appeared to be mainly due to protection against neonatal sepsis and respiratory
infections (7-9). Also in several mouse infection models (summarized in (10))
prior BCG vaccination has shown to protect from mortality. Lastly, BCG is used as
immunotherapy in cancer, as BCG installations in bladder cancer induce immune 5
stimulating effects that slow tumor progression (11).
The exact mechanism on how BCG exerts these non-specific protective effects
remains partially unknown. Two types of mechanisms have been suggested to
mediate these effects. Firstly, by inducing CD4 and CD8 memory cells that can be
activated in an antigen-independent way, a process called heterologous immunity is
triggered by BCG (12-14). Secondly, BCG also induces epigenetic reprogramming of
human monocytes, which results in a more pro-inflammatory phenotype, a process
called trained (innate) immunity (15, 16).
Despite these data, no earlier studies have demonstrated a direct effect of BCG
on a human infection in a controlled setting. In this manuscript we use vaccination
with the live-attenuated yellow fever vaccine as a model of viral infection in humans.
Using this model, we investigate the impact of BCG vaccination on the virologic and
immunological parameters after yellow fever vaccine administration, in a first study
assessing the impact of BCG in a controlled human infection.

METHODS
Subjects and BCG and yellow fever vaccine vaccination - Healthy men (age
range 19-37 years) were recruited to participate in this trial. 30 healthy individuals
were included in between February and November of 2015. Volunteers were at
baseline randomly assigned to receiving either BCG (SSI, Denmark) or placebo (the
diluent used to dissolve BCG in) and vaccinated in a double-blind fashion. A month
later all volunteers received the yellow fever vaccine (Stamaril, Sanofi Pasteur).
Blood was drawn before BCG/placebo and yellow fever vaccination and 3, 5, 6, 14,
and 90 days after yellow fever vaccination. One of the volunteers in the BCG group
already had a protective yellow fever titer before yellow fever vaccination, so he
was excluded from all yellow fever analysis data. The study was approved by the
Arnhem-Nijmegen Medical Ethical Committee, NL50160.092.24.
PBMC and monocyte isolation - Isolation and stimulation was performed as
described before (15, 17). Briefly, PBMCs were isolated by density centrifugation

| 69
Chapter 5

of Ficoll-Paque (GE healthcare, UK). Cells were washed twice in PBS and
resuspended in RPMI culture medium (Roswell Park Memorial Institute medium;
Invitrogen, CA, USA) supplemented with 50μg/ml gentamicin, 2mM Glutamax
(Gibco), and 1mM pyruvate (Gibco) and diluted to a concentration of 5x10^6/ml.
100µl/well was added to 96-well plates and cells were incubated for 24h or 7d with
RPMI, sonicated Mycobacterium tuberculosis H37Rv (5µg/ml), heat-killed Candida
albicans (1x10^6/ml, strain UC820) or Staphylococcus aureus (1x10^6/ml, clinical
isolate). Supernatants were collected after 24h or 7d and stored at -20oC.
Monocyte isolation was performed after the PBMC isolation step, by MACS
isolation with CD14 positive magnetic beads (MACS Miltenyi) according to the protocol
of the manufacturer. 1x10^6 monocytes were stored in Trizol (Life technologies) and
all remaining monocytes were fixed in 1% methanol-free formaldehyde and stored in
PBS before sonication, after which chromatin was stored at -80oC.
Cytokine Measurements - Cytokine measurements were performed in the
supernatants using commercial ELISA kits from R&D Systems (TNFα, IL-1β, IL-
17 and IL-22; Minneapolis, MN, USA) or Sanquin (IL-6, IFN-γ; Amsterdam, The
Netherlands). Circulating cytokines after yellow fever vaccination were determined
in plasma. Ethylenediaminetetraacetic acid (EDTA) anticoagulated blood was
centrifuged at 2,000xg at 4°C for 10min immediately after withdrawal, and plasma
was stored at -20°C until analysis. Concentrations of TNFα, IL-6, IL-8, IL-10, IL-1β,
IL-1 receptor antagonist (IL-1RA), IFNα and IFNγ were measured in plasma using
a Luminex assay according to the manufacturer’s instructions (Milliplex; Millpore,
Billerica, MA, USA).
Chromatin immunoprecipitation (ChIP) - Purified monocytes before and after BCG
vaccination were fixed with 1% formaldehyde (Sigma-Aldrich) at a concentration
of approximately 15x10^6 cells/ml. Fixed cell preparations were sonicated using
a Diagenode Bioruptor Pico sonicator using 5 cycles of 30s on, 30s off. One µg
of chromatin (approx. 0.5-1 x 10^6 cells) was incubated with dilution buffer, 12µl
protease inhibitor cocktail and 1µg of H3K27ac antibody or H3K27ac (Diagenode)
to a final volume of 300µl, and incubated overnight at 4oC with rotation. Protein A/G
magnetic beads were washed in dilution buffer with 0.15% SDS and 0.1% BSA, added
to the chromatin/antibody mix and rotated for 60min at 4oC. Beads were washed with
400µl buffer for 5min at 4oC with five rounds of washes. After washing, chromatin
was eluted using 200µl elution buffer for 20min. Supernatant was collected, 8µl 5M
NaCl, 3µl proteinase K were added and samples were incubated for 4h at 65oC.
Finally, samples were purified using Qiagen Qiaquick MinElute PCR purification Kit
and eluted in 20µl elution buffer. Further prepartion of the samples and the data
analysis was performed as described in Chapter 9.
Statistical analysis - Differences were analyzed using Wilcoxon signed-rank test or

70 |
 BCG reduces Yellow Fever Viremia

    

 



        

 



 
 

 
 

 
 

 

 

 



 

5


  
























   
    


 
 

 

 

 
 

 


  

























  

    




 
   
 

 
 



 



 

 
  



























Figure 1 - BCG induces trained

 immunity in vivo. (A) Healthy
volunteers randomly received
BCG or placebo vaccination.
Before vaccination and 1
month later, blood was drawn
and PBMCs were isolated
and restimulated ex vivo. (B)
Fold increases (compared to
baseline) of IL-1β, TNFα, and
IL-6 production to LPS, M.
tuberculosis (MTB), and C.
albicans are shown. (n=15 per
group, * p <0.05 BCG vs placebo,
# p < 0.01 ## p < 0.01 baseline vs
1 month, Mann-Whitney U test).
(C) Unsupervised clustering
analysis of cytokines measured
(IL-1β, TNFα, IL-6, and IL10 after
24h and IL-17, IL-22, IFNγ after 7
days ex vivo incubation with LPS,
MTB, S. aureus, or C. albicans.

| 71
Chapter 5

Mann-Whitney U test where applicable. All calculations were performed in Graphpad

prism 5 (CA, USA). p < 0.05 was considered statistically significant. Data are shown
as means ± SEM.

RESULTS
BCG induces trained immunity in vivo
We have shown before that BCG is able to increase ex-vivo cytokine responses to
non-related pathogens of PBMCs 2 weeks and 3 months after vaccination (15, 17).
We assessed the BCG effects on cytokine production a month after vaccination, with
inclusion of a placebo group to account for potential timing-related effects. We were
again able to show significant increases in cytokine production 1 month after BCG
vaccination, which for most stimuli and cytokines were significantly higher than the
placebo vaccinated volunteers (Figure 1A,B, S1). However, the induction of trained
immunity was highly variable between individuals. To assess whether the induction
of production of different cytokines upon different stimuli was correlated (e.g. is
a higher induction of IL-6 to LPS correlated with a higher IL-1β production upon
MTB stimulation), we performed an unsupervised cluster analysis. When the fold
increases of cytokine production 1 month after BCG vaccination were compared,
a cluster of innate cytokines and a second cluster of T-helper 1/17 lymphocyte
cytokines becomes apparent. Within the cluster of innate cytokines, the induction of
IL-1β and IL-6 production is highly related (Figure 1C).

BCG vaccination lowers yellow fever viraemia

Yellow fever vaccine viraemia was determined by RT-PCR on day three, five, and
seven post-vaccination. Viraemia was highest at day five, as previously reported by
others (18) (Figure 2A,B). When viraemia was compared between the volunteers
that received BCG or placebo, the group vaccinated with BCG showed a significantly
lower amount of circulation virus compared to the group that received placebo
(Figure 2B). This was also reflected by the amount of circulating cytokines in plasma,
which were significantly higher in the volunteers that received placebo (Figure 2C).
Importantly, when yellow fever neutralizing antibodies were measured at three
months post vaccination, no differences were found between the two groups (Figure
2D), showing that BCG vaccination did not have deleterious effects on yellow fever
serology, despite the diminished viraemia. In addition, BCG vaccination did not
change the specific cellular response to YFV as measured by IFNγ production by
PBMCs (Figure S2).
To determine whether the induction of trained immunity, as measured by induction
of ex-vivo cytokine responses, was correlated with the amount of circulating yellow
fever virus, Spearman correlations between viraemia and all measured cytokines

72 |
 BCG reduces Yellow Fever Viremia

Figure 2 - BCG vaccination lowers yellow fever vaccine viraemia. (A) Post-vaccination viraemia was
determined by PCR three, five and seven days after yellow fever vaccine. (B) Relative viraemia amounts
by setting CT 40 as reference 1 are day 3, 5, and 7 post-vaccination. (*<0.05, Mann-Whitney U test). (C)
Circulating cytokines were determined five days post vaccination in plasma. IL-1β and IL-10 were below
detection limit in almost all samples. (*<0.05, **<0.01, Mann-Whitney U test). (D) Yellow fever neutralizing
antibodies were determined 90 days post yellow fever vaccination.

were calculated. The fold-increase in TNFα and IL-6 production showed a weak
correlation with viraemia. In contrast, the potentiation of IL-1β production capacity
after BCG vaccination was strongly correlated with a lower viraemia (Figure 3A).
Among the other cytokines, the induction of IL-10 upon stimulation with C. albicans
also displayed a negative correlation with viraemia (Figure 3A). Interestingly,
the induction of the specific cellular responses to YFV by BCG as measured by
IFNγ production by PBMCs did not correlate with the viraemia (Figure 3A). When
comparable correlation analysis were performed for the induction of yellow fever
neutralizing antibody titers, no clear pattern was seen (Figure 3B).

| 73
Chapter 5

        

    
  

  
  

  
  
 




 
 

   


  

  
            
    
          
          

         

 Figure 3 – Induction of IL-1β negatively correlates with


yellow fever viraemia. (A) Fold induction of cytokine


production 1 month after BCG vaccination (as shown in
 
 
 

 Figure 1B) are compared with yellow fever viraemia at



 day five post vaccination (as shown in Figure 3B). The
Spearman correlation coefficients and their p values are

     shown. Panel (ii) and (iii) show an example of fold increase

     (a month after BCG vaccination) of IL-1β by C. albicans
   
stimulation correlated with yellow fever viraemia (CT-
values) and of IFNγ by YFV stimulation. (C) Fold induction of cytokine production 1 month after BCG
vaccination (as shown in Figure 1B) are compared with yellow fever titer 90 days post vaccination (as
shown in Figure 3D). The spearman correlation efficients and their p values are shown.

BCG vaccination results in epigenetically different monocytes

Monocytes from seven donors were analyzed by ChIP sequencing to determine the
distribution of H3K27ac at ‘baseline’ (before BCG vaccination, day -28) and ‘BCG
1 month’ (1 month after BCG vaccination, day 0), in order to examine whether also
in vivo in humans BCG is able to induce a different epigenetic phenotype. In order
to compare whole genome H3K27ac profiles of the different donors at the two time
points, correlation plots based on sequencing reads were performed (Figure 4A).
Based on all H3K27ac peaks, a separation of the samples at baseline and after
BCG vaccination is seen. Correlation between the samples becomes only clearer
when specifically analyzing peaks that are highly induced in at least one donor, or
specifically analyzing differences between peaks before and after BCG vaccination
(Figure 4A, S3A). Both displaying the 646 peaks showing differences between
baseline and BCG in a heat map and a principal component analysis (PCA) figure
show clear differences between the two time points (Figure 4B,C). When specifically
analyzing peaks related to promoters, a comparable effect is seen (Figure S3B,C).
Finally, when the genes near the 646 differential peaks are analyzed by pathway
analysis, several important signaling and inflammatory related pathways are
significantly differently regulated (Figure 4D, Table S1,2). Interestingly, genes as
AKT1, MAPKs and PIK3 related genes that have been shown to be major regulators
in β-glucan-induced trained immunity appear to be also important in BCG-induced
trained immunity (19, 20).

74 |
 BCG reduces Yellow Fever Viremia

A Similarity between samples - spearman correlation

At least 1 BCG sample BCG v baseline
all H3K27ac > 3SD from baseline mean (p<0.05, FC>1.5)

correlation
Baseline (-28d) BCG 1 month (0d)
0.5 1
5
B H3K27ac (p <0.05 FC>1.5) C
646 peaks (456 up, 190 down) H3K27ac (p <0.05)
3 time
10
baseline

PC2 (9.8%)
z-score

1 month
0
0
−10

−3 −20

−40 −20 0 20
PC1 (48.3%)
reads / Peak

H3K27ac (p <0.05 FC>1.5)

10
PC3 (5.8%)

−5

−10
−20 −10 0 10 20
PC1 (46.9%)

D Pathway name (PANTHER) P-Value FDR Q-Val Enrichment Region Hits Inflammatory Fc epsilon RI
B cell activation 4.42E-10 6.72E-08 9.685 14 response signaling
Apoptosis signaling pathway 7.77E-07 5.90E-05 6.2763 12 AKT1
Ras Pathway 4.19E-06 2.12E-04 5.8697 11 pathway
CCR1
Axon guidance mediated by semaphorins 9.74E-06 3.70E-04 9.8 7 AKT1
CXCR2
Inflammation mediated by chemokine and cytokine signaling 5.34E-05 1.62E-03 3.3967 15
GPR68 INPP5D
EGF receptor signaling pathway 5.73E-05 1.45E-03 3.7859 13 LCP2
TNFAIP6
FGF signaling pathway 7.85E-05 1.70E-03 3.6672 13
TNFRSF1B MAPK11
VEGF signaling pathway 1.21E-04 2.30E-03 4.902 9
TNIP1 MAPK14
AOAH PIK3CD
Pathway name (MSigDB) P-Value FDR Q-Val Enrichment Region Hits
AGER
Fc epsilon RI signaling pathway 8.19E-11 1.08E-07 8.9254 16 PRKCB
Genes involved in Immune System 8.72E-10 5.75E-07 2.661 49 APOL3
PRKCD
Leukocyte transendothelial migration 1.01E-08 2.66E-06 5.8915 17 HDAC4
LYZ RAC1
Chemokine signaling pathway 3.33E-08 7.33E-06 4.8115 19
Fc gamma R-mediated phagocytosis 4.67E-08 7.70E-06 6.1095 15 OLR1 RAC2
VEGF signaling pathway 1.17E-07 1.40E-05 7.5264 12 RPS6KA4 VAV3

Figure 4 – Genome-wide H3K27ac analysis of BCG exposed monocytes. Monocytes from seven
donors were analyzed by ChIPseq to determine the distribution of H3K27ac at ‘baseline’ (before BCG
vaccination, -28d) and ‘BCG 1 month’ (1 month after BCG vaccination, 0d). (A) Correlation plot based on
sequencing reads at (i) all H3K27ac peaks, (ii) peaks dynamic in at least one donor after BCG exposure,
and (iii) peaks dynamic between the baseline and BCG 1 month groups (p <0.05, FC >1.5). (B) Heat map
of 646 peaks showing differences between baseline and BCG exposed groups. (C) Principal component
analysis of the same peaks. (D) Top pathways associated with genes near the 646 differential peaks and
names of genes associated with inflammation and cytokine signaling.

| 75
Chapter 5

DISCUSSION
In this study we demonstrate for the first time that BCG has beneficial non-specific
effects in a controlled model of human infection. In addition, we described the
effects of BCG vaccination on cytokine production by PBMCs to related and non-
related stimuli, and in a subset of individuals we demonstrate broad changes in the
epigenetic programming of monocytes.
We have reported previously that the BCG vaccine is able to induce non-specific
effects by showing increased cytokine production of PBMCs to non-specific stimuli
after BCG vaccination (15, 17). We have now reproduced these effects, although we
also show an important inter-individual variation in the induction of trained immunity.
It was previously suggested that development of a scar after BCG vaccination
could be used as a marker for non-specific effects and childhood survival (3, 21).
However, all BCG-vaccinated volunteers developed a scar with a comparable size
(0.5-0.7cm), and thus it is unlikely that scar development is a strong correlate of
protection. A single nucleotide polymorphism in the autophagy gene ATG2b was
shown to reduce the ability to induce trained immunity (22). However, screening the
15 BCG vaccinated volunteers revealed only one volunteer with a mutant genotype,
and thus is this also insufficient to explain the lack of response in some volunteers.
Although responders and non-responders could be identified, the current knowledge
on genetic factors influencing the induction of trained immunity by BCG is insufficient
to explain the distribution we observed here. To answer this question a cohort study
with larger numbers of volunteers being vaccinated with BCG is warranted to assess
the effect of other genetic polymorphisms on the induction of trained immunity by
BCG.
Apart from just the change in cytokine production, we have now also shown
that BCG vaccination can reduce yellow fever viraemia. Beneficial effects of BCG
vaccination on resistance to viral infections have been reported in observational
studies. In two randomized controlled trials there was a reduction in mortality from
lower respiratory infection in children (often of viral origin) (7, 8) and in a case control
study in children beneficial effects on the incidence of respiratory syncytial virus
were found (23). Also in an Indonesian trial, repeated BCG vaccination in elderly
subjects (60-75 years) reduced upper respiratory tract infections (24). Interestingly,
when determining whether induction of trained immunity in our study measured by
cytokine production upon stimulation with non-related pathogens is correlated with
the protective effects of BCG vaccination on yellow fever viraemia, it appears the
induction of especially the fold increase of IL-1β production was a good correlate of
protection. In contrast, no such effect was observed for the specific cellular function
as measured by IFNγ production of PBMCs after YFV stimulation. Because only
circulating monocytes were thoroughly assessed in this study, effects of other innate

76 |
 BCG reduces Yellow Fever Viremia

immune cells (e.g. NK-cells) on lowering yellow fever viraemia after BCG vaccination
cannot be excluded.
When assessing pathways related to the changed peaks after BCG vaccination,
several important signaling and cytokine/chemokine pathways become apparent.
This shows that also in vivo BCG is able to induce a different cellular phenotype
of monocyte by changing the epigenetic landscape. When comparing the current
epigenetic profiles to the epigenetic analysis that we have performed before on
in-vitro β-glucan-trained macrophages, noticeable similarities are found. In the
β-glucan-trained macrophages acluster of genes (M5) was defined as being most
significantly regulated: immune response, cytokine and chemokine activity were the 5
major regulated pathways in this cluster (19). Comparable regulated pathways were
now also found in monocytes from in-vivo-trained healthy volunteers. Furthermore,
we have shown before that the PI3K/Akt pathway is important in the induction of
trained immunity by β-glucan and also by BCG in vitro (20, 25): this pathway is now
shown to be epigenetically regulated in-vivo by BCG vaccination. Hence, the clear
changes induced in in-vitro induced trained immunity can also be observed in the
in-vivo vaccination model.
In conclusion, we show that the BCG vaccine is able to induce a pro-inflammatory
phenotype in circulating monocytes, and is able to reduce the amount of circulating
yellow fever virus after administration of the yellow fever vaccine. The demonstration
that BCG vaccination is indeed able to improve the outcome of infection in humans
opens the gates for new treatment strategies using trained immunity in severe
infections.

REFERENCES
1. Zumla A, et al. Tuberculosis. N Engl J Med.
2013;368(8):745-55.
2. Colditz GA, et al. Efficacy of BCG vaccine in the
prevention of tuberculosis. Meta-analysis of the
published literature. JAMA 1994;271(9):698-702.
3. Roth A, et al. BCG vaccination scar associated with
better childhood survival in Guinea-Bissau. Int J
Epidemiol. 2005;34(3):540-7.
4. Kristensen I, Aaby P, Jensen H. Routine vaccinations
and child survival: follow up study in Guinea-Bissau,
West Africa. BMJ. 2000;321(7274):1435-8.
5. Moulton LH, et al. Evaluation of non-specific effects
of infant immunizations on early infant mortality in
a southern Indian population. Trop Med Int Health.
2005.10(10):947-55.
6. Hirve S, et al. Non-specific and sex-differential effects
of vaccinations on child survival in rural western
India. Vaccine. 2012;30(50):7300-8.
7. Aaby P, et al. Randomized trial of BCG vaccination
at birth to low-birth-weight children: beneficial
nonspecific effects in the neonatal period? J Infect
Dis. 2011;204(2):245-52.
8. Biering-Sorensen S, et al. Small randomized trial
among low-birth-weight children receiving bacillus
Calmette-Guerin vaccination at first health center
contact. Pediatr Infect Dis J. 2012;31(3):306-8.
9. Roth A, et al. Low Birth Weight Infants and Calmette-
Guerin Bacillus Vaccination at Birth: Community
Study from Guinea-Bissau. Pediatric Infectious
Disease Journal. 2004;23(6):544-550.
10. Blok BA, et al. Trained innate immunity as underlying
mechanism for the long-term, nonspecific effects of
vaccines. J Leukoc Biol. 2015;98(3):347-56.
11. Han RF, Pan JG. Can intravesical bacillus Calmette-
Guerin reduce recurrence in patients with superficial
bladder cancer? A meta-analysis of randomized
trials. Urology. 2006;67(6):1216-23.
12. Lertmemongkolchai G, et al. Bystander activation of
CD8+ T cells contributes to the rapid production of
IFN-gamma in response to bacterial pathogens. J
Immunol. 2001;166(2):1097-105.
13. Berg RE, Cordes CJ, Forman J. Contribution of
CD8+ T cells to innate immunity: IFN-gamma
secretion induced by IL-12 and IL-18. Eur J Immunol.
2002;32(10):2807-16.
14. Berg RE, et al. Memory CD8+ T cells provide innate
immune protection against Listeria monocytogenes
in the absence of cognate antigen. J Exp Med.
2003;198(10):1583-93.
15. Kleinnijenhuis J, et al. Bacille Calmette-Guerin
induces NOD2-dependent nonspecific protection
from reinfection via epigenetic reprogramming
of monocytes. Proc Natl Acad Sci U S A.
2012;109(43):17537-42.
16. Netea MG, et al. Trained immunity: A program of
innate immune memory in health and disease.
Science. 2016;352(6284):aaf1098.
17. Kleinnijenhuis J, et al. Long-lasting effects of
BCG vaccination on both heterologous Th1/Th17
responses and innate trained immunity. J Innate
Immun. 2014;6(2):152-8.
18. Edupuganti S, et al. A randomized, double-blind,

| 77
Chapter 5

controlled trial of the 17D yellow fever virus vaccine

given in combination with immune globulin or
placebo: comparative viremia and immunogenicity.
Am J Trop Med Hyg. 2013;88(1):172-7.
19. Saeed S, et al. Epigenetic programming of monocyte-
to-macrophage differentiation and trained innate
immunity. Science. 2014;345(6204):1251086.
20. Cheng SC, et al. mTOR- and HIF-1alpha-mediated
aerobic glycolysis as metabolic basis for trained
immunity. Science. 2014;345(6204):1250684.
21. Garly ML, et al. BCG scar and positive tuberculin
reaction associated with reduced child mortality in
West Africa. A non-specific beneficial effect of BCG?
Vaccine. 2003;21(21-22):2782-90.
22. Buffen K, et al. Autophagy controls BCG-induced
trained immunity and the response to intravesical
BCG therapy for bladder cancer. PLoS Pathog.
2014;10(10):e1004485.
23. Stensballe LG, et al. Acute lower respiratory tract
infections and respiratory syncytial virus in infants
in Guinea-Bissau: a beneficial effect of BCG
vaccination for girls community based case-control
study. Vaccine. 2005;23(10):1251-7.
24. Wardhana et al. The efficacy of Bacillus Calmette-
Guerin vaccinations for the prevention of acute upper
respiratory tract infection in the elderly. Acta Med
Indones. 2011;43(3):185-90.
25. Arts RJ, et al. Immunometabolic Pathways
in BCG-Induced Trained Immunity. Cell Rep.
2016;17(10):2562-2571.

Digital versions of Tables S1 and S2 can be obtained by sending a request to the

author.

Table S1 – >3SD Dynamic H3K27ac peaks in at least one donor after BCG exposure. Genes (and
related pathways) related to peaks that are at least 3 standard deviations dynamic in one of the volunteers
after BCG vaccination.

Table S2 – Dynamic H3K27ac peaks FC > 1.5, p < 0.05 after BCG exposure. Genes (and related
pathways) related to peaks with a fold change of at least 1,5 with p < 0.05 after BCG vaccination.

78 |
 BCG reduces Yellow Fever Viremia

Figure S1, related to Figure 1B - Healthy volunteers randomly received BCG or placebo vaccination.
Before vaccination and 1 month later blood was drawn and PBMCs were isolated and ex vivo restimulated.
Fold increases (compared to baseline) of IL-10, IFNγ, IL-17, IL-22 production to LPS or PHA, M.
tuberculosis (MTB), C. albicans, and S. aureus are shown. (n=15 per group, * p < 0.05 BCG vs placebo,
# p < 0.01 ## p < 0.01 baseline vs 1 month, Mann-Whitney U test).

| 79
Chapter 5

Figure S2, related to Figure 2,3 – IFNγ production of PBMCs upon stimulation with the yellow fever
vaccine (YFV). PBMCs were isolated at the mentioned days post yellow fever vaccination and ex vivo
stimulated for 7d with the YFV. Fold increases (compared to baseline) are displayed.

80 |
 BCG reduces Yellow Fever Viremia

A Pearson correlation

At least 1 BCG sample BCG v baseline

all H3K27ac > 3SD from baseline mean (p<0.05, FC>1.5)

correlation
5
Baseline BCG 1 month
0.5 1

B H3K27ac (p <0.05 FC>1.5)

C H3K27ac (p <0.05 FC>1.5)
At promoters only - 146 genes (related to H3K27ac Figure A)
reads/peak in each donor
Down in BCG exposed
100

3
RPS6
MIR3138_WDR1
DUSP7

80
MAFK
MIR3605_PHC2
MIR1976_RPS6KA1
GRAMD2_PKM
MIR6829_TNK2
CEBPG
KCNAB2
Reads/peak
UNC13D
BTK_RPL36A_RPL36A−HNRNPH2
CST7
KIAA0930
z-score

UBXN11
CXCR2
DNM2_MIR199A1

60
LOC101928445_RUFY1
DDR1
OGG1
OAS1

0
SNORA30_SRCAP
SSPO_ZNF467
ATG16L2
CD2BP2
CROCCP2
PLXND1
ANKRD13D
DGKZ
LILRA6_LILRB3

40
MMP14

IRF9
AOAH_AOAH−IT1
ATXN7L3_TMUB2
IRF9
LOC100506472_TAB1
LOC100653515_TIMP2
MIR6840_PILRB
SMARCD2
GLB1L_STK16
MGRN1_MIR6769A
MIR6513_PNKD_TMBIM1
ENO1_MIR6728
LOC284837

20
ZBTB47

−3
NADK
SNX20
ZNF607
FAM65B
PARD6G−AS1
RGS3
MIR6803_PPP6R1
SMAD3
C17orf62
CCDC12_NBEAL2
TTC19_ZSWIM7
CAPN3
CST3

0
HDAC4_MGC16025
MIR6813_OPRL1_RGS19
RPS6KA4
ARHGEF2_MIR6738
FCGRT
EEF1G_MIR3654
PRKAR2B
ALAD_C9orf43_POLE3
C10orf131
IKZF1
MEPCE_ZCWPW1
Peaks

C19orf71
GCNT2
SELENBP1
AGER_AGPAT1_MIR6833_RNF5_RNF5P1

Up in BCG exposed
TNIP1
MIR6751_SYVN1
AKT1
ARRDC1_C9orf37_EHMT1
B3GNT8_BCKDHA
PPARGC1B
LOC101929698_NOL4L

100
UHRF1
ATPAF1_TEX38
C12orf10
SIGLECL1
BICD1
FANCC
MAFG_SIRT7
MSRB1
PTK6
TACC3_TMEM129
UNC13D_WBP2
HDGF_MRPL24

TNFRSF1B
LILRA1
MIR4632_TNFRSF1B

80
NFIC
CCR1
CD101
L3MBTL1
NARS
NMNAT3
ADCY7_MIR6771
GNB5_LOC100129973
Reads/peak

GSTM4
MIR7109_SFI1
POGK
PRCC
ZNF737

60
APOL3
E2F2_LOC101928163
MT1E
TNPO2
ERGIC1
MCEMP1_RETN
ONECUT1
ITSN2
MS4A6A
TNFAIP6
OLR1_TMEM52B
CECR2
NR1D1
DMXL2

40
FGGY
GPR68
CLEC1A
FHAD1
RGS12
CASP2_TMEM139
CLCN3
DYX1C1_DYX1C1−CCPG1
LINC00114
LYZ
MORC3
OSM
ARG2

20
ADAP1
PRKAR1A_WIPI1
SP110
STAG1
LACTB
UBL4A
LINC00881
CDKN1A
FLJ25758
KCTD12
UBE2D1
WBP1L
PPARG

0
CRY2

Figure S3, related to Figure 4 – Genome-wide H3K27ac analysis of BCG exposed monocytes.
Monocytes from seven donors were analyzed by ChIPseq to determine the distribution of H3K27ac at
‘baseline’ (before BCG vaccination, -28d) and ‘BCG 1 month’ (1 month after BCG vaccination, 0d). (A)
Correlation plots showing the relationship between the different donors and exposures by Pearson,
based on sequencing reads at (i) all H3K27ac peaks, (ii) peaks dynamic in at least one donor after BCG
exposure, and (iii) peaks dynamic between the baseline and BCG 1 month groups (p <0.05, FC >1.5).
Based on all H3K27ac peaks, we see mixing of the baseline and BCG samples, which suggests little
global change in H3K27ac in response to BCG. However, based on significantly different peaks (iii) we
observe clear separation between baseline and BCG exposed monocytes. (B) Heat map of differentially
regulated genes (p < 0.05, FC > 1.5) related to promoters. (C) Box plots of down and upregulated peaks
after BCG vaccination.

| 81
 Chapter 6

Trained innate immunity as underlying

mechanism for the long-term non-specific
effects of vaccines

Bastiaan A. Blok*, Rob J.W. Arts*, Reinout van Crevel, Christine S. Benn, Mihai G.
Netea.

*These authors contributed equally to this work

J Leukoc Biol 2015;3:347-56

Chapter 6

ABSTRACT

An increasing body of evidence shows that the innate immune system has adaptive
characteristics that involve a heterologous memory of past insults. Both experimental
models and proof-of-principle clinical trials show that innate immune cells such
as monocytes, macrophages and NK-cells can provide protection against certain
infections in vaccination models independently of lymphocytes. This process is
regulated through epigenetic reprogramming of innate immune cells and has been
termed ‘trained immunity’. It has been hypothesized that induction of trained immunity
is responsible for the protective non-specific effects induced by vaccines such as
BCG, measles vaccination, and other whole-microorganism vaccines. In this review
we will present the mechanisms of trained immunity responsible for the long-lasting
effects of vaccines on the innate immune system.

84 |
 Non-specific Effects of Vaccines

Traditionally the host defense against invading pathogens is divided into innate and
adaptive immunity. The innate immune system, relying on monocytes, macrophages,
neutrophils, dendritic cells and NK-cell as its cellular effectors, recognizes pathogens
using pattern recognition receptors (PRR; e.g. TLRs, NLRs, CLRs, RIGI-helicases)
that bind pathogens associated molecular patterns (PAMPs) on pathogens. This
results in a rapid activation of host defense: cytokine and chemokine production,
phagocytosis, reactive oxygen/nitric oxide species production and other antimicrobial
killing mechanisms, as well as antigen presentation to the adaptive immune system
(1, 2). Since the innate immune system is considered not to possess immunologic
memory, its actions are seen as being non-specific and to induce an identical effect
upon every encounter with a pathogen. The adaptive immune system that consists of
T- and B-lymphocytes, acts through specific recognition of antigens by lymphocytes,
which induces memory cells that will greatly enhance the response to a later infection
6
with a similar pathogen. Classical vaccination is based on this adaptive immune
mechanism. Since the activation of lymphocytes and generation of memory cells is
a slow process (days to weeks), vaccination is used to induce a ‘safe/controlled’ first
activation of the immune system that will result in a specific memory and will protect
the vaccinated host from secondary infection with the pathogen against which it was
vaccinated (3).
Recent data challenge however the paradigm that innate immunity is completely
devoid of adaptive characteristics. Non-specific beneficial effects of vaccines on
mortality and morbidity due to infections have been increasingly reported, which
could not be explained solely by adaptive immunity (4). In both observational studies
and randomized controlled trials it was shown that BCG reduced overall mortality,
mainly by a decrease in lower respiratory infections and sepsis (further discussed
below). Since this effect seems to be established within days, this is more consistent
with an effect on innate immunity than on adaptive immunity. Moreover, studies in
plants and non-vertebrates that totally lack adaptive immunity, have also shown
protective host immune responses in models of vaccination or after certain infections
(reviewed in (5)). These observations led to the hypothesis that certain infections
or vaccines are able to induce reprogramming of the innate immune responses,
leading to non-specific protection to reinfection, a process named trained immunity
(5, 6) (Figure 1).

Trained immunity: a de facto innate immune memory

An important model to study the mechanisms mediating trained immunity (TRIM) is
the protection to reinfection induced by Candida albicans or its cell-wall component
β-glucan. It was shown that mice infected with a nonlethal C. albicans infection had
a lower mortality from a lethal C. albicans infection 7 days later. This protective

| 85
Chapter 6

Innate immune function

Training:
e.g. BCG

Tolerance:
e.g. LPS

Time
Vaccination Infection
Figure 1 - Long-term effects of vaccines on innate immune function. Upon vaccination, the innate
immune system becomes activated by the vaccine. The stimulation of innate immunity can lead to long-
term effects leading to an increase response to a (non-related) infection. For example, BCG vaccination
leads to training of innate immunity and a more effective host immune response, accompanied by a
reduced mortality due to non-related infections. On the contrary, a previous infection with a Gram-negative
microorganism and endotoxemia can lead to immunotolerance and a decreased response to an infection.

effect appeared to be T/B-cell independent, as Rag1-deficient mice were still

partially protected (7), just as SCID mice in a BCG-induced trained immunity model
(discussed below) (8). In contrast, CCR2-deficient mice in which myeloid cells are
trapped in the bone marrow lost all protection: this demonstrates that only the loss of
both innate immune effects (trained immunity) and adaptive memory (through loss
of antigen-presenting cell function) leads to a complete inactivation of the protective
effects induced by BCG. In an in-vitro experimental model, monocytes primed with
β-glucan displayed a reprogramming of their function, among which an increased
pro-inflammatory cytokine response to secondary stimuli. This appeared to be
mediated by a dectin-1-Raf1 pathway and led to increased methylation of histone
activation markers such as H3K4me3 and transcription of the TNFA and IL6 genes
upon stimulation with (non-) related pathogens (7). Subsequently, inhibition of histone
methyltransferases inhibited these effects, demonstrating a role of this epigenetic-
based mechanism for induction of innate immune memory, a conclusion supported by
genome wide changes in H3K4me3, H3K4me1 and H3K27Ac (7, 9). Other microbial
components were also shown to induce long-term reprogramming of innate immune
responses. It should be noted, however, that the functional reprogramming of innate
immune cells can result in an enhanced response after restimulation, as seen for
Candida, but can also result in a reduced responses, indicative of tolerance, as
seen for LPS (Figure 1) (9). On the other hand, one could also argue that it would be

86 |
 Non-specific Effects of Vaccines

more appropriate to depart from the view that one particular training stimulus would
induce either increase or decrease of cell function: in fact it can be observed that
each of these stimuli induces at the same time upregulation of certain genes, while
downregulating others (10).
Pathway analysis of the transcriptome and epigenome profiles of trained
monocytes demonstrated a central role for the mTOR-pathway and glycolysis for
induction of innate immunity. Similar to activated lymphocytes (11) or cancer cells (12)
a shift in glucose cellular metabolism from oxidative phosphorylation towards aerobic
glycolysis (known as the Warburg effect), was necessary for the function of trained
cells (13). Hence, trained immunity is induced through epigenetic reprogramming of
the transcriptional programs, as well as a through a switch in the cellular metabolism
of glucose that insures the energy sources for the cells.
The capacity to induce trained immunity has been reported for BCG vaccination
6
too (8, 14). Furthermore, other vaccines have also been shown to have long-lasting
effects on all-cause mortality, and it has been hypothesized that they induce innate
immune training effects (15). In the present review we will focus on the non-specific
effects of vaccines and the evaluation of their capacity to induce trained immunity
and heterologous immune effects.

BCG
The BCG vaccine is a live-attenuated vaccine against tuberculosis that is derived
from the causative agent of bovine tuberculosis, Mycobacterium bovis. Its protective
effect against tuberculosis differs greatly between different populations and different
forms of tuberculosis (16). This is mostly attributed to different rates of priming with
environmental mycobacteria which would nullify the additional protective effect of
BCG vaccination (reviewed in (17)).

Non-specific effects on mortality and morbidity

In addition to its specific protective effect against tuberculosis, BCG has been shown
to possess several non-specific effects. BCG-induced potent non-specific effects
during therapy for bladder cancer (18), topical therapy for common and genital warts
(19-21), diffuse cuteneous leishmania (22), and even as treatment for asthma or
type 1 diabetes (23, 24). In addition, reports from the 1950s and 1960s showed that
BCG vaccination or stimulation with other mycobacterial proteins (25) protect against
infection with Staphylococcus aureus, Salmonella enteritidis, M. fortuitum (26, 27),
Yersinia pestis (28), Klebsiella pneumonia (29), Salmonella enteritidis, Schistosoma
mansoni (30), herpes simplex and vaccinia virus (31), Leishmania Major (32) and
tumors (33) in mice, with effects that lasted up to 11 months after vaccination. A small
number of studies have also reported increased susceptibility to Salmonella typhi, or

| 87
Chapter 6

Eberthella typhosa after BCG vaccination (34-36).

Early human observational data are also available to support the hypothesis that
BCG induces important non-specific effects. After the introduction of BCG vaccination
in the province of Norrbotten in Sweden in 1931, mortality in the BCG-vaccinated
children in the first year of life was 6.6% compared to 22.2% in the non-vaccinated,
an effect that was too big to be due only to the protection to tuberculosis (37). A year
later, in 1932, the Pasteur Institute reviewed their safety data on BCG vaccination
and showed a mortality of 7.0% among vaccinated, compared to 15.3% among
non-vaccinated children (38). Several trials performed in the 1940s and 1950s in
the USA and the UK show decreased overall mortality in children vaccinated with
BCG (reviewed in (39)). More recent observational studies also showed similar non-
specific protective effects by BCG (40). Several observational studies performed
in West-Africa showed that BCG vaccination (as determined by vaccination card,
tuberculin test, or scar formation) was associated with a decreased overall mortality,
with mortality ratios ranging from 0.41 to 0.55 (41-43), and similar protective
effects of BCG were observed in several Asian countries (44, 45). Apart from these
observational data, two randomized controlled trials have been performed to study
the non-specific effects of BCG. In a first trial, 2320 low-birth-weight children (who
normally will not receive BCG vaccine until they have gained enough weight), were
randomized to receive BCG at birth or a delayed BCG vaccination. A mortality
rate ratio of 0.49 (0.21-1.15) was shown after 3 days and 0.55 (0.34-0.89) after 4
weeks in favor of the BCG-vaccinated neonates. The effect was most prominent in
children with the lowest birth weight (<1.5kg) and was mainly due to fewer cases of
neonatal sepsis, respiratory infections, and fever (46). A similar effect was observed
in a smaller trial (47). A case-control study performed in this population found a
beneficial effects of BCG vaccination on the incidence of acute lower respiratory
tract infections and infection with respiratory syncitial virus. This effect was more
marked in girls compared to boys (48). Revaccination of children aged 19 months
to 5 years with low or no reactivity to tuberculin skin test did not have effects on
overall mortality. Though this may have been due to the fact that many children
received DTP afterwards; in children who had received all their DTP vaccines before
enrolment, revaccination with BCG was associated with a mortality rate ratio of 0.36
(0.13- 0.99) (49).

Non-specific immunological effects of BCG

The beneficial non-specific effects of BCG vaccination have been proposed to
be mediated by two types of mechanisms: lymphocyte-mediated heterologous
effects, or by innate trained immunity. Cross-reactivity of T-lymphocytes, a process
termed ‘heterologous immunity’ (50), has been long proposed to mediated some

88 |
 Non-specific Effects of Vaccines

of the non-specific effects of vaccines. Heterologous immunity has been especially

well described in virus infections, and it has been shown in mice that BCG can
protect against infection with vaccinia virus through a mechanism dependent on
T-cell receptor signaling and IFNγ production in CD4 cells (51). In an experimental
model in hamsters, BCG vaccination increased the lytic activity of peritoneal cells
against herpes simplex infected cells, an effect dependent on non-adherent Thy1.2+
cells (52). Furthermore, it has been shown that CD4 and CD8 memory cells can be
activated in an antigen-independent manner, and they can therefore boost both Th1
and Th17 responses upon secondary non-related infections (53-58). Interestingly,
BCG revaccination of two year old children in Guinea Bissau resulted in lower TNFα
and higher IL-10 responses to LPS, PHA and PPD (59), an effect that might be
dependent on Treg induction by the second BCG vaccination, as it was shown that
mice that were presensitized with mycobacteria developed more Treg induction
6
and higher IL-10 response upon subsequent vaccination with BCG (60). Also, BCG
vaccination has been shown to enhance the antibody titer and T-cell responses to
other vaccines such as hepatitis B, polio and pneumococcal conjugate vaccination
(61, 62)
In addition to heterologous immunity, experimental and epidemiological data point
to long-term effects of BCG on the innate immune responses. A mice study showed
that BCG/PPD-activated macrophages were able to produce more H2O2 and were
better capable in killing Candida albicans (63). Also SCID mice (lacking functional
lymphocytes), showed an increased survival from Candida sepsis and less fungal
outgrowth after BCG vaccination, with spleen monocytes producing more TNFα upon
ex-vivo restimulation (8). BCG vaccinated B-cell deficient mice were as effectively
protected from S. mansoni infection as the wild type controls (64). Administration
of muramyldipeptide (MDP), which is a constituent of mycobacterial cells walls,
confers protection against infection with vaccinia virus and herpes simplex virus in
mice, and this effect was mediated by peritoneal macrophages and not dependent
on IFNγ (31). Mice vaccinated with BCG show increased resistance against malaria
infection, which was associated with increased transcription of antimicrobial proteins
compared to non-vaccinated mice (65).
In humans, BCG vaccination was shown to induce potentiation of the activity of
NK-cells (22, 66), and the protective effect of BCG vaccination on disseminated
candidiasis was partially dependent on NK-cells (66). Compared to cord blood
monocytes from unvaccinated babies, cells from vaccinated infants showed
increased expression of granulysin and perforin upon stimulation (67). In a trial in
Guinea Bissau with 467 low-birth-weight newborns, ex-vivo cytokine production was
upregulated upon stimulation with several TLR agonists (68), and an association of
the number of M1 vs. M2 macrophages for the risk of recurrence after intravesical

| 89
Chapter 6

BCG therapy supports an important role of innate immune cells for the non-specific
effects of BCG (69). An increase in antimicrobial peptide production in infants
vaccinated with OPV and BCG was also observed in a human observational study
(70).

Molecular mechanisms behind the non-specific effects of BCG on trained

immunity
Little is known regarding the molecular mechanisms mediating trained immunity
induced by BCG vaccination. In a human vaccination trial, BCG resulted in an
increased pro-inflammatory cytokine response of monocytes for up until three
months after vaccination, upon ex-vivo stimulation with M. tuberculosis, S. aureus,
or C. albicans. This was accompanied by a small increase of the activation markers
CD11b, TLR4 and CD14. The increased cytokine production was a result of higher
mRNA expression, which was accompanied by an increased H3K4me3 at the IL6
and TNFA promoters (8). However, these effects mostly reversed 12 months after
vaccination, arguing that trained immunity is shorter lived than classical adaptive
immune memory. In addition, in an in-vitro model in which monocytes are trained
for 24h with BCG and restimulated one week later, it was shown that trained
immunity induced by BCG was dependent on the recognition by the NOD2 receptor,
as monocytes of NOD2-deficient patients could not be trained. Moreover, BCG-
induction of trained immunity in-vitro was inhibited by the addition of the histone
methyltransferase MTA (8), suggesting that epigenetic changes at the level of
histone methylation play an important role. These effects of trained immunity by
BCG in vivo were shown to wane after one year, while heterologous effects on Th1
and Th17 responses were still visible at this timepoint (14). Finally, the induction of
trained immunity by BCG was shown to be dependent on autophagy (71). Moreover,
SNPs in autophagy genes were correlated with clinical outcome of bladder cancer
patients that were treated with BCG instillations, hinting to the fact that the effect of
BCG on bladder carcinoma might also be mediated by the innate immune system.
An overview of the molecular mechanisms responsible for the induction of trained
immunity by BCG is presented in Figure 2.

YELLOW FEVER VACCINE

The yellow fever vaccine (YFV) is a live-attenuated vaccine that in developed
countries is only administered to travelers going to yellow fever endemic countries.
In contrast, in many countries in Africa, South and Middle America YFV is part of
the routine vaccination program (72). Vaccination with YFV results in viraemia three
to seven days after vaccination, which results in a life-long immunity against yellow
fever, making the YFV one of the most effective vaccines in use (73). Although no

90 |
 Non-specific Effects of Vaccines

Figure 2 - Molecular mechanisms of trained immunity induced by BCG. During the uptake and
digestion of BCG by the monocytes and macrophages, autophagy plays an important role. In the
autophagolysosome compartment BCG is digested, with the release of MDP that activates NOD2.
Through a signaling cascade that remains to be deciphered, NOD2-dependent signals induce epigenetic
reprogramming such as H3K4 trimethylation, that is responsible for relaxing the chromatin and increasing
gene transcription.

prospective clinical trials have been performed, observational studies may suggest
that YFV exerts potent non-specific effects. In an observational study (2007-2011)
where the effect on overall mortality of live and live plus inactivated vaccines was
compared, subjects (9-23 months old) where vaccinated with measles vaccine with
or without a pentavalent vaccine containing DTP, H. influenzae type B and hepatitis
B vaccine. In the last few years of the study the YFV was added to the vaccination
program. Although confounding factors between the periods with and without YFV
may have influenced the results, mortality declined after introduction of the YFV from
15.2 to 7.0 for the 6 months follow up, and from 18.2 to 9.2 for 12 months follow up
(74).

Non-specific immunological effects of YFV

Interestingly, non-specific immunological effects of YFV have also been reported.
When human volunteers were vaccinated with the YFV and 7, 15 and 30 days after
vaccination isolated neutrophils, monocytes and NK-cells were restimuled ex vivo
with the YFV, a higher TNFα signal in the unstimulated cells and a higher IL-10
production in both unstimulated and stimulated cells was observed up until 30 days
after vaccination. NK-cells did not show any difference for IFNγ, but IL-4 production

| 91
Chapter 6

was significantly decreased in the non-stimulated cells, still 30 days after vaccination
(75). In a similar vaccination study, an increased amount of pro-inflammatory
monocytes (defined as CD14+CD16+HLA-DR++) was observed after YFV, which
fits with the upregulated cytokine staining (76). Changes induced by YFV in NK-
cells were determined in a vaccination study in 8 volunteers, showing a significant
upregulation of TLR3 and TLR9 expression on NK-cells until 10 and 7 days after
vaccination, respectively. Interestingly, minor changes in TLR3 and TLR9 were
seen up to 60 days post vaccination. Activation markers such as CD69 and HLA-
DP,PQ,DR were significantly higher expressed until 10 days post vaccination and
especially the latter remained on average higher expressed until 60 days (77, 78).
In conclusion, mounting evidence suggests that YFV induces long-term activation of
monocytes and NK-cells.

Molecular mechanisms behind the non-specific effects of YFV

The YFV is recognized by TLR7, RIG-I helicases, and potentially TLR9 (79, 80).
Regarding the molecular events induced by YFV, it has been demonstrated that this
signals via a TLR9-PI(3)K-mTOR-p70S6K pathway, which leads to, among others,
activation of mTOR (80). Transcription data showed that hexokinase 3 (HK3, a rate
limiting enzyme in the glycolysis pathway), is still upregulated 60 days after YFV (13,
81). Further, in an infectious model in which rhesus macaques were infected with
the viscerotropic yellow fever virus, an upregulation of several epigenetic regulators
of histone methyltransferase activity was reported (82). In a different study, two
histone modulators were upregulated in the first week after vaccination: HIST1H1C
and HIST1H4C (81). These data were not mirrored by whole-blood transcriptome
analysis, presumably due to the fact that neutrophil-related signatures would likely
mask effects on the minority monocyte and NK-cell populations (83, 84) and also sex
differential effects were not taken into account in these analyses, possibly masking
potential effect (85).

INFLUENZA VACCINE
Influenza vaccination is done with either live or inactivated vaccines that consists
of three or four influenza strains which may differ each new season, depending on
the strains that are predicted to be most common during the influenza season. In
many high-income countries the inactivated vaccine is given annually to people with
a higher risk for complications of influenza (e.g. chronically ill, elderly, weakened
immune system) or health care workers (86), whereas the live-attenuated vaccine it
is recommended also to children in the US.

92 |
 Non-specific Effects of Vaccines

Non-specific immunological effects of influenza vaccine

14 and 28 days after vaccination with an inactivated influenza vaccine, PBMCs were
isolated and ex-vivo stimulation with LPS, M. tuberculosis, C. albicans and S. aureus
was performed. This showed a tendency for increased TNFα and IL-6 production,
whereas IL-1β, IFNγ and IL-10 production was downregulated (87). A similar trend
was observed in a trial in which both older (>65 years) and younger (21-30 years)
individuals were vaccinated with inactivated influenza vaccine. Blood was drawn
before and 2, 7 and 28 days after vaccination, showing an increase in IL-6 and TNFα
staining of CD14+CD16- and CD14+CD16+ monocytes in the younger volunteer
group. In contrast in the older individuals an increase in IL-10 intracellular staining
was observed in both types of monocytes (88). In another trial, healthy volunteers
were vaccinated with a live-attenuated influenza vaccine. Four, seven and 11 weeks
after vaccination PBMCs were stimulated ex vivo with the vaccine and cytokine
6
production was assessed. A decrease in IL-10 production was observed, while the
production of pro-inflammatory cytokines was decreased at 4 and 11 weeks post-
vaccination, with a slight increase at 7 weeks. No explanation for the difference
between the results at 7 and 11 weeks was proposed by the authors (89).
Influenza vaccine is known to be recognized by TLR7 (90), but not much is
known regarding the mechanisms through which influenza vaccine modulates
innate immunity. However, potentiation of NK-cell function is probably one of the
most relevant. In this respect, it has been shown that influenza is a potent stimulator
of NK-activity, and that it increases the number of CD69+ spleen NK-cells (78). In
a model of spontaneous metastasis of 4T1 breast tumor, when resection of the
primary tumor was combined with an inactivated influenza vaccination, a reduced
amount of metastases was observed. This effect could be reversed by depleting NK-
cells (78). In humans who were vaccinated with the inactivated influenza vaccine,
an upregulation of CD69 expression, an increase of NK cytotoxicity (78), and an
upregulation of NKp46+ and 2B4+ NK-cells was shown, which lasted until 14 days
after vaccination with the live-attenuated vaccine (91).

VACCINIA
Vaccinia virus belongs to the family of Poxviridiae, genus Orthopoxvirus, and has
been used extensively to vaccinate against smallpox, the very severe disease
caused by the related variola virus. Vaccination campaigns with vaccinia were
very successful, leading to the eradication of smallpox in 1977. Vaccinia induced
protection against smallpox is thought to rely on the induction of neutralizing
antibodies and the generation of memory T-cells (92). Two observational studies
on the non-specific effect of vaccinia on overall mortality have been performed in
Guinea-Bissau. Adults were screened for the presence of a vaccinia scar and this

| 93
Chapter 6

was associated with a decrease in overall mortality ranging from 40 to 80% (93, 94).
Also, vaccinia vaccination has been linked with protection against melanoma and
non-Hodgkin lymphoma (95-97).

Non-specific immunological effects of vaccinia

The epidemiological observation is complemented by a number of experimental
studies in animals. Peritoneal cells and spleen cells from hamsters vaccinated with
vaccinia showed an increased ex vivo cytotoxic activity towards cells infected with
herpes simplex virus (HSV) (52, 98). For peritoneal cells this effect was mediated
by a Thy1.2-positive fraction, and not by adherent macrophages, pointing to the fact
that lymphoid cells are most likely involved (52). In the spleen cells however this
effect was shown to be dependent on a Thy1.2-negative cell population, consistent
with vaccinia activation of NK-cells (98).
Vaccinia has been also shown to modulate the cytokine production capacity. An
increase of IFNγ, IL-6 and TNFα production was found when spleen cells of vaccinia-
challenged mice were cultured with vaccinia-infected cells compared to spleen cells
from naive mice. The IL-6 and TNFα production was shown to be dependent on
the adherent cells, compatible with monocytes and macrophages, whereas IFNγ
production was dependent on both CD4 and adherent cells. Interestingly, when
spleen cells from vaccinia-challenged mice were stimulated with HSV-infected cells,
a strong increase in IL-6 and TNFα, but not IFNγ, production was noted, indicative of
non-specific stimulation (99). The upregulation of pro-inflammatory cytokine release
to unrelated stimuli seems to be present after in vivo, but not in vitro, infection with
vaccinia virus. Dendritic cells show a decreased production of IL-6 and TNFα upon
LPS and poly(I:C) stimulation when infected with vaccinia in vitro compared to mock
infection, but increased production of these cytokines to LPS stimulation when cells
are isolated from mice infected in vivo (100, 101). Other effector mechanisms of
innate immune activation are also influenced by vaccinia infection since murine
peritoneal cells harvested two weeks after vaccinia challenge showed increased
production of reactive oxygen species when stimulated both with zymosan and
with whole heat-killed C. albicans, this effect lasted for three weeks after vaccinia
infection (102).
Since several studies point to a role of TLR2 in the innate immune recognition
of vaccinia and engagement of TLR2 by Pam3CSK4 has been shown to prime
ROS production in murine and human macrophages, this effect could potentially be
mediated by TLR2 activation by vaccinia (103, 104). However, TLR2 stimulation in
this study lead to decreased cytokine responses, and therefore it is unlikely to fully
account for the effects of vaccinia. Interestingly, stimulation of TLR2 in hematopoetic
stem cells (HSPCs) leads to alteration in the functional phenotype of progenitor

94 |
 Non-specific Effects of Vaccines

monocytes and macrophages (104). One could speculate that TLR2 recognition of
vaccinia in HSPCs could therefore lead to phenotypic changes that account for the
observed epidemiological long-term non-specific effects.

Molecular mechanisms behind the non-specific effects of vaccinia

The in-vivo effects of vaccinia challenge in humans have been characterized in a
gene expression study in which PBMCs were isolated from 24 healthy volunteers
before and 3 days, 6 days and 55 days after vaccination. Most of the genes that were
differentially expressed showed the greatest modulation 6 days after vaccination.
However, a large number of genes were still differentially expressed 55 days after
vaccination, including several genes related to innate immune function. On the
early time points after vaccination a striking upregulation of monocyte/macrophages
specific markers was observed such as CD63 and CD16, as well as NK-specific
6
genes such as KLRB1 and ZAP70. Interestingly, expression of IL8 and its receptor
CXCR2 were both upregulated 55 days after vaccination, as well as IL18 and
ARID5A, which stabilizes IL-6 and leads to increased IL-6 production in vivo. Several
genes involved in cell metabolism which have been shown to be upregulated in
models of trained immunity (e.g. HIF1A transcription factor) were also increased 55
days after vaccinia challenge (83).

MEASLES VACCINE
Measles vaccination is part of worldwide vaccination programs, sometimes
incorporated in the measles-mumps-rubella vaccine. Protection against measles
infection after vaccination is thought to rely on both humoral and cellular adaptive
responses (105). Apart from its specific effect against measles infection, numerous
observational studies from low-income countries and a randomized trial from have
shown that measles vaccination is associated with decreased overall mortality
and morbidity (106-108). Furthermore, a study from the Gambia has shown that
nasopharyngeal carriage of S. pneumoniae and H. influenzae is decreased after
measles and YFV vaccination compared to before vaccination (109).

Non-specific immunological effects of measles vaccine

Natural measles infection is well known to induce immunosuppression, which is
mainly thought to be dependent on lymphocyte depletion and silencing (110, 111).
Inhibitory effects of measles vaccination on immune responses have been reported
as well (112, 113). Interestingly, wild-type measles virus and vaccine strains are
recognized differentially by monocytes, with wild-type measles virus being recognized
by TLR2 (114) whereas for recognition of vaccine strains TLR3 and RIG-I seem
to be of importance (115-117). This difference in innate immune recognition could

| 95
Chapter 6

point to the fact that natural measles infection and measles vaccination might have
differential effects on non-specific immunological responses. Several studies have
assessed non-specific responses ex vivo before and after measles vaccination.
Ovsyannikova et al. reported that after measles vaccination the ex-vivo production
of both innate (IL-6, TNFα) and adaptive (IFNγ, IL-2) cytokines upon PHA stimulation
is decreased during two weeks after vaccination. However, 30 days post vaccination
levels of IL-6, IFNγ and IL-2 are increased compared to baseline. After a second
measles vaccination, a different pattern was seen with increased IL-6, TNFα, and
IFNγ responses lasting until 2 weeks postvaccination (118). Pabst et al. compared
cellular recall responses to tetanus toxoid (TT) and Candida antigen, and cytokine
production of PBMCs upon stimulation with PHA before and after (14, 22, 30 and 38
days) primary measles vaccination in infants. Two weeks after measles vaccination
a transient drop in cellular recall responses to TT and candida antigen was seen,
but IFNγ response to PHA was significantly increased 14 and 38 days after measles
vaccination (119). Likewise, Hussey et al. found decreased lymphoproliferative
responses to PHA 2 weeks and 3 months after primary and secondary vaccination
with the Schwarz strain of measles vaccine, but an increased concentration of the
macrophage activation marker neopterin 2 weeks after vaccination (120). In contrast,
Jensen et al. compared ex-vivo cytokine responses to a panel of non-specific
stimuli before and six weeks after measles vaccination and found no influence
on innate (TNFα, IL-10) or adaptive (IFNγ, IL-13, IL-5, IL-17) cytokine production
(121). Overall, vaccination with measles seems to induce a transient suppression of
lymphoproliferative responses, but a slight increase in innate immune responses as
measured by non-specific cytokine production.

OTHER VACCINES
In addition to the several vaccines detailed above for which a relatively abundant
amount of information is available with regard to their non-specific immunological
effects, similar data, although less detailed, is known for other vaccines. For HPV
vaccination it has been shown that 2 weeks after primary and secondary vaccination
an increased expression of NK-activation markers NKG2D, NKp30 and NKp46 is
observed, as well as increased expression of ILT2 (negative regulatory receptor) on
monocytes (122).
One of the most controversial discussion in the literature concerns DTP vaccination,
for which deleterious effects on mortality have been reported by some, albeit not all,
researchers. One could speculate that these effects may at least partly be explained
by an effect on the innate immune system. Several observational studies performed
in environments with high pediatric mortality have shown increased overall mortality
in the period in which DTP vaccine is the most recently administered vaccine. This

96 |
 Non-specific Effects of Vaccines

effect was more pronounced in girls compared to boys (42, 123, 124). Similarly, an
increase in the incidence of intestinal infection with rotavirus and C. parvum was
observed in girls who had received DTP as most recent vaccination (125, 126). Also,
in a murine study vaccination with DTP resulted in increased pathology and mortality
when mice where challenged with RSV one week after immunization. This effect
was more pronounced with purified pertussis toxin, and in an experiment with an
adoptive transfer of spleen cells, not dependent on CD4 or CD8 T-cells (127).
In the light of the beneficial non-specific effects of BCG vaccine which may be
exerted through trained immunity, it could be speculated that DTP might have an
opposite effect on the innate immune system compared to BCG, inducing functional
reprogramming of the immune system predisposing for increased susceptibility to
infections. However, whether this is true and how DTP -or its adjuvant (alum)- exerts
this effect remains to be demonstrated.
6
FUTURE PESPECTIVES
The potential of vaccines to have non-specific effects on diseases other than the
primary target infection is increasingly recognized as a very important phenomenon,
as seen in the recommendation of the WHO SAGE working group which argues for
the need for more studies to investigate the non-specific effects of vaccines (128).
Given the evidence accumulated so far, it is likely that many of the non-specific
effects of vaccines are at least in part mediated by reprogramming of the innate
immune system.
This conclusion has several implications that warrant further research into the
effects of vaccination on the innate immune system.
Firstly, by taking into account these beneficial (and sometimes maybe deleterious)
non-specific effects of vaccines, there is potential for a more rational design of
vaccination policies, by delivering vaccines in an order that confers the maximum
beneficial effects and protection against off-target diseases during childhood (40).
Secondly, if currently used vaccines with strong beneficial non-specific effects
but moderate specific protective effects, such as BCG, are to be replaced by newer
vaccines that confer a greater specific protective effect, these new vaccines should
also be evaluated for their non-specific effects. The old vaccine should not be
withdrawn and substituted by a new vaccine without evaluation of the effect of this
change on overall mortality.
Thirdly, the non-specific effects of vaccines that have been phased out of
vaccination policies due to the eradication of their target disease, such as vaccinia
(worldwide), BCG (developed world), or perhaps in the future polio vaccine and
measles vaccine, could still have beneficial effects without protecting against their
target diseases. These potential beneficial effects should be investigated, because

| 97
Chapter 6

these vaccines might still confer benefits even if their respective target-diseases
have been eliminated.
Fourthly, many adjuvants which are used to enhance the adaptive immunological
response to vaccination against infections, and more recently cancer, act through
activation of the innate immune system. Further research is warranted to identify
innovative approaches for the design of novel classes of vaccines that combine
effective induction of adaptive immune responses with elicitation of innate immune
memory (trained immunity).
Fifthly, with increasing life span, immunosenescence is a growing problem, which
may be alleviated by use of vaccines which induce innate immune training.
Finally, the study of the beneficial non-specific effects of vaccines might lead
to the development of new strategies to use them in patient groups suffering from
immunodeficiencies, who cannot be vaccinated with live vaccines.

REFERENCES
1. Takeuchi O, Akira S. Pattern recognition receptors
and inflammation. Cell. 2010;140(6):805-20.
2. Kawai T, Akira S. The role of pattern-recognition
receptors in innate immunity: update on Toll-like
receptors. Nature immunology. 2010;11(5):373-84.
3. Chang JT, Wherry EJ, Goldrath AW. Molecular
regulation of effector and memory T cell differentiation.
Nature immunology. 2014;15(12):1104-15.
4. Aaby P, Kollmann TR, Benn CS. Nonspecific effects
of neonatal and infant vaccination: public-health,
immunological and conceptual challenges. Nature
immunology. 2014;15(10):895-9.
5. Netea MG, Quintin J, van der Meer JW. Trained
immunity: a memory for innate host defense. Cell
host & microbe. 2011;9(5):355-61.
6. Quintin J, Cheng SC, van der Meer JW, Netea
MG. Innate immune memory: towards a better
understanding of host defense mechanisms. Current
opinion in immunology. 2014;29:1-7.
7. Quintin J, Saeed S, Martens JH, Giamarellos-
Bourboulis EJ, Ifrim DC, Logie C, et al. Candida
albicans infection affords protection against
reinfection via functional reprogramming of
monocytes. Cell host & microbe. 2012;12(2):223-32.
8. Kleinnijenhuis J, Quintin J, Preijers F, Joosten LA,
Ifrim DC, Saeed S, et al. Bacille Calmette-Guerin
induces NOD2-dependent nonspecific protection
from reinfection via epigenetic reprogramming of
monocytes. Proceedings of the National Academy
of Sciences of the United States of America.
2012;109(43):17537-42.
9. Ifrim DC, Quintin J, Joosten LA, Jacobs C, Jansen
T, Jacobs L, et al. Trained immunity or tolerance:
opposing functional programs induced in human
monocytes after engagement of various pattern
recognition receptors. Clinical and vaccine
immunology : CVI. 2014;21(4):534-45.
10. Saeed S, Quintin J, Kerstens HH, Rao NA,
Aghajanirefah A, Matarese F, et al. Epigenetic
programming of monocyte-to-macrophage
differentiation and trained innate immunity. Science.
2014;345(6204):1251086.
11. Finlay DK. Regulation of glucose metabolism in T
cells: new insight into the role of Phosphoinositide
3-kinases. Frontiers in immunology. 2012;3:247.
12. Levine AJ, Puzio-Kuter AM. The control of the
metabolic switch in cancers by oncogenes and tumor
suppressor genes. Science. 2010;330(6009):1340-4.
13. Cheng SC, Quintin J, Cramer RA, Shepardson KM,
Saeed S, Kumar V, et al. mTOR- and HIF-1alpha-
mediated aerobic glycolysis as metabolic basis for
trained immunity. Science. 2014;345(6204):1250684.
14. Kleinnijenhuis J, Quintin J, Preijers F, Benn CS,
Joosten LA, Jacobs C, et al. Long-lasting effects of
BCG vaccination on both heterologous Th1/Th17
responses and innate trained immunity. Journal of
innate immunity. 2014;6(2):152-8.
15. Benn CS, Netea MG, Selin LK, Aaby P. A small jab
- a big effect: nonspecific immunomodulation by
vaccines. Trends Immunol. 2013;34(9):431-9.
16. Mangtani P, Abubakar I, Ariti C, Beynon R, Pimpin L,
Fine PE, et al. Protection by BCG vaccine against
tuberculosis: a systematic review of randomized
controlled trials. Clinical infectious diseases : an
official publication of the Infectious Diseases Society
of America. 2014;58(4):470-80.
17. Netea MG, van Crevel R. BCG-induced protection:
effects on innate immune memory. Semin Immunol.
2014;26(6):512-7.
18. Sylvester RJ, van der MA, Lamm DL. Intravesical
bacillus Calmette-Guerin reduces the risk of
progression in patients with superficial bladder
cancer: a meta-analysis of the published results of
randomized clinical trials. The Journal of urology.
2002;168(5):1964-70.
19. Salem A, Nofal A, Hosny D. Treatment of common
and plane warts in children with topical viable
Bacillus Calmette-Guerin. Pediatric dermatology.
2013;30(1):60-3.
20. Metawea B, El-Nashar AR, Kamel I, Kassem W,
Shamloul R. Application of viable bacille Calmette-
Guerin topically as a potential therapeutic modality in
condylomata acuminata: a placebo-controlled study.
Urology. 2005;65(2):247-50.
21. Nofal A, Yosef A, Salah E. Treatment of recalcitrant
warts with Bacillus Calmette-Guerin: a promising new
approach. Dermatologic therapy. 2013;26(6):481-5.
22. Pereira LI, Dorta ML, Pereira AJ, Bastos RP,
Oliveira MA, Pinto SA, et al. Increase of NK cells
and proinflammatory monocytes are associated
with the clinical improvement of diffuse cutaneous
leishmaniasis after immunochemotherapy with
BCG/Leishmania antigens. The American journal of
tropical medicine and hygiene. 2009;81(3):378-83.
23. Rousseau MC, Parent ME, St-Pierre Y. Potential
health effects from non-specific stimulation of the
immune function in early age: the example of BCG
vaccination. Pediatric allergy and immunology
: official publication of the European Society of
Pediatric Allergy and Immunology. 2008;19(5):438-
48.
24. Faustman DL, Wang L, Okubo Y, Burger D, Ban
L, Man G, et al. Proof-of-concept, randomized,
controlled clinical trial of Bacillus-Calmette-Guerin
for treatment of long-term type 1 diabetes. PloS one.
2012;7(8):e41756.
25. Williams CA, Jr., Dubos RJ. Studies on fractions
of methanol extracts of tubercle bacilli. I. Fractions

98 |

which increase resistance to infection. The Journal of
experimental medicine. 1959;110:981-1004.
26. Dubos RJ, Schaedler RW. Effects of cellular
constituents of mycobacteria on the resistance
of mice to heterologous infections I. Protective
effects. The Journal of experimental medicine.
1957;106(5):703-17.
27. Fox AE, Evans GL, Turner FJ, Schwartz BS, Blaustein
A. Stimulation of nonspecific resistance to infection
by a crude cell wall preparation from Mycobacterium
phlei. Journal of bacteriology. 1966;92(1):1-5.
28. Weiss DW. Enhanced resistance of mice to infection
with Pasteurella pestis following vaccination with
fractions of phenol-killed tubercle bacilli. Nature.
1960;186:1060-1.
29. Weiss DW, Bonhag RS, Parks JA. Studies on the
Heterologous Immunogenicity of a Menthanol-
Insoluble Fraction of Attenuated Tubercle Bacilli
(Bcg). I. Antimicrobial Protection. The Journal of
experimental medicine. 1964;119:53-70.
30. Maddison SE, Chandler FW, Kagan IG. The effect of
pretreatment with BCG on infection with Schistosoma
mansoni in mice and monkeys. Journal of the
Reticuloendothelial Society. 1978;24(6):615-28.
31. Ikeda S, Negishi T, Nishimura C. Enhancement
of non-specific resistance to viral infection by
muramyldipeptide and its analogs. Antiviral research.
1985;5(4):207-15.
32. Fortier AH, Mock BA, Meltzer MS, Nacy CA.
Mycobacterium bovis BCG-induced protection
against cutaneous and systemic Leishmania major
infections of mice. Infect Immun. 1987;55(7):1707-
14.
33. Weiss DW, Bonhag RS, Deome KB. Protective
activity of fractions of tubercle bacilli against
isologous tumours in mice. Nature. 1961;190:889-91.
34. Howard JG, Biozzi G, Halpern BN, Stiffel C, Mouton
D. The effect of Mycobacterium tuberculosis (BCG)
infection on the resistance of mice to bacterial
endotoxin and Salmonella enteritidis infection. British
journal of experimental pathology. 1959;40(3):281-
90.
35. Halpern BN, Biozzi G, Howard J, Stiffel C, Mouton
D. [Increase of the toxic power of killed Eberthella
typhosa in rats inoculated with living BCG; relation
between this increase of susceptibility and the
functional state of the reticuloendothelial system].
Comptes rendus des seances de la Societe de
biologie et de ses filiales. 1958;152(6):899-902.
36. Suter E, Ullman GE, Hoffman RG. Sensitivity of mice
to endotoxin after vaccination with BCG (Bacillus
Calmette-Guerin). Proceedings of the Society for
Experimental Biology and Medicine Society for
Experimental Biology and Medicine. 1958;99(1):167-
9.
37. Naeslund C. Expérience de vaccination par le bcg
dans la province du norrbotten (suède). Revue de la
Tuberculose1931. p. 617-36.
38. Institut Pasteur (Paris France). Vaccination préventive
de la tuberculose de l’homme et des animaux, par le
BCG; rapports et documents, provenant des divers
pays, la France exceptée, transmis à l’Institut Pasteur
en 1932. Paris,: Masson; 1932. 366 p. p.
39. Shann F. The non-specific effects of vaccines.
Archives of disease in childhood. 2010;95(9):662-7.
40. Shann F. Nonspecific effects of vaccines and the
reduction of mortality in children. Clinical therapeutics.
2013;35(2):109-14.
41. Roth A, Gustafson P, Nhaga A, Djana Q, Poulsen A,
Garly ML, et al. BCG vaccination scar associated
with better childhood survival in Guinea-Bissau.
International journal of epidemiology. 2005;34(3):540-
7.
42. Kristensen I, Aaby P, Jensen H. Routine vaccinations
and child survival: follow up study in Guinea-Bissau,
West Africa. Bmj. 2000;321(7274):1435-8.
43. Garly ML, Martins CL, Bale C, Balde MA, Hedegaard
KL, Gustafson P, et al. BCG scar and positive
tuberculin reaction associated with reduced child
mortality in West Africa. A non-specific beneficial
effect of BCG? Vaccine. 2003;21(21-22):2782-90.
44. Moulton LH, Rahmathullah L, Halsey NA, Thulasiraj
RD, Katz J, Tielsch JM. Evaluation of non-specific
effects of infant immunizations on early infant mortality
in a southern Indian population. Tropical medicine &
international health : TM & IH. 2005;10(10):947-55.
45. Hirve S, Bavdekar A, Juvekar S, Benn CS, Nielsen
J, Aaby P. Non-specific and sex-differential effects of
vaccinations on child survival in rural western India.
Vaccine. 2012;30(50):7300-8.
46. Aaby P, Roth A, Ravn H, Napirna BM, Rodrigues A,
Lisse IM, et al. Randomized trial of BCG vaccination
Non-specific Effects of Vaccines
at birth to low-birth-weight children: beneficial
nonspecific effects in the neonatal period? The
Journal of infectious diseases. 2011;204(2):245-52.
47. Biering-Sorensen S, Aaby P, Napirna BM, Roth A,
Ravn H, Rodrigues A, et al. Small randomized trial
among low-birth-weight children receiving bacillus
Calmette-Guerin vaccination at first health center
contact. The Pediatric infectious disease journal.
2012;31(3):306-8.
48. Stensballe LG, Nante E, Jensen IP, Kofoed PE,
Poulsen A, Jensen H, et al. Acute lower respiratory
tract infections and respiratory syncytial virus in
infants in Guinea-Bissau: a beneficial effect of BCG
vaccination for girls community based case-control
study. Vaccine. 2005;23(10):1251-7.
49. Roth AE, Benn CS, Ravn H, Rodrigues A, Lisse IM,
Yazdanbakhsh M, et al. Effect of revaccination with
BCG in early childhood on mortality: randomised trial
in Guinea-Bissau. Bmj. 2010;340:c671.
50. Gil A, Kenney LL, Mishra R, Watkin LB, Aslan N,
Selin LK. Vaccination and heterologous immunity:
educating the immune system. Transactions of the
Royal Society of Tropical Medicine and Hygiene.
2015;109(1):62-9.
51. Mathurin KS, Martens GW, Kornfeld H, Welsh
RM. CD4 T-cell-mediated heterologous immunity
between mycobacteria and poxviruses. J Virol.
2009;83(8):3528-39.
52. Yang H TW. Nonspecific cytotoxicity of vaccinia-
induced peritoneal exudates in hamsters is mediated
by Thy1.2 homologue-positive cells distinct from
NK cells and macrophages. Journal of Immunology.
6
1983;131(5):2545-50.
53. Lertmemongkolchai G, Cai G, Hunter CA, Bancroft
GJ. Bystander activation of CD8+ T cells contributes
to the rapid production of IFN-gamma in response to
bacterial pathogens. J Immunol. 2001;166(2):1097-
105.
54. Berg RE, Cordes CJ, Forman J. Contribution of CD8+
T cells to innate immunity: IFN-gamma secretion
induced by IL-12 and IL-18. European journal of
immunology. 2002;32(10):2807-16.
55. Berg RE, Crossley E, Murray S, Forman J. Memory
CD8+ T cells provide innate immune protection
against Listeria monocytogenes in the absence
of cognate antigen. The Journal of experimental
medicine. 2003;198(10):1583-93.
56. Hashiguchi T, Oyamada A, Sakuraba K, Shimoda
K, Nakayama KI, Iwamoto Y, et al. Tyk2-dependent
bystander activation of conventional and
nonconventional Th1 cell subsets contributes to
innate host defense against Listeria monocytogenes
infection. J Immunol. 2014;192(10):4739-47.
57. Hu J, August A. Naive and innate memory
phenotype CD4+ T cells have different requirements
for active Itk for their development. J Immunol.
2008;180(10):6544-52.
58. Sanger C, Busche A, Bentien G, Spallek R, Jonas
F, Bohle A, et al. Immunodominant PstS1 antigen
of Mycobacterium tuberculosis is a potent biological
response modifier for the treatment of bladder
cancer. BMC cancer. 2004;4:86.
59. Andersen A, Roth A, Jensen KJ, Erikstrup C, Lisse
IM, Whittle H, et al. The immunological effect of
revaccination with Bacille Calmette-Guerin vaccine
at 19 months of age. Vaccine. 2013;31(17):2137-44.
60. Ho P, Wei X, Seah GT. Regulatory T cells induced
by Mycobacterium chelonae sensitization influence
murine responses to bacille Calmette-Guerin. Journal
of leukocyte biology. 2010;88(6):1073-80.
61. Ota MOC VJ, Schlegel-Haueter SE, Fielding K,
Sanneh M, Kidd M, Newport MJ, Aaby P, Whittle
H, Lambert PH, McAdam KPWJ, Siegrist CA,
Marchant A. Influence of Mycobacterium bovis
Bacillus Calmette-Guerin on Antibody and Cytokine
Responses to Human Neonatal Vaccination. The
Journal of Immunology. 2002(168).
62. Ritz N, Mui M, Balloch A, Curtis N. Non-specific
effect of Bacille Calmette-Guerin vaccine on the
immune response to routine immunisations. Vaccine.
2013;31(30):3098-103.
63. van ‘t Wout JW, Poell R, van Furth R. The role of
BCG/PPD-activated macrophages in resistance
against systemic candidiasis in mice. Scandinavian
journal of immunology. 1992;36(5):713-9.
64. Maddison SE, Chandler FW, McDougal JS,
Slemenda SB, Kagan IG. Schistosoma mansoni
infection in intact and B cell deficient mice: the effect
of pretreatment with BCG in these experimental
models. The American journal of tropical medicine
and hygiene. 1978;27(5):966-75.
65. Parra M, Liu X, Derrick SC, Yang A, Tian J, Kolibab
| 99
Chapter 6
K, et al. Molecular analysis of non-specific protection
against murine malaria induced by BCG vaccination.
PloS one. 2013;8(7):e66115.
66. Kleinnijenhuis J, Quintin J, Preijers F, Joosten LA,
Jacobs C, Xavier RJ, et al. BCG-induced trained
immunity in NK cells: Role for non-specific protection
to infection. Clinical immunology. 2014;155(2):213-9.
67. Semple PL, Watkins M, Davids V, Krensky AM,
Hanekom WA, Kaplan G, et al. Induction of granulysin
and perforin cytolytic mediator expression in 10-week-
old infants vaccinated with BCG at birth. Clinical &
developmental immunology. 2011;2011:438463.
68. Jensen KJ, Larsen N, Biering-Sorensen S, Andersen
A, Eriksen HB, Monteiro I, et al. Heterologous
Immunological Effects of Early BCG Vaccination
in Low-Birth-Weight Infants in Guinea-Bissau:
A Randomized-controlled Trial. The Journal of
infectious diseases. 2014.
69. Suriano F, Santini D, Perrone G, Amato M, Vincenzi
B, Tonini G, et al. Tumor associated macrophages
polarization dictates the efficacy of BCG instillation
in non-muscle invasive urothelial bladder cancer.
Journal of experimental & clinical cancer research :
CR. 2013;32:87.
70. Alam MJ, Rashid MM, Kabir Y, Raqib R, Ahmad SM.
On birth single dose live attenuated OPV and BCG
vaccination induces gut cathelicidin LL37 responses
at 6 week of age: a natural experiment. Vaccine.
2015;33(1):18-21.
71. Buffen K, Oosting M, Quintin J, Ng A, Kleinnijenhuis
J, Kumar V, et al. Autophagy controls BCG-induced
trained immunity and the response to intravesical
BCG therapy for bladder cancer. PLoS pathogens.
2014;10(10):e1004485.
72. Patel D, Simons H. Yellow fever vaccination: is
one dose always enough? Travel Med Infect Dis.
2013;11(5):266-73.
73. Campi-Azevedo AC, de Almeida Estevam P, Coelho-
Dos-Reis JG, Peruhype-Magalhaes V, Villela-
Rezende G, Quaresma PF, et al. Subdoses of 17DD
yellow fever vaccine elicit equivalent virological/
immunological kinetics timeline. BMC Infect Dis.
2014;14:391.
74. Fisker AB, Ravn H, Rodrigues A, Ostergaard MD,
Bale C, Benn CS, et al. Co-administration of live
measles and yellow fever vaccines and inactivated
pentavalent vaccines is associated with increased
mortality compared with measles and yellow fever
vaccines only. An observational study from Guinea-
Bissau. Vaccine. 2014;32(5):598-605.
75. Silva ML, Martins MA, Espirito-Santo LR, Campi-
Azevedo AC, Silveira-Lemos D, Ribeiro JG, et al.
Characterization of main cytokine sources from the
innate and adaptive immune responses following
primary 17DD yellow fever vaccination in adults.
Vaccine. 2011;29(3):583-92.
76. Martins MA, Silva ML, Eloi-Santos SM, Ribeiro
JG, Peruhype-Magalhaes V, Marciano AP, et al.
Innate immunity phenotypic features point toward
simultaneous raise of activation and modulation
events following 17DD live attenuated yellow fever
first-time vaccination. Vaccine. 2008;26(9):1173-84.
77. Neves PC, Matos DC, Marcovistz R, Galler R. TLR
expression and NK cell activation after human yellow
fever vaccination. Vaccine. 2009;27(41):5543-9.
78. Tai LH, Zhang J, Scott KJ, de Souza CT, Alkayyal AA,
Ananth AA, et al. Perioperative influenza vaccination
reduces postoperative metastatic disease by
reversing surgery-induced dysfunction in natural killer
cells. Clinical cancer research : an official journal of
the American Association for Cancer Research.
2013;19(18):5104-15.
79. Bruni D, Chazal M, Sinigaglia L, Chauveau L,
Schwartz O, Despres P, et al. Viral entry route
determines how human plasmacytoid dendritic
cells produce type I interferons. Science signaling.
2015;8(366):ra25.
80. Cao W, Manicassamy S, Tang H, Kasturi SP, Pirani
A, Murthy N, et al. Toll-like receptor-mediated
induction of type I interferon in plasmacytoid
dendritic cells requires the rapamycin-sensitive PI(3)
K-mTOR-p70S6K pathway. Nature immunology.
2008;9(10):1157-64.
81. Gaucher D, Therrien R, Kettaf N, Angermann
BR, Boucher G, Filali-Mouhim A, et al. Yellow
fever vaccine induces integrated multilineage and
polyfunctional immune responses. The Journal of
experimental medicine. 2008;205(13):3119-31.
82. Engelmann F, Josset L, Girke T, Park B, Barron A,
Dewane J, et al. Pathophysiologic and transcriptomic
analyses of viscerotropic yellow fever in a rhesus
macaque model. PLoS neglected tropical diseases.
100 |
2014;8(11):e3295.
83. Scherer CA, Magness CL, Steiger KV, Poitinger ND,
Caputo CM, Miner DG, et al. Distinct gene expression
profiles in peripheral blood mononuclear cells from
patients infected with vaccinia virus, yellow fever
17D virus, or upper respiratory infections. Vaccine.
2007;25(35):6458-73.
84. Querec TD, Akondy RS, Lee EK, Cao W, Nakaya
HI, Teuwen D, et al. Systems biology approach
predicts immunogenicity of the yellow fever vaccine
in humans. Nature immunology. 2009;10(1):116-25.
85. Klein SL, Jedlicka A, Pekosz A. The Xs and Y of
immune responses to viral vaccines. Lancet Infect
Dis. 2010;10(5):338-49.
86. Couch RB. Seasonal inactivated influenza virus
vaccines. Vaccine. 2008;26 Suppl 4:D5-9.
87. Leentjes, J., Kox, M., Stokman, R., Gerretsen, J.,
Diavatopoulos, D., Rimmelzwaan, G. F., Picckers,
P., Netea M. G. (2014) BCG-vaccination enhances
immunogenicity of subsequent influenza vaccination
in healthy volunteers: a randomized placebo-
controlled double-blind pilot study. Submitted.
88. Mohanty S, Joshi SR, Ueda I, Wilson J, Blevins
TP, Siconolfi B, et al. Prolonged Proinflammatory
Cytokine Production in Monocytes Modulated by
Interleukin 10 After Influenza Vaccination in Older
Adults. The Journal of infectious diseases. 2014.
89. Lanthier PA, Huston GE, Moquin A, Eaton SM, Szaba
FM, Kummer LW, et al. Live attenuated influenza
vaccine (LAIV) impacts innate and adaptive immune
responses. Vaccine. 2011;29(44):7849-56.
90. Geeraedts F, Goutagny N, Hornung V, Severa M,
de Haan A, Pool J, et al. Superior immunogenicity
of inactivated whole virus H5N1 influenza vaccine
is primarily controlled by Toll-like receptor signalling.
PLoS pathogens. 2008;4(8):e1000138.
91. Jost S, Reardon J, Peterson E, Poole D, Bosch R,
Alter G, et al. Expansion of 2B4+ natural killer (NK)
cells and decrease in NKp46+ NK cells in response
to influenza. Immunology. 2011;132(4):516-26.
92. Kennedy RB, Ovsyannikova IG, Jacobson RM,
Poland GA. The immunology of smallpox vaccines.
Current opinion in immunology. 2009;21(3):314-20.
93. Aaby P, Gustafson P, Roth A, Rodrigues A, Fernandes
M, Sodemann M, et al. Vaccinia scars associated
with better survival for adults. An observational study
from Guinea-Bissau. Vaccine. 2006;24(29-30):5718-
25.
94. Jensen ML DS, van der Loeff MS, da Costa C, Vincent
T, et al. Vaccinia scars associated with improved
survival among adults in rural Guinea-Bissau. PloS
one. 2006;1(1):e101.
95. Lankes HA, Fought AJ, Evens AM, Weisenburger DD,
Chiu BC. Vaccination history and risk of non-Hodgkin
lymphoma: a population-based, case-control study.
Cancer causes & control : CCC. 2009;20(5):517-23.
96. Pfahlberg A, Kolmel KF, Grange JM, Mastrangelo
G, Krone B, Botev IN, et al. Inverse association
between melanoma and previous vaccinations
against tuberculosis and smallpox: Results of the
FEBIM study. Journal of Investigative Dermatology.
2002;119(3):570-5.
97. Krone B, Kolmel KF, Henz BM, Grange JM.
Protection against melanoma by vaccination with
Bacille Calmette-Guerin (BCG) and/or vaccinia: an
epidemiology-based hypothesis on the nature of a
melanoma risk factor and its immunological control.
Eur J Cancer. 2005;41(1):104-17.
98. Yang H CC, Woan MC, Tompkins WAF. Evaluation of
hamster natural cytotoxic cells and vaccinia induced
cytotoxic cells for Thy1.2-homologue by using a
mouse monoclonal α-Thy1.2 antibody. Journal of
Immunology. 1982;129(5):2239-43.
99. Carpenter EA RJ, Ramshaw IA. IFN-y, TNF, and IL-6
Production by Vaccinia Virus Immune Spleen Cells.
The Journal of Immunology. 1994(152):2652.
100. Deng L, Dai P, Ding W, Granstein RD, Shuman S.
Vaccinia virus infection attenuates innate immune
responses and antigen presentation by epidermal
dendritic cells. J Virol. 2006;80(20):9977-87.
101. Yao Y, Li P, Singh P, Thiele AT, Wilkes DS,
Renukaradhya GJ, et al. Vaccinia virus infection
induces dendritic cell maturation but inhibits antigen
presentation by MHC class II. Cellular immunology.
2007;246(2):92-102.
102. Schleupner CJ, Glasgow LA. Peritoneal macrophage
activation indicated by enhanced chemiluminescence.
Infect Immun. 1978;21(3):886-95.
103. Price PJ, Torres-Dominguez LE, Brandmuller C,
Sutter G, Lehmann MH. Modified Vaccinia virus
Ankara: innate immune activation and induction of
cellular signalling. Vaccine. 2013;31(39):4231-4.
 Non-specific Effects of Vaccines

104. Yanez A, Hassanzadeh-Kiabi N, Ng MY, Megias J, immunization is associated with increased

Subramanian A, Liu GY, et al. Detection of a TLR2 expression of different innate immune regulatory
agonist by hematopoietic stem and progenitor receptors. Clinical and vaccine immunology : CVI.
cells impacts the function of the macrophages 2012;19(7):1005-11.
they produce. European journal of immunology. 123. Aaby P, Garly ML, Nielsen J, Ravn H, Martins C,
2013;43(8):2114-25. Bale C, et al. Increased female-male mortality ratio
105. Bautista-Lopez N, Ward BJ, Mills E, McCormick D, associated with inactivated polio and diphtheria-
Martel N, Ratnam S. Development and durability tetanus-pertussis vaccines: Observations from
of measles antigen-specific lymphoproliferative vaccination trials in Guinea-Bissau. The Pediatric
response after MMR vaccination. Vaccine. infectious disease journal. 2007;26(3):247-52.
2000;18(14):1393-401. 124. Aaby P, Benn C, Nielsen J, Lisse IM, Rodrigues
106. Aaby P, Martins CL, Garly ML, Bale C, Andersen A, A, Ravn H. Testing the hypothesis that diphtheria-
Rodrigues A, et al. Non-specific effects of standard tetanus-pertussis vaccine has negative non-specific
measles vaccine at 4.5 and 9 months of age on and sex-differential effects on child survival in high-
childhood mortality: randomised controlled trial. Bmj. mortality countries. BMJ open. 2012;2(3).
2010;341:c6495. 125. Rodrigues A, Fischer TK, Valentiner-Branth P, Nielsen
107. Aaby P, Martins CL, Garly ML, Rodrigues A, Benn CS, J, Steinsland H, Perch M, et al. Community cohort
Whittle H. The optimal age of measles immunisation study of rotavirus and other enteropathogens: are
in low-income countries: a secondary analysis of routine vaccinations associated with sex-differential
the assumptions underlying the current policy. BMJ incidence rates? Vaccine. 2006;24(22):4737-46.
open. 2012;2(4). 126. Valentiner-Branth P, Perch M, Nielsen J, Steinsland
108. Martins CL, Benn CS, Andersen A, Bale C, Schaltz- H, Garly ML, Fischer TK, et al. Community cohort
Buchholzer F, Do VA, et al. A randomized trial of study of Cryptosporidium parvum infections: sex-
a standard dose of Edmonston-Zagreb measles differential incidences associated with BCG and
vaccine given at 4.5 months of age: effect on total diphtheria-tetanus-pertussis vaccinations. Vaccine.
hospital admissions. The Journal of infectious 2007;25(14):2733-41.
diseases. 2014;209(11):1731-8. 127. Fischer JE, Johnson JE, Johnson TR, Graham BS.
109. Bottomley C, Bojang A, Smith PG, Darboe O, Antonio Pertussis toxin sensitization alters the pathogenesis
M, Foster-Nyarko E, et al. The impact of childhood of subsequent respiratory syncytial virus infection.
vaccines on bacterial carriage in the nasopharynx: a Journal of Infectious Diseases. 2000;182(4):1029-38.
longitudinal study. Emerging themes in epidemiology.
2015;12(1):1.
128. (WHO) WHO. Meeting of the Strategic advisory group
of experts on immunization, april 2014 – conclusions
6
110. Avota E, Gassert E, Schneider-Schaulies S. Measles and recommendations. Weekly Epidemiological
virus-induced immunosuppression: from effectors to Record (WER). 2014;21(89):221-36.
mechanisms. Medical microbiology and immunology.
2010;199(3):227-37.
111. de Vries RD, McQuaid S, van Amerongen G, Yuksel
S, Verburgh RJ, Osterhaus AD, et al. Measles
immune suppression: lessons from the macaque
model. PLoS pathogens. 2012;8(8):e1002885.
112. Hahm B, Cho JH, Oldstone MB. Measles virus-
dendritic cell interaction via SLAM inhibits innate
immunity: selective signaling through TLR4 but not
other TLRs mediates suppression of IL-12 synthesis.
Virology. 2007;358(2):251-7.
113. Indoh T, Yokota S, Okabayashi T, Yokosawa N, Fujii
N. Suppression of NF-kappaB and AP-1 activation
in monocytic cells persistently infected with measles
virus. Virology. 2007;361(2):294-303.
114. Bieback K, Lien E, Klagge IM, Avota E, Schneider-
Schaulies J, Duprex WP, et al. Hemagglutinin protein
of wild-type measles virus activates toll-like receptor
2 signaling. J Virol. 2002;76(17):8729-36.
115. Tanabe M K-TM, Takeuchi K, Takeda M, Ayata
M, Ogura H, Matsumoto M, Seya T. Mechanism
of up-regulation of human Toll-like receptor 3
secondary to infection of measles virus-attenuated
strains. Biochemical and Biophysical Research
Communications. 2003;311:39-48.
116. Shingai M ET, Begum NA, Kato A, Honma T,
Matsumoto K, Saito H, Ogura H, Matsumoto M,
Seya T. Differential Type I IFN-Inducing Abilities of
Wild-Type versus Vaccine Strains of Measles Virus. J
Immunol. 2007;176:6123-33.
117. Clifford HD, Yerkovich ST, Khoo SK, Zhang G, Upham
J, Le Souef PN, et al. TLR3 and RIG-I gene variants:
associations with functional effects on receptor
expression and responses to measles virus and
vaccine in vaccinated infants. Human immunology.
2012;73(6):677-85.
118. Ovsyannikova IG, Reid KC, Jacobson RM, Oberg AL,
Klee GG, Poland GA. Cytokine production patterns
and antibody response to measles vaccine. Vaccine.
2003;21(25-26):3946-53.
119. Pabst HF, Spady DW, Carson MM, Stelfox HT,
Beeler JA, Krezolek MP. Kinetics of immunologic
responses after primary MMR vaccination. Vaccine.
1997;15(1):10-4.
120. Hussey GD GE, Hughes J, Ryon JJ, Kerran M,
Carelse E, Strebel PM, Markowitz LE, Moodie J,
Barron P, Latief Z, Sayed R, Beatty D, Griffin DE. The
effect of Edmonston-Zagreb and Schwarz measles
vaccines on immune responses in infants. Journal of
Infectious Disease. 1996(173):1320.
121. Jensen KJ, Sondergaard M, Andersen A, Sartono
E, Martins C, Garly ML, et al. A randomized trial of
an early measles vaccine at 4(1/2) months of age
in Guinea-Bissau: sex-differential immunological
effects. PloS one. 2014;9(5):e97536.
122. Colmenares V, Noyola DE, Monsivais-Urenda
A, Salgado-Bustamante M, Estrada-Capetillo L,
Gonzalez-Amaro R, et al. Human papillomavirus

| 101
 Part II

Immunometabolic Pathways
in Trained Immunity
 Chapter 7

Immunometabolic pathways in BCG-

induced trained immunity

Rob J.W. Arts, Agostinho Carvalho, Claudia La Rocca, Carla Palma, Fernando
Rodrigues, Ricardo Silvestre, Johanneke Kleinnijenhuis, Ekta Lachmandas, Luís
G. Gonçalves, Ana Belinha, Cristina Cunha, Marije Oosting, Leo A.B. Joosten,
Giuseppe Matarese, Reinout van Crevel, Mihai G. Netea.

Cell Reports 2016;17:1-10

Chapter 7

ABSTRACT

The protective effects of the tuberculosis vaccine BCG on unrelated infections are
thought to be mediated by long-term metabolic and epigenetic reprogramming of
innate immune cells such as the monocytes, a process termed trained immunity.
Here we show that BCG induction of trained immunity in monocytes is accompanied
by a strong increase in glycolysis and to a lesser extent glutamine metabolism, both
in an in-vitro model and after vaccination of mice and humans. Pharmacological
and genetic modulation of rate-limiting glycolysis enzymes inhibits trained immunity,
changes which are reflected by effects on the histone marks (H3K4me3 and
H3K9me3) underlying BCG-induced trained immunity. These data demonstrate that
a shift of the glucose metabolism towards glycolysis is crucial for the induction of
the epigenetic and functional changes underlying BCG-induced trained immunity.
The identification of these pathways may be a first step towards novel vaccines that
combine immunological and metabolic stimulation.

106 |
 Immunometabolism and BCG

The live-attenuated Bacillus Calmette-Guérin (BCG) vaccine confers protection

against severe forms of Mycobacterium tuberculosis infection, whilst having a limited
effect against pulmonary tuberculosis (1, 2). In addition to its effects on tuberculosis,
it has also been shown that vaccination with BCG leads to non-specific protective
effects against non-related infections and mortality. In observational studies in West
Africa it was shown that the presence of a BCG scar or PPD positivity are associated
with reduced child mortality (3, 4). Furthermore, in two randomized controlled trials,
early administration of BCG vaccination reduced child mortality, mainly as a result
of less neonatal sepsis and lower respiratory infections (5-7). BCG is also used
to treat bladder cancer and appears to be beneficial in several other diseases,
such as warts, leishmaniasis and asthma (8-10). As further proof of its non-specific
protective effects, BCG was shown to protect mice against lethal candidiasis (11),
and interestingly, this protective effect was also present in SCID mice, therefore
showing that this non-specific protection is T- and B-cell independent (12). It was
found that these effects are mediated by functional and epigenetic reprogramming
of innate immune cells such as monocytes, macrophages and NK-cells, a process
7
termed ‘trained immunity’ (13, 14).
We have recently demonstrated that induction of trained immunity by fungal
components such as β-glucan leads to a shift of cellular metabolism from oxidative
phosphorylation towards glucose fermentation (15, 16). This is a process mediated
through the Akt/mTOR/HIF-1α pathway that is crucial for an effective induction of
trained immunity (15, 16). Similar observations on the importance of metabolic
changes during immune cells activation have been made by others: pro-inflammatory
(e.g. M(IFNγ)) macrophages are characterized by increased glycolysis and lactate
production, whereas the more anti-inflammatory (e.g. M(IL-4)) macrophages seem to
rely on oxidative phosphorylation, fatty acid uptake and β-oxidation (17). In contrast
monocytes from patients suffering from sepsis-induced immunoparalysis show
reduced pro-inflammatory cytokine production with a defective capacity to mount
glycolysis and β-oxidation (18).
So far however, no data have been reported regarding cellular metabolism in
BCG-induced trained immunity. In this study we have used in-vitro and in-vivo (both
mice and human) models of trained immunity (12) to assess the changes in cellular
metabolism pathways that underlie BCG-induced trained immunity and its effects
on cytokines and epigenetic (histone) changes. Deciphering the role of metabolic
pathways for the non-specific effects of BCG vaccination may lead to a better
understanding of the induction of trained immunity and how modulation of cellular
metabolism pathways may be used to boost the effect of vaccines.

| 107
Chapter 7

MATERIALS AND METHODS

Monocyte isolation and training experiments - Buffy coats from healthy donors
were obtained after written informed consent (Sanquin blood bank, Nijmegen, The
Netherlands and Hospital de Braga, Braga, Portugal). PBMC isolation was performed
by dilution of blood in pyrogen-free PBS and differential density centrifugation
over Ficoll-Paque (GE healthcare, UK). Cells were washed twice in PBS and
resuspended in RPMI culture medium (Roswell Park Memorial Institute medium;
Invitrogen, CA, USA) supplemented with 50μg/ml gentamicin, 2mM Glutamax
(Gibco), and 1mM pyruvate (Gibco). In some experiments glutamax was replaced
with 2mM or 1mM L-glutamin (Sigma-Aldrich, St. Louis, MO, USA). Subsequently
monocyte isolation was performed by hyperosmotic density gradient centrifugation
over Percoll (Sigma). Afterwards cells were washed once with PBS. Monocytes
were counted and adjusted to 1×10^6 cells/ml. A 100μl volume was added to flat
bottom 96-well plates (Corning, NY, USA) and cells were let to adhere for 1h at 37oC;
subsequently a washing step with 200μl warm PBS was performed to yield maximal
purity. Monocytes were incubated with culture medium only as a negative control or
5μg/ml of BCG (SSI, Denmark) for 24h (in 10% pooled human serum). Cells were
washed once with 200μl of warm PBS and rested for 5 days in culture medium with
10% human pooled serum. Medium was changed once on day 3 of incubation. On
day 6, cells were restimulated for 24h with 200μl RPMI, or Escherichia coli LPS
(serotype 055:B5, Sigma-Aldrich, 10 ng/ml, after which supernatants were collected
and stored at -20oC. In some experiments, cells were pre-incubated (before BCG
training) for 1h with 100nM Wortmannin (Sigma), 10nM rapamycin (Sigma), 50μM
BPTES (Sigma), 100μM 6-aminonicotinamide (Sigma), 11mM 2-deoxyglucose
(Sigma), 0,3mM metformin, 3μM potassium dichloroacetate (DCA, Sigma), 1mM
AICAR (5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside, Brunschwig
chemie), 10nM torin 1 (R&D systems, MN, USA), 1μM oligomycin (Sigma).
Cytokine, lactate, glucose, and NAD+ measurements - Cytokine production was
determined in supernatants using commercial ELISA kits for TNFα (R&D systems)
and IL-6 (Sanquin, Amsterdam, The Netherlands) following the instructions of the
manufacturer. Lactate, glucose and NAD+/NADH concentrations were measured
using Fluorometric Quantification Assay Kits (Biovision, CA, USA).
Metabolite measurements - 10x10^6 Monocytes were trained in 10cm-Petri dishes
(Greiner) in 10ml-medium volumes. At day 6 cells were detached from the plate with
versene (Life Technologies) and counted. At least 1 million cells were lysed in 60μl
0.5% Triton-X in PBS. Metabolite concentrations were determined by assay kits for
fumarate, glutamate, malate, or acetyl-CoA (all Sigma) following the instruction of
the manufacturer.
Western blots - Monocytes were cultured as described above and after 4h (Akt) or

108 |
 Immunometabolism and BCG

6 days (mTOR) cells were lysed and stored at -80oC. Total protein amounts were
determined by BCA assay (Thermo Fisher Scientific) and equal amounts of proteins
were loaded on precasted 4-15% gels (Biorad, CA, USA). The separated proteins
were transferred to a nitrocellulose membrane (Biorad), which was blocked in 5%
BSA (Sigma). Incubation overnight at 4oC with rabbit polyclonal antibodies against
p-Akt, p-mTOR, p-S6K, p-4EBP1 (Cell Signaling, Danvers, MA, USA), and actin
(Sigma) were used to determine the protein expression, which was visualized using
a polyclonal secondary antibody (Dako, Belgium) and SuperSignal West Femto
Substrate (Thermo Fisher Scientific) or ECL (Biorad).
mRNA extraction and RT-PCR - Cells were cultured as described above. On day 6
mRNA was extracted by Trizol (Life technologies), according to the manufacturer’s
instruction and cDNA was synthesized using iScript reverse transcriptase (Invitrogen).
Relative expression was determined using SYBR Green method (Invitrogen) on an
Applied Biosciences Step-one PLUS qPCR machine and the values are expressed
as fold increases in mRNA levels, relative to those in non-trained cells, with HPRT
as a housekeeping gene. Primers are listed in Table S1.
7
Chromatin immunoprecipitation - 10x10^6 Monocytes were trained in 10cm-
Petri dishes (Greiner) in 10ml-medium volumes. Cells were isolated and trained as
described above. After resting for 5 days in culture medium, the cells were harvested
and fixed in 1% methanol-free formaldehyde. Afterwards, cells were sonicated
and immunoprecipitation was performed using antibodies against H3K4me3 and
H3K9me3 (Diagenode, Seraing, Belgium). DNA was isolated with a MinElute PCR
purification kit (Quiagen) and was further processed for qPCR analysis using the
SYBR green method. Samples were analyzed by a comparative Ct method according
to the manufacturer’s instructions. The primers are listed in Table S1.
Assessment of glycolysis and oxygen consumption by Seahorse methodology
- 10x10^6 Monocytes were trained in 10cm-Petri dishes (Greiner) in 10ml-medium
volumes as described above and after 6 days detached with Versene (ThermoFisher
Scientific) from the culture plates. 1x10^5 cells in triplicate were plated to overnight-
calibrated cartridges in assay medium (RPMI with 0.6mM glutamine, pH adjusted
to 7.4. For OCR also 5mM glucose and 1mM pyruvate was added) and incubated
for 1h in a non-CO2 corrected incubator at 37oC. Oxygen consumption rate (OCR)
and extracellular acidification rate (ECAR) were analysed using a cell mito stress
(OCR) or glycolysis stress test (ECAR) kit in a XFp analyser (Seahorse bioscience,
Copenhagen, Denmark) with final concentrations of 1μM oligomycin, 1μM FCCP,
0,5μM Rotenone/Antimycin A, 10mM glucose, and 50mM 2-DG.
For mouse ex-vivo Seahorse analyses, splenocytes were collected from either
BCG-vaccinated or control mice and plated 4x10^5 cells/well in RPMI medium
supplemented with 10% FBS. At 12h cell were analysed with a 96XFe analyser to

| 109
Chapter 7

assess ECAR and OCR as above described.

Animal experiments - This article conforms to the relevant ethical guidelines
for animal research. The research was approved by the institutional animal care
committee of the Italian Ministry of Health (N° 220/2010-B) and the handling of mice
was conducted in compliance with European Community Directive 86/609 and the
U.S. Association for Laboratory Animal Care recommendations for the care and use
of laboratory animals.
Briefly, C57BL/6 female mice were supplied as specific pathogen-free mice by
Charles River (Calco, Lecco, Italy) and were maintained in specific-pathogen-free
conditions. Food and water were available ad libitum. Five week-old mice were
vaccinated or not with a single dose of BCG (5x10^6 CFU in 200µl PBS) injected
i.v. Five mice were used for each experimental mouse group. Seven days after BCG
vaccination, mice were sacrificed by cervical dislocation, according to the ethics
requirements and spleens were aseptically collected. Single cell suspension were
prepared in PBS by mechanic dissociation (Gentle Macs dissociator) and applied
to Falcon 2360 cell strainers (BD Discovery Labware, San Diego, CA) before to be
used in Seahorse experiments.
NMR and amino acid experiments - Amino acids were quantified by high-
performance liquid chromatography (HPLC) in a Gilson UV/vis_155 detector (338nm)
after precolumn derivatization with ortho-phthalaldehyde (OPA with methanol
≥99.9%, potassium borate 1M pH=9.5, and 2-mercaptoethanol ≥99.0%) 1:5 (Sigma
Aldrich). Culture supernatants were filtered by Acrodisc 13mm syringe filters with
0.2μm supor membrane (Pall Corporations, USA). Inorganic mobile phase pH=7.8
was composed by Na2HPO4.2H2O3 50mM:propionic acid 250mM (1:1) mixture
(Merck, Germany) with acetonitrile HPLC grade in water (10:2:13). Organic mobile
phase was composed by acetonitrile, methanol and water (3:3:4) (HPLC grade,
HiPerSolv Chromanorm, VWR Chemicals, USA). All mobile phases for elution were
degasified for 30 minutes previously to analysis. Amino acids were quantified using
the Gilson Uniprot Software, version 5.11 accordingly to standard solutions were
prepared in MilliQ water (Millipore, Germany).
For NMR spectroscopy, methanol/water extracts and cell culture supernatants
were analyzed. The aqueous and chloroform extracts were dried in a SpeedVac
Plus system. The aqueous extract was suspended in 600μL D2O with 0.262mM of
TSP-d4 as chemical shift indicator and the organic extract in 600 μL CD3Cl. To
550μL of cell culture media were added 50μL D2O, with a TSP-d4 final concentration
of 0.262mM.
The samples were analyzed at 25°C by 1H-NMR and by 2D 13C-1H- heteronuclear
single quantum coherence (HSQC) spectroscopy in a UltrashiedTM 800 Plus
(Bruker) operating at 800.33MHz, equipped with a TXI-Z H C/N/-D (5mm) probe.

110 |
 Immunometabolism and BCG

The 1H-NMR pulse sequence used has a NOESY-presaturation (noesygppr1d) with

irradiation at the water frequency (ns 124, TD 64K, SW 20 ppm, d1 4s, d8 0.01s);
while in the 13C-1H-HSQC was used the hsqcetgpsisp2 pulse sequence (ns 16, TD1
512, TD2 2K, SW2 16ppm, SW1 165ppm, d1 1s). The chemical shifts in aqueous
sample were referred to TSP. Spectra were acquired and processed using TopSpin
3.2 software (Bruker); assignments were made by comparison with chemical shifts
found in the literature for metabolic intermediates and Human Metabolome Database
(www.hmdb.ca). The quantifications of the signals were performed by integration of
the peaks in the 1H-NMR spectra and of the volumes in the 13C-1H-HSQC spectra,
using the resonance due to the TSP as reference.
Ex-vivo studies in humans - BCG vaccination trial: Twenty healthy volunteers
were vaccinated with the BCG vaccine (SSI, Denmark) after informed consent was
obtained. Before and two weeks and three months after vaccination, blood was
drawn and PBMCs were isolated and ex vivo stimulated with M. tuberculosis, S.
aureus, or C. albicans. 24h supernatants were used to determine lactate production
and PBMCs stored in Trizol to determine gene expression. The study was approved
7
by the Arnhem-Nijmegen medical ethical committee (NL31936.091.10). Primary end
points and detailed methods were published before (12).
Metformin clinical trial: Twelve healthy non-obese volunteers with good kidney
function and devoid of metabolic disorders received increasing amounts of metformin
for a total of five days (1000mg on day 1, 2000mg on day 6). Blood sampling was
performed one day before start of metformin (day 0), directly after metformin intake
(day 6), on day 9 and on day 20 for ex-vivo training of isolated monocytes. The study
was approved by the Arnhem-Nijmegen medical ethical committee (NL47793.091.14).
Both studies were conducted in accordance with the Helsinki Declaration.
Genetic analysis - For the genetic studies, we investigated genetic variation in
two cohorts of healthy Dutch volunteers described previously (19-21): one cohort
of 65 volunteers (cohort 1) collected in 2011, and a second cohort of 49 volunteers
collected in 2015 (cohort 2). In both cohorts we performed ex-vivo trained immunity
experiments. Volunteers were between 23-73 years old, and consisted of 77% males
and 23% females. Monocytes were cultured in vitro as described above. SNPs in the
database for MTOR, HK2, PFKP, GLS and GLUD1/2 were selected to analyze their
effect on IL-6 and TNFα production upon LPS restimulation after BCG training. SNP
information was extracted from a genome-wide Illumina Infinium single-nucleotide
polymorphism (SNP) array (22). Linkage disequilibrium was calculated according to
the methods of Machiela and Chanock. (23)
Statistics - Ex-vivo and in-vitro monocyte experiments were performed at least 6
times and analyzed using a Wilcoxon signed-rank test or one-way Anova, where
applicable. A P-value below 0.05 was considered statistically significant. All data

| 111
Chapter 7

were analyzed using Graphpad prism 5.0 (La Jolla, CA, USA). * p < 0.05, ** p < 0.01.
Data are shown as means ± SEM.

RESULTS
Glucose is a main energy source for BCG-trained monocytes
To assess glycolytic rate, a well-established in-vitro method of trained immunity was
used (12, 24). Human monocytes were incubated for 24h with BCG or RPMI as
a medium control, and restimulated after a subsequent 5 days of rest with LPS
(or RPMI) for 24h (Figure 1A). Glycolytic rate was assessed by measuring glucose
consumption from the medium, lactate production was used to measure the
fermentative capacity, 24h after LPS stimulation. Both glucose consumption and
lactate release were increased, reflecting induction of glycolysis (Figure 1B). The
ratio of lactate:glucose in BCG-trained macrophages was close to two, suggesting
that these cells use glucose as the major source of lactate, whereas in non-trained
macrophages (showing a higher ratio) other substrates were used as well (Figure
1B, S1). As further proof, priming with BCG significantly increased incorporation of
13
C in lactate during the 24h of restimulation with LPS (Figure 1B, S2A,B), while
incubating with 13C-labed glucose. Incorporation of 13C-labels was also increased
in rybosyl-1, which is suggestive of an induction of the pentose phosphate pathway
(Figure S2C). Assessment of BCG-trained monocytes on day 6 (prior to restimulation)
using Seahorse technology showed an increased basal and maximal extracellular
acidification rate (ECAR), as a measure of lactate production. Interestingly however,
the oxygen consumption rate (OCR, as a measure for oxidative phosphorylation)
was also increased (Figure 1C, S3A). This is different compared to β-glucan trained
macrophages, which have shown a classical Warburg effect (with increased glycolysis
and decreased oxidative phosphorylation) (16). These data were validated in mice,
where BCG led to an upregulation of ECAR and OCR in splenocytes one week after
vaccination (Figure 1D, S3B).
Besides glucose, other metabolites can be used for energy and carbon
metabolism. We therefore assessed amino acid utilization at several time points,
Figure 1 – Role of glucose metabolism for the induction of BCG-induced trained immunity. (A)
Graphical outline of the in-vitro methods. (B) Monocytes were incubated for 24h with culture medium
or BCG, then let to rest for 2 days and stimulated for 24h with LPS in medium with 13C-labeled glucose.
Glucose consumption from the medium, lactate production, and their ratios were determined. Also
incorporation of the 13C-label in lactate was determined (n=3, * p < 0.05, student t test). (C) Monocytes
were incubated for 24h with culture medium or BCG. At day 6 (prior to restimulation) extracellular
acidification rate (ECAR) and oxygen consumption rate (OCR) were determined by Seahorse. (n=6, * p
< 0.05, Wilcoxon signed-rank test). (D) Mice were vaccinated with BCG. After 7 days splenocytes were
isolated and ECAR and OCR were determined by Seahorse. (n=6, * p < 0.05, ** p < 0.01, Mann-Whitney
U test). (E) Monocytes were incubated for 24h with culture medium or BCG. At day 6 (prior to restimulation)
intracellular concentrations of glutamate, fumarate, malate and acetyl-CoA were determined. (n=6, * p <
0.05, Wilcoxon signed-rank test).

112 |
 Immunometabolism and BCG

 

 
 

  

 

 











  
       

     


 
 

 
 

 

 




7




 
   

 
  
    

       

       
  
 
 
   
 
  
 
 
 

 

 

 

 
 



    
 
   
 
 
   
 

       

 Glucose Pyruvate Acetyl CoA

Lactate






  

  

GLYCOLYSIS  
Citrate

 

Malate  

TCA CYCLE  

  

  
Fumarate  
α-keto

  

  

Succinate glutarate 







GLUTAMINE Glutamine Glutamate
METABOLISM  

| 113
Chapter 7

but none were significantly increased (Figure S4). Interestingly, intracellular

concentrations of glutamate and malate (but not fumarate), metabolites that can be
produced from glutamine, were increased. In contrast, concentrations of acetyl CoA,
a central metabolite linking glycolysis and fatty acid metabolism with TCA cycle,
were not modulated by BCG training (Figure 1E).

Metabolic changes and trained immunity are dependent on activation of the

Akt/mTOR pathway
We previously showed that the shift towards a higher glycolytic rate in β-glucan-
induced trained monocytes is dependent on the Akt/mTOR pathway (16). Supporting
a similar pathway in BCG-induced trained immunity, we found that monocytes that
were primed for 2h with BCG showed an increased Akt phosphorylation (Figure
2A). Inhibition of Akt by wortmannin during the first 24h of BCG training abrogated
the increase in cytokine production by LPS restimulation at day 6, confirming the
essential role of Akt for induction of trained immunity (Figure 2B). BCG-induced
training of monocytes also led to phosphorylation of mTOR and its targets S6K and
4EPB1 as determined at day 6 (Figure 2C), and inhibition of mTOR and glycolysis
by rapamycin, torin, AICAR, and 2-deoxyglucose during BCG training abrogated
the increased cytokine production (Figure 2D). Similar effects were observed with
addition of metformin that has more broad metabolic effects on both glycolysis and
oxidative phosphorylation (Figure 2D). Addition to the medium of dichloroacetate
(DCA), which inhibits pyruvate dehydrogenase kinases and thus shifts glucose
metabolism towards the TCA cycle (25)) abrogated induction of cytokine production.
In contrast, the inhibition of the electron transport chain by the complex V inhibitor
oligomycin did not have an effect on the induction of trained immunity (Figure 2E).
Inhibition of glutamine metabolism by BPTES also abrogated cytokine production
(Figure 2F). Decreasing glutamine concentration in the medium also inhibited
induction of cytokine production after restimulation with LPS (Figure 2G), showing
Figure 2 – Akt/mTOR activation and induction of BCG-induced trained immunity. (A) Monocytes
were incubated for 2h with BCG or medium control and phosphorylated Akt was assessed by Western
Blot and quantified. (n=5, * p < 0.05, Wilcoxon signed-rank test). (B) Monocytes were incubated for 24h
with culture medium or BCG, with or without wortmannin. At day 6, after restimulation with LPS, IL-6 and
TNFα concentrations in the supernatants were measured. (n=6, * p < 0.05, Wilcoxon signed-rank test).
(C) Monocytes were incubated for 24h with culture medium or BCG. At day 6 (prior to restimulation)
phosphorylation of mTOR, S6K, and 4EBP1 was assessed by Western Blot and quantified. (n=5, * p <
0.05, Wilcoxon signed-rank test). (D-F) Monocytes were incubated for 24h with culture medium or BCG,
with or without the metabolic modulators of glycolysis/mTOR (D), TCA/OxPhos (E), glutamine metabolism
or PPP (F). At day 6, IL-6 and TNFα production were determined in the supernatants after restimulation
with LPS. (n=6, * p < 0.05, Wilcoxon signed-rank test). (G) Monocytes were incubated for 24h with culture
medium or BCG. Culture media with 2, 1, or 0 mM of L-glutamine were used. At day 6, IL-6 and TNFα
production in the supernatants were determined after restimulation with LPS. (n=6, * p < 0.05, Wilcoxon
signed-rank test).

114 |
 Immunometabolism and BCG

    
 

 
    
   


 


 
 


 
 
  


 
 
 


  

   
  
   
 
    





  



 
 

  



    

  


 

7
 
 

 
 


 

  
 
 

 

 

  
 
 

 
 

   
   
 
 
  
 

  
 

 



 
 


























 






  
 

  
 

 








 
 























   
 
 
 
 
 


 
 



 
 

  
 

  
 


 













 






 





 

 
























| 115
Chapter 7

that glutamine utilization is essential for the induction of trained immunity. Inhibition
of the pentose phosphate pathway by 6-aminonicotinamide had no effect on the
induction of training (Figure 2F). Thus, the Akt/mTOR pathway, that in turn drives
glucose and glutamine metabolism, is crucial for BCG-induced trained immunity.

Epigenetic regulation of metabolism

To further assess how glucose and glutamine metabolism are regulated in BCG-
trained monocytes and macrophages, mRNA expression of mTOR and four essential
enzymes in glycolysis and glutamine metabolism were determined at day 6 after
BCG training. mTOR and all four enzymes were upregulated in trained monocytes
prior to restimulation (Figure 3A). To investigate whether this increased expression
was a result of epigenetic changes, histone 3 trimethylation of lysine 4 (H3K4me3)
and lysine 9 (H3K9me3) were determined. Both these two histone marks have been
previously shown to be important in BCG-induced trained immunity, with H3K4me3
being a histone mark denoting open chromatin and increased gene transcription,
while H3K9me3 is a repressor mark (12, 26, 27). H3K4me3 was indeed found
significantly increased at the promoters of MTOR, HK2, and PFKP, and the decrease
of H3K9me3 was even more pronounced, also for GLS and GLUD (Figure 3B).
When monocytes were trained with BCG an increase of H3K4me3 and decrease of
H3K9me3 was found at the promoters of TNFA and IL6, just as seen before (26).
However, when BCG training was inhibited with metabolic inhibitors of glutamine
metabolism (BPTES) or mTOR/glycolysis (rapamycin) the epigenetic changes at the
promoter site of TNFA and IL6 were reversed to the baseline status (Figure 3C,D).
This shows that the epigenetic and metabolic changes are intertwined and highly
dependent on each other.

Induction of glycolysis is crucial for trained immunity following BCG vaccina-

tion of human volunteers
We next examined whether the increased ex-vivo cytokine production 2 weeks and
3 months following BCG vaccination (12) was accompanied by increased glycolysis.
This indeed seemed to be the case as shown by higher lactate concentrations in
supernatants (Figure 4A), and higher expression of HK2 and PFKP in PBMCs,
isolated from BCG-vaccinated individuals. Expression of GLS and GLUD, involved
in glutamine metabolism, was not significantly affected by BCG vaccination, but
there was a possible trend towards higher expression at three months (Figure 4B).
To examine these pathways in vivo we next administered metformin, an AMPK-
activator (and mTOR inhibitor), to healthy volunteers for five days and examined
ex-vivo induction of trained immunity with BCG (as shown in Figure 1A). Use of
metformin inhibited induction of trained immunity by BCG, as shown by a temporary

116 |
 Immunometabolism and BCG

Figure 3 – Epigenetic and metabolic regulation in BCG-induced trained immunity. Monocytes were
incubated for 24h with culture medium or BCG. At day 6 (prior to restimulation): (A) mRNA expression of
MTOR, and two rate limiting enzymes in glycolysis (HK2, and PFKP) and glutamine metabolism (GLS,
and GLUD) were determined. (n=6, * p < 0.05, Wilcoxon signed-rank test). (B) DNA was isolated and
H3K4me3 and H3K9me3 were determined at promoter sites of MTOR, HK2, PFKP, GLS, and GLUD.
(n=6, * p < 0.05, Wilcoxon signed-rank test). (C,D) H3K4me3 (C) or H3K9me3 (D) were determined
at promoter sites of TNFA and IL6. During the first 24h inhibitors of glutamine metabolism (BPTES) or
mTOR/glycolysis (rapamycin) were added. (n=6, * p < 0.05, Wilcoxon signed-rank test).

| 117
Chapter 7

Figure 4 – The role of glycolysis in proof-of-principle clinical trials in human volunteers. (A) In a
human BCG vaccination trial healthy volunteers were vaccinated with BCG and at baseline and after 2
weeks and 3 months, PBMCs were ex vivo restimulated and lactate concentrations in the supernatants
were assessed (12). (n=19, * p < 0.05, Friedman test, and Dunns post test). (B) In the same vaccination
trial expression of HK2, PFKP, GLS, and GLUD were determined in PBMCs. (n=6, * p < 0.05, Wilcoxon
signed-rank test). (C) In a separate human metformin trial, healthy volunteers were treated for 6 days with
an increasing dose of metformin. At baseline (day 0), directly after completed metformin treatment (day
6), and 3 days (day 9), and 14 day (days 20) after metformin treatment, monocytes were isolated and ex
vivo trained with BCG (as shown in Figure 1A). TNFα and IL-6 production after 24h restimulation with LPS
were determined at day 7, and lactate production was assessed prior to restimulation (day 6). (n=11, * p
< 0.05, Wilcoxon signed-rank test).

Genetic validation for a role of glycolysis pathway in trained immunity

As a final step we examined whether genetic variation in metabolic pathways
affected in-vitro training of monocytes by BCG: if glycolysis and glutaminolysis are
important for the induction of trained immunity, then genetic variation of rate limiting
enzymes in these pathways should modulate trained immunity. In order to determine
this, the effects of single nucleotide polymorphisms (SNPs) in MTOR, HK2, PFKP,
GLS and GLUD1/2 on induction of IL-6 and TNFα after LPS restimulation of BCG-
trained macrophages were determined in a first cohort (n=65), and significant
associations were confirmed in a second cohort (n=49). SNPs in MTOR showed
modulation of trained immunity, but as numbers of the homozygous genotypes were
small and several MTOR SNPs were in linkage disequilibrium it is hard to draw
strong conclusions on the causative SNP (Figure S5). Three GLUD SNPs were not
associated with induction of cytokine production, and the effect observed in one of
the two GLS SNPs (rs7564529) was not validated in the second cohort. However,
three SNPs in HK2 and one SNP in PFKP significantly modulated the induction
of trained immunity, and this effect was validated in the second cohort (Figure 5).
Given the rate-limiting role of these enzymes for glycolysis, these findings support
the essential role of glycolytic rate for the induction of trained immunity.

118 |
 Immunometabolism and BCG

decreased induction of cytokine responses and lactate production upon secondary

stimulation (Figure 4C).

DISCUSSION
BCG-induced trained immunity results in an increased responsiveness of monocytes
and macrophages, with effector functions such as cytokine production and reactive
oxygen species release being increased upon secondary stimulation with non-
related pathogens. Earlier studies have shown that trained immunity is caused by
epigenetic rewiring at chromatin level (12). In this paper we show that the change
in inflammatory profile and the underlying epigenetic changes are dependent on
changes in cellular metabolism, with an increase in glycolysis as central hallmark,
but also with upregulation of glutamine metabolism and oxidative phosphorylation.
Furthermore, these metabolic changes were also epigenetically mediated, hence
showing a complex interaction between immunometabolic pathways and epigenetic
modifications.
The importance of cellular metabolism during immune cell activation has received
7

Figure 5 - The effect of SNPs in glycolytic genes on the induction of trained immunity by BCG.
Blood was drawn of healthy volunteers in 2011 (cohort 1) and 2015 (cohort 2) and SNPs were determined.
Adherent monocytes were cultured in vitro as described in Figure 1A. 3 SNPs in HK2 (rs2229621 and
1807090 in linkage disequilibrium, R2=0.936) and 1 SNP in PFKP were found to affect the production of
IL-6 and TNFα in the supernatants upon LPS restimulation after BCG training in both cohorts. (* p < 0.05,
Wilcoxon signed-rank test).

| 119
Chapter 7

a lot of attention in the last years. Already in the beginning of last century Otto Warburg
showed that tumor cells displayed a higher rate of glycolysis and less oxidative
phosphorylation compared to normal cells, a process called Warburg effect (28).
More recently a similar pattern has been described during activation of immune cells,
such as for pro-inflammatory M(IFNγ) macrophages and activated lymphocytes (29,
30). Moreover, not only glucose metabolism, but also other metabolic pathways play
important roles in reprogramming and polarizing cells, with fatty acid oxidation and
oxidative phosphorylation being essential for anti-inflammatory M(IL-4) macrophage
polarization (31), and glutamine metabolism with succinate accumulation involved in
IL-1β production (32). Recently it was shown that the increase in glycolysis in LPS-
activated BMDM was also a result of altered activity of transcription factors, with a
shift from Myc to Hif-1α dependent transcriptional regulation (33).
In the present study we demonstrate that cellular metabolism reprogramming is a
central process involved in induction of trained immunity by BCG vaccination as well.
BCG is the most widely used vaccine worldwide, and many epidemiological studies
have demonstrated its capacity to protect against non-mycobacterial infections as
well (5, 6). We have recently shown that BCG is a potent inducer of trained immunity:
understanding the pathways that contribute to this effect of BCG is thus crucial
for understanding the induction of trained immunity in humans, and potentially to
design novel approaches for vaccination and immunotherapy in patients. Through a
complementary approach combining in-vitro experiments, BCG vaccination in mice,
BCG proof-of-principle studies in humans, and genetic validation, we demonstrate a
crucial role for the Akt/mTOR pathway inducing high glycolytic rate for the induction
of trained immunity. In addition, glutamine metabolism is also necessary for a full
effective activation of trained immunity. In a model with β-glucan induced trained
immunity, also a long-term increase in glycolysis (and pro-inflammatory phenotype)
was shown, which was also dependent on mTOR/HIF-1α pathway (16). Interestingly
however, in β-glucan induced trained immunity a clear Warburg effect was seen,
with high glycolytic rate but a decreased oxidative phosphorylation (16). In contrast,
BCG-induced trained immunity induced both glycolysis and an increase in oxygen
consumption, arguing that different metabolic programs can be induced by various
training stimuli. Nevertheless, when electron transport chain complex V was
inhibited by oligomycin no effect on cytokine production was observed and when
glucose metabolism was shifted from lactate production to the TCA cycle (by DCA)
a decrease in induction of cytokine production was observed. This demonstrates
that glycolytic rate and lactate production are more important for induction of trained
immunity than oxidative phosphorylation, and mitochondrial metabolism could be
associated with carbon and not energy metabolism highlighted by the relevance of
glutamine in trained immunity.

120 |
 Immunometabolism and BCG

The effect of BCG on cellular metabolism has been little studied so far. In
a BCG-vaccination trial, PBMCs showed a decreased expression of glycolysis
genes two days after vaccination, but they were upregulated at 7 and 14 days
post vaccination (34). In our trial we see upregulation of glycolysis genes and a
trend for glutaminolysis genes up to 3 months after vaccination. However, this was
performed in only 19 volunteers at one fixed time point after ex-vivo stimulation.
Given the strong variation in the human population, a larger trial with sequencing
data (and preferably also genetic analysis) is strongly warranted. Furthermore, in
infection models with Mycobacterium tuberculosis and M. avium, an overall shift of
glucose metabolism from oxidative phosphorylation to fermentation (Warburg effect)
has been reported, and this was linked to pro-inflammatory cytokine production and
bacterial survival (35-37). However, how long these shifts last and whether they are
only an expression of the acute immune reaction to the mycobacteria is unknown.
One of the important conclusions of the present study is that these changes
in cellular metabolism contribute to the long-term epigenetic reprogramming of
trained monocytes. Previously, we have already shown how β-glucan induced
7
trained immunity results in metabolic changes (Warburg effect), which is the result
of epigenetic modulation, e.g. increased H3K4me3 and H3K27ac at promoters
sites of essential glycolytic genes (16). We have now confirmed that comparable
epigenetic changes are induced in BCG-induced trained immunity. Interestingly
however, these epigenetic changes are in turn dependent on the induction of
the metabolic pathways: if glycolysis or glutaminolysis are inhibited, changes in
H3K4me3 and H3K9me3 at promoter sites of IL6 and TNFA are reversed, showing a
link between these two regulatory cellular processes. The relation between cellular
metabolism and the epigenetic landscape of cells has recently received increased
attention (38-40). Methylation of histone tails is regulated by lysine demethylases
and histone methylstransferases, whose activity is influenced by cellular metabolites
functioning as co-factors. For histone (and also DNA) methylation S-adenosyl
methionine (SAM), derived from methionine, serves as a methyl donor and cofactor
(40). More than 200 mammalian genes have been predicted to encode for SAM-
dependent methyltransferases (41). Unfortunately, the regulation of SAM in BCG-
induced trained immunity is still unkown. Histone demethylation KDMs of the JmjC
and JmjD family need α-ketoglutarate as a cofactor for the demethylation process
(42). Metabolites with a similar molecular structure, such as fumarate, succinate,
or 2-hydroxyglutarate, can in turn serve as antagonizing factors (42, 43), thereby
inhibiting the demethylation process. Moreover, these metabolites do not only affect
histone demethylases, but also affect DNA demethylases (43), which therefore leaves
DNA methylation and the effect of the changing metabolism on DNA methylation
as an intriguing topic for future research. In this respect, it is important to point out

| 121
Chapter 7

that glutaminolysis, which can lead to succinate accumulation (32), when inhibited
abolished upregulation of cytokine production by BCG. These data argue that the
metabolic and epigenetic modifications are intertwined, and positive feedback loops
are likely to strengthen the trained immunity phenotype. While we here demonstrate
the impact of cellular metabolism on histone modifications at the level of immune
gene promoters, epigenetic changes may be also induced in rate-limiting metabolic
enzymes. Further study is needed to examine these possible effects.
In order to further demonstrate the importance of mTOR-dependent glycolysis for
induction of trained immunity, we show in a clinical trial that metformin (an mTOR
inhibitor) administration can inhibit the induction of trained immunity. Finally, we
demonstrate that genetic polymorphisms in genes encoding for the rate-limiting
glycolysis enzymes HK2 and PFKP influence induction of trained immunity in
monocytes from two cohorts of healthy volunteers. Also several SNPs in mTOR
showed a tendency towards modulation of trained immunity, but their importance
remains to be demonstrated in larger studies.
In conclusion, we show essential roles for glycolysis and glutamine metabolism
for the induction of trained immunity in human monocytes by BCG. Induction of
these pathways is regulated by epigenetic mechanisms at the level of chromatin
organization. The next step should investigate the potential therapeutic role that
modulation of these pathways may have during vaccination.

REFERENCES
1. Zumla A, Raviglione M, Hafner R, von Reyn CF.
Tuberculosis. N Engl J Med. 2013;368(8):745-55.
2. Colditz GA, Brewer TF, Berkey CS, Wilson ME,
Burdick E, Fineberg HV, et al. Efficacy of BCG vaccine
in the prevention of tuberculosis. Meta-analysis of the
published literature. JAMA. 1994;271(9):698-702.
3. Garly ML, Martins CL, Bale C, Balde MA, Hedegaard
KL, Gustafson P, et al. BCG scar and positive
tuberculin reaction associated with reduced child
mortality in West Africa. A non-specific beneficial
effect of BCG? Vaccine. 2003;21(21-22):2782-90.
4. Roth A, Gustafson P, Nhaga A, Djana Q, Poulsen A,
Garly ML, et al. BCG vaccination scar associated
with better childhood survival in Guinea-Bissau.
International journal of epidemiology. 2005;34(3):540-
7.
5. Aaby P, Roth A, Ravn H, Napirna BM, Rodrigues A,
Lisse IM, et al. Randomized trial of BCG vaccination
at birth to low-birth-weight children: beneficial
nonspecific effects in the neonatal period? The
Journal of infectious diseases. 2011;204(2):245-52.
6. Biering-Sorensen S, Aaby P, Napirna BM, Roth A,
Ravn H, Rodrigues A, et al. Small randomized trial
among low-birth-weight children receiving bacillus
Calmette-Guerin vaccination at first health center
contact. The Pediatric infectious disease journal.
2012;31(3):306-8.
7. Kristensen I, Aaby P, Jensen H. Routine vaccinations
and child survival: follow up study in Guinea-Bissau,
West Africa. Bmj. 2000;321(7274):1435-8.
8. Salem A, Nofal A, Hosny D. Treatment of common
and plane warts in children with topical viable
Bacillus Calmette-Guerin. Pediatric dermatology.
2013;30(1):60-3.
9. Pereira LI, Dorta ML, Pereira AJ, Bastos RP,
Oliveira MA, Pinto SA, et al. Increase of NK cells
and proinflammatory monocytes are associated
with the clinical improvement of diffuse cutaneous
leishmaniasis after immunochemotherapy with
BCG/Leishmania antigens. The American journal of
tropical medicine and hygiene. 2009;81(3):378-83.
10. Rousseau MC, Parent ME, St-Pierre Y. Potential
health effects from non-specific stimulation of the
immune function in early age: the example of BCG
vaccination. Pediatric allergy and immunology
: official publication of the European Society of
Pediatric Allergy and Immunology. 2008;19(5):438-
48.
11. van ‘t Wout JW, Poell R, van Furth R. The role of
BCG/PPD-activated macrophages in resistance
against systemic candidiasis in mice. Scandinavian
journal of immunology. 1992;36(5):713-9.
12. Kleinnijenhuis J, Quintin J, Preijers F, Joosten LA,
Ifrim DC, Saeed S, et al. Bacille Calmette-Guerin
induces NOD2-dependent nonspecific protection
from reinfection via epigenetic reprogramming of
monocytes. Proceedings of the National Academy
of Sciences of the United States of America.
2012;109(43):17537-42.
13. Netea MG, Joosten LA, Latz E, Mills KH, Natoli G,
Stunnenberg HG, et al. Trained immunity: A program
of innate immune memory in health and disease.
Science. 2016;352(6284):aaf1098.
14. Netea MG, Quintin J, van der Meer JW. Trained
immunity: a memory for innate host defense. Cell
host & microbe. 2011;9(5):355-61.
15. Saeed S, Quintin J, Kerstens HH, Rao NA,
Aghajanirefah A, Matarese F, et al. Epigenetic
programming of monocyte-to-macrophage
differentiation and trained innate immunity. Science.
2014;345(6204):1251086.
16. Cheng SC, Quintin J, Cramer RA, Shepardson KM,
Saeed S, Kumar V, et al. mTOR- and HIF-1alpha-
mediated aerobic glycolysis as metabolic basis for
trained immunity. Science. 2014;345(6204):1250684.
17. Odegaard JI, Chawla A. Alternative macrophage

122 |

activation and metabolism. Annual review of
pathology. 2011;6:275-97.
18. Cheng SC, Scicluna BP, Arts RJ, Gresnigt MS,
Lachmandas E, Giamarellos-Bourboulis EJ, et al.
Broad defects in the energy metabolism of leukocytes
underlie immunoparalysis in sepsis. Nat Immunol.
2016;17(4):406-13.
19. Buffen K, Oosting M, Quintin J, Ng A, Kleinnijenhuis
J, Kumar V, et al. Autophagy controls BCG-induced
trained immunity and the response to intravesical
BCG therapy for bladder cancer. PLoS pathogens.
2014;10(10):e1004485.
20. Oosting M, Berende A, Sturm P, Ter Hofstede HJ,
de Jong DJ, Kanneganti TD, et al. Recognition
of Borrelia burgdorferi by NOD2 is central for the
induction of an inflammatory reaction. J Infect Dis.
2010;201(12):1849-58.
21. Li Y, Oosting M, Deelen P, Ricano-Ponce I, Smeekens
S, Jaeger M, et al. Inter-individual variability and
genetic influences on cytokine responses to bacteria
and fungi. Nature medicine. 2016.
22. Parkes M, Cortes A, van Heel DA, Brown MA.
Genetic insights into common pathways and complex
relationships among immune-mediated diseases.
Nat Rev Genet. 2013;14(9):661-73.
23. Machiela MJ, Chanock SJ. LDlink: a web-based
application for exploring population-specific
haplotype structure and linking correlated alleles
of possible functional variants. Bioinformatics.
2015;31(21):3555-7.
24. Quintin J, Saeed S, Martens JH, Giamarellos-
Bourboulis EJ, Ifrim DC, Logie C, et al. Candida
albicans infection affords protection against
reinfection via functional reprogramming of
monocytes. Cell host & microbe. 2012;12(2):223-32.
25. Cairns RA, Papandreou I, Sutphin PD, Denko NC.
Metabolic targeting of hypoxia and HIF1 in solid
tumors can enhance cytotoxic chemotherapy.
Proceedings of the National Academy of Sciences of
the United States of America. 2007;104(22):9445-50.
26. Arts RJ, Blok BA, Aaby P, Joosten LA, de Jong D,
van der Meer JW, et al. Long-term in vitro and in
vivo effects of gamma-irradiated BCG on innate and
adaptive immunity. J Leukoc Biol. 2015;98(6):995-
1001.
27. Arts RJ, Blok BA, van Crevel R, Joosten LA, Aaby P,
Benn CS, et al. Vitamin A induces inhibitory histone
methylation modifications and down-regulates
trained immunity in human monocytes. J Leukoc Biol.
2015;98(1):129-36.
28. Warburg O, Wind F, Negelein E. The Metabolism of
Tumors in the Body. J Gen Physiol. 1927;8(6):519-
30.
29. Pearce EL, Poffenberger MC, Chang CH,
Jones RG. Fueling immunity: insights into
metabolism and lymphocyte function. Science.
2013;342(6155):1242454.
30. Tan Z, Xie N, Cui H, Moellering DR, Abraham E,
Thannickal VJ, et al. Pyruvate dehydrogenase
kinase 1 participates in macrophage polarization
Immunometabolism and BCG
via regulating glucose metabolism. Journal of
immunology. 2015;194(12):6082-9.
31. Galvan-Pena S, O’Neill LA. Metabolic reprograming
in macrophage polarization. Front Immunol.
2014;5:420.
32. Tannahill GM, Curtis AM, Adamik J, Palsson-
McDermott EM, McGettrick AF, Goel G, et
al. Succinate is an inflammatory signal that
induces IL-1beta through HIF-1alpha. Nature.
2013;496(7444):238-42.
33. Liu L, Lu Y, Martinez J, Bi Y, Lian G, Wang T, et al.
Proinflammatory signal suppresses proliferation and
shifts macrophage metabolism from Myc-dependent
to HIF1alpha-dependent. Proceedings of the
National Academy of Sciences of the United States
of America. 2016;113(6):1564-9.
34. Matsumiya M, Satti I, Chomka A, Harris SA,
Stockdale L, Meyer J, et al. Gene expression and
cytokine profile correlate with mycobacterial growth
in a human BCG challenge model. J Infect Dis.
2015;211(9):1499-509.
35. Gleeson LE, Sheedy FJ, Palsson-McDermott EM,
Triglia D, O’Leary SM, O’Sullivan MP, et al. Cutting
Edge: Mycobacterium tuberculosis Induces Aerobic
Glycolysis in Human Alveolar Macrophages That
Is Required for Control of Intracellular Bacillary
Replication. J Immunol. 2016.
36. Appelberg R, Moreira D, Barreira-Silva P, Borges
M, Silva L, Dinis-Oliveira RJ, et al. The Warburg
effect in mycobacterial granulomas is dependent on
the recruitment and activation of macrophages by
interferon-gamma. Immunology. 2015;145(4):498-
507.
37. Shi L, Salamon H, Eugenin EA, Pine R, Cooper
A, Gennaro ML. Infection with Mycobacterium
tuberculosis induces the Warburg effect in mouse
lungs. Sci Rep. 2015;5:18176.
38. Donohoe DR, Bultman SJ. Metaboloepigenetics:
interrelationships between energy metabolism and 7
epigenetic control of gene expression. Journal of
cellular physiology. 2012;227(9):3169-77.
39. Hirschey MD, DeBerardinis RJ, Diehl AM, Drew JE,
Frezza C, Green MF, et al. Dysregulated metabolism
contributes to oncogenesis. Seminars in cancer
biology. 2015.
40. Kaelin WG, Jr., McKnight SL. Influence of metabolism
on epigenetics and disease. Cell. 2013;153(1):56-69.
41. Petrossian TC, Clarke SG. Uncovering the human
methyltransferasome. Mol Cell Proteomics.
2011;10(1):M110 000976.
42. Lu C, Ward PS, Kapoor GS, Rohle D, Turcan
S, Abdel-Wahab O, et al. IDH mutation impairs
histone demethylation and results in a block to cell
differentiation. Nature. 2012;483(7390):474-8.
43. Xiao M, Yang H, Xu W, Ma S, Lin H, Zhu H, et al.
Inhibition of alpha-KG-dependent histone and
DNA demethylases by fumarate and succinate
that are accumulated in mutations of FH and
SDH tumor suppressors. Genes & development.
2012;26(12):1326-38.
| 123
Chapter 7

Figure S1. Glucose metabolism, Related to Figure 1. Human monocytes were trained for 24h with
BCG or left in medium as control. After 2 subsequent days rest, cells were restimulated with LPS. Glucose
consumption and lactate production in the medium were assessed at different time points for 2 donors
and lactate:glucose ratios were calculated.

124 |
 Immunometabolism and BCG

Figure S2. Related to Figure 1

and S3. (A) Spectrum of culture
13
C−1H−HSQC ppm media. Representative 13C-1H-HSQC
supernant
exp103 63 20
etha spectrum of the culture media of human
CTL monocytes trained for 24h with BCG
Lact−3
30
BCG
Glutm (BCG; red) or left in medium as control
Glutm (CTL; black) following a subsequent 24h
40
incubation with LPS in the presence of
2-13C-labeled glucose. The 2D-spectrum
50

Glutm
shows the proton resonances (X-axis)
60 Hepes etha directly linked to 13C (Y-axis), with the
gluc
Hepes
resonances of 2-13C-glucose (Gluc-2)
70 Lact−2
α−gluc2
and 2-13C-lactate (Lact-2) being the more
intense (see below). The chemical shift
is expressed in parts per million (ppm).
80 β−gluc2

90
The spectrum displays other peaks
corresponding to other compounds that
100
α−gluc1
are not resulting from the metabolism of
β−gluc1
2-13C-labeled glucose. Gluc = glucose;
Glutm = glutamine; Lact = lactate; etha
6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 ppm
13C Labelling profile of Lactate−2 in supernant
= ethanol.

(B) Spectrum of cell extracts. Highlight

12
C−Lact2 of a representative 2-lactate 1H-NMR
spectrum of cell extracts from human
7
monocytes trained for 24h with BCG
(BCG; red) or left in medium as control
(CTL; black) following a subsequent
13
24h incubation with LPS in the
C−Lact2 13

13
C−Lact2
C−Lact2
presence of 2-13C-labeled glucose. The
presence of a 13C splits the resonances
46% BCG
of the protons directly linked in two by
a J-coupling constant, allowing the
calculation of the 13C incorporated
19 % CTL
in each position in comparison with
4.20 4.15 4.10 4.05 ppm
12
C-lactate abundance (≈ 4.15-4.10
ppm). In the case of the position 2 of
lactate, the total incorporation of 13C
from the 2-13C-glucose is 19 % in the
control macrophages and 46% in the
13C Rybosyl-1 BCG-trained macrophages.

(C) 13C-labeled glucose incorportation

relation to non-trained

in Rybosyl. Human monocytes were

trained for 24h with BCG or left in
1.5
Incorporation in

medium as control. After 2 subsequent

days rest, cells were restimulated
with LPS in medium with 13C-labeled
1.0
glucose. After 24h incorportation in
intracellular metabolites was assessed.
(Mean ± SD, n=3).
0.5

0.0
Unstimulated BCG

| 125
Chapter 7

126 |
 Immunometabolism and BCG

Figure S4. Related to Figure 1. Amino acid consumption from

medium. Human monocytes were trained for 24h with BCG or left
in medium as control. After two subsequent days rest, cells were
restimulated with LPS. Amino acid consumption from the medium was
assessed at the indicated time points.

Figure S3. Related to Figure 1C,D. (A) Complete human Seahorse data. Monocytes were incubated for
24h with culture medium or BCG. At day 6 (prior to restimulation) extracellular acidification rate (ECAR)
and oxygen consumption rate (OCR) were determined by Seahorse. (Mean ± SEM, n=6, * p < 0.05,
Wilcoxon signed-rank test). (B) Complete mice Seahorse data. Mice were vaccinated with BCG. After 7
days splenocytes were isolated and ECAR and OCR were determined by Seahorse. (Mean ± SEM, n=6,
* p < 0.05, ** p < 0.01, Mann-Whitney U test).

| 127
Chapter 7

Figure S5. Related to Figure 5. Effect of MTOR SNPs on induction of trained immunity. Blood
was drawn of healthy volunteers in 2011 (cohort 1) and SNPs were determined. Adherent monocytes
were cultured in vitro as described in figure 1A. The indicated SNPs in MTOR were found to affect the
production of IL-6 and TNFα upon LPS restimulation after BCG training. (Mean ± SEM, * P < 0.05,
Wilcoxon signed-rank test). Linkage disequilibria of the displayed MTOR SNPs. Calculated according to
the methods of Machiela and Chanock (1).

128 |
 Immunometabolism and BCG

Epigenetic promoter primers

Gene Forward (5’-->3’) Reverse (5’-->3’)

MYO AGCATGGTGCCACTGTGCT GGCTTAATCTCTGCCTCATGAT

H2B TGTACTTGGTGACGGCCTTA CATTACAACAAGCGCTCGAC

GAPDH CCCCGGTTTCTATAAATTGAGC AAGAAGATGCGGCTGACTGT

ZNF UTR AAGCACTTTGACAACCGTGA GGAGGAATTTTGTGGAGCAA

TNFA GTGCTTGTTCCTCAGCCTCT ATCACTCCAAAGTGCAGCAG

IL6 AGGGAGAGCCAGAACACAGA GAGTTTCCTCTGACTCCATCG

MTOR ATAAAGAGCGCTAGCCCGAA GACCCCTCCCGGTGTAATTC

HK2 GAGCTCAATTCTGTGTGGAGT ACTTCTTGAGAACTATGTACCCTT

PFKP CGAAGGCGATGGGGTGAC CATCGCTTCGCCACCTTTC

GLS CCAGAGCCCCTAGTACCCAA TTGGCGATTAGGGCAGTCAA

GLUD GAAGTCCGTCCTCCCCGTTA TTTTAAGCCGCAGCTTCCTG

qPCR primers

Gene Forward (5’-->3’) Reverse (5’-->3’)

7
HPRT CCTGGCGTCGTGATTAGTGAT AGACGTTCAGTCCTGTCCATAA

MTOR TCCGAGAGATGAGTCAAGAGG CACCTTCCACTCCTATGAGGC

HK2 TTGACCAGGAGATTGACATGGG CAACCGCATCAGGACCTCA

PFKP ATTGCGGTTTTCGATGCCAC GCCACAACTGTAGGGTCGT

GLS AGGGTCTGTTACCTAGCTT ACGTTCGCAATCCTGTAGA

GLUD TCGTGGAGGACAAGTTGGT TTGCAGGGCTTGATGATCC

Table S1. Related to Figure 3. Primers.

Supplementary references
1. Machiela, M.J., and Chanock, S.J. LDlink: a web-
based application for exploring population-specific
haplotype structure and linking correlated alleles
of possible functional variants. Bioinformatics
2015;31:3555-3557.

| 129
 Chapter 8

Glutaminolysis and fumarate

accumulation integrate immunometabolic
and epigenetic programs in trained
immunity

Rob J.W. Arts, Boris Novakovic, Rob ter Horst, Agostinho Carvalho, Siroon
Bekkering, Ekta Lachmandas, Fernando Rodrigues, Ricardo Silvestre, Shih-Chin
Cheng, Shuang-Yin Wang, Ehsan Habibi, Luís G. Gonçalves, Inês Mesquita,
Cristina Cunha, Arjan van Laarhoven, Frank L. van de Veerdonk, David L. Williams,
Jos W.M. van der Meer, Colin Logie, Luke A. O’Neill, Charles A. Dinarello, Niels P.
Riksen, Reinout van Crevel, Clary Clish, Richard A. Notebaart, Leo A.B. Joosten,
Hendrik G. Stunnenberg, Ramnik J. Xavier, Mihai G. Netea.

Cell Metab 2016;24:1-13

Chapter 8

ABSTRACT

Induction of trained immunity (innate immune memory) is mediated by activation

of immune and metabolic pathways that result in epigenetic rewiring of cellular
functional programs. Through network-level integration of transcriptomics and
metabolomics data, we identify glycolysis, glutaminolysis, and the cholesterol
synthesis pathway as indispensable for the induction of trained immunity by β-glucan
in monocytes. Accumulation of fumarate, due to glutamine replenishment of the
TCA cycle, integrates immune and metabolic circuits to induce monocyte epigenetic
reprogramming by inhibiting KDM5 histone demethylases. Furthermore, fumarate
itself induced an epigenetic program similar to β-glucan-induced trained immunity. In
line with this, inhibition of glutaminolysis and cholesterol synthesis in mice reduced
the induction of trained immunity by β-glucan. Identification of the metabolic pathways
leading to induction of trained immunity contributes to our understanding of innate
immune memory and opens new therapeutic avenues.

132 |
 Immunometabolism in Trained Immunity

Recent studies demonstrated that certain infections and vaccinations induce innate
immune memory (also termed trained immunity (1)) in monocytes, macrophages,
and natural killer cells, resulting in non-specific protection against reinfection (2,
3). The biological relevance of innate immune memory is demonstrated by its
broad presence in nature, with studies in organisms as diverse as plants, insects,
cephalopods, and mammals reporting its impact for resistance to infections (4-6).
Many of the studies reporting adaptive characteristics embedded in innate immune
responses predate the modern era of molecular biology: the lack of understanding
the molecular mechanisms underlying their effects impaired however the capacity
to fully understand the importance of this process. This situation has changed
profoundly over the last few years, when several studies demonstrated that
epigenetic reprogramming forms the basis of innate immune memory in both plants
(7, 8) and mammals (3, 9-11).
Genome-wide changes in histone modifications have been shown to underlie
trained immunity in monocytes, but the molecular mechanisms linking the
immunological signals induced by microbial stimuli or vaccines to the epigenetic
changes have not been deciphered. Changes in cellular metabolism, with a shift
from oxidative phosphorylation to aerobic glycolysis (Warburg effect), are crucial
for the induction of β-glucan-induced trained immunity (12). Interestingly, increasing
evidence links cellular metabolism to the regulation of gene transcription, as several
8
metabolites from glycolysis and the TCA cycle have been shown to act as cofactors
for epigenetic writers and erasers such as DNA and histone methyltransferases
and demethylases, and histone acetyltransferases and deacetylases (13, 14).
These circuits have important functional consequences based on how cells use
metabolic substrates: for example, type 1 inflammatory macrophages (M(IFNγ)) rely
on increased glycolysis (15-17), whereas tolerant macrophages (M(IL-4)) rely on
oxidative phosphorylation and β-oxidation (17, 18). Interestingly, not only glucose
metabolism, but also other metabolic pathways play important roles in reprogramming
and polarizing cells (13, 14, 19).
Based on this growing body of evidence, we hypothesized that changes in
cellular metabolism in trained immunity not only reflect enhanced energetic needs,
but also connect with immune pathways and epigenetic reprogramming, through the
accumulation of specific metabolites modulating epigenetic processes that impact
the functional program of the cell. We combined transcriptomic, metabolomic, and
epigenomic studies to identify important metabolic processes activated in β-glucan-
trained monocytes. We validated the role of these processes in induction of trained
immunity, identifying an important function for glutamine metabolism and fumarate
accumulation. The importance of these processes was also demonstrated in in-vivo
models of trained immunity.

| 133
Chapter 8

MATERIALS AND METHODS

PBMC and monocyte isolation - Buffy coats from healthy donors were obtained
after written informed consent (Sanquin Blood Bank, Nijmegen, The Netherlands).
Peripheral blood mononuclear cell (PBMC) isolation was performed by dilution
of blood in pyrogen-free PBS and differential density centrifugation over Ficoll-
Paque (GE healthcare, UK). Cells were washed twice in PBS. Training of adherent
monocytes was performed as previously described (3); see also below. Percoll
isolation of monocytes was performed as previously described (20). Briefly, 150-
200x10^6 PBMCs were layered on top of a hyperosmotic Percoll solution (48.5%
Percoll (Sigma-Aldrich, St Louis, MO, USA), 41.5% sterile H2O, 0.16 M filter-sterilized
NaCl) and centrifuged for 15min at 580xg. The interphase layer was isolated and
cells were washed with cold PBS. Cells were resuspended in RPMI culture medium
(Roswell Park Memorial Institute medium, Invitrogen, CA, USA) supplemented with
50μg/ml gentamicin, 2mM Glutamax, and 1mM pyruvate and counted. An extra
purification step was added by adhering Percoll-isolated monocytes to polystyrene
flat bottom plates (Corning, NY, USA) for 1h at 37°C; a washing step with warm PBS
was then performed to yield maximal purity.
Monocyte training and inhibition experiments - 100μl cells were added to flat
bottom 96-well plates. After washing with warm PBS, monocytes were incubated
with culture medium only as a negative control or 5μg/ml of β-glucan, (β-1,3-(D)-
glucan, kindly provided by Professor David Williams), 100µM mono methyl-fumarate
or dimethyl-2-oxoglutarate (Sigma) for 24h (in 10% pooled human serum). Cells
were washed once with 200μl warm PBS and incubated for 5 days in culture medium
with 10% serum and medium was changed once. Cells were restimulated with
200μl RPMI, Escherichia coli LPS (serotype 055:B5, Sigma-Aldrich, 10ng/ml), or
Pam3Cys (EMC microcollections, L2000, 10μg/ml). After 24h, supernatants were
collected and stored at -20°C (see Figure S1). In some experiments, cells were
pre-incubated (before β-glucan training) for 1h with 10nM rapamycin (Sigma), 50μM
BPTES (Sigma), 2μg/ml Ceruline (Sigma), 100μM 6-aminonicotinamide (Sigma),
20μM fluvastatin sodium hydrate (Sigma). Concentrations were selected as being
the highest non-cytotoxic concentrations.
Cytokine and lactate measurements - Cytokine production was determined in
supernatants using commercial ELISA kits for TNFα (R&D systems, MN, USA)
and IL-6 (Sanquin, Amsterdam, The Netherlands) following the instructions of the
manufacturer. Lactate concentration was measured using a Lactate Fluorometric
Assay Kit (Biovision, CA, USA).
HPLC and NMR - Amino acids were quantified by high-performance liquid
chromatography (HPLC) in a Gilson UV/vis_155 detector (338nm) after precolumn
derivatization with ortho-phthalaldehyde (OPA with methanol ≥99.9%, potassium

134 |
 Immunometabolism in Trained Immunity

borate 1M pH=9.5, and 2-mercaptoethanol ≥99.0%) 1:5 (Sigma Aldrich). Culture

supernatants were filtered by Acrodisc 13mm syringe filters with 0.2μm supor
membrane (Pall Corporations, USA). Inorganic mobile phase pH=7.8 was
composed by Na2HPO4.2H2O3 50mM : propionic acid 250mM (1:1) mixture (Merck,
Germany) with acetonitrile HPLC grade in water (10:2:13). Organic mobile phase
was composed by acetonitrile, methanol and water (3:3:4) (HPLC grade, HiPerSolv
Chromanorm, VWR Chemicals, USA). All mobile phases for elution were degasified
for 30 minutes previously to analysis. Amino acids were quantified using the Gilson
Uniprot Software, version 5.11 accordingly to standard solutions were prepared in
MilliQ water (Millipore, Germany).
For NMR spectroscopy, methanol/water extracts and cell culture supernatants
were analyzed. The aqueous and chloroform extracts were dried in a SpeedVac
Plus system. The aqueous extract was suspended in 600μL D2O with 0.262mM of
TSP-d4 as chemical shift indicator and the organic extract in 600μL CD3Cl. To 550μL
of cell culture media were added 50μL D2O, with a TSP-d4 final concentration of
0.262mM.
The samples were analyzed at 25°C by 1H-NMR and by 2D 13C-1H- heteronuclear
single quantum coherence (HSQC) spectroscopy in a UltrashiedTM 800 Plus
(Bruker) operating at 800.33MHz, equipped with a TXI-Z H C/N/-D (5mm) probe.
The 1H-NMR pulse sequence used has a NOESY-presaturation (noesygppr1d) with
8
irradiation at the water frequency (ns 124, TD 64K, SW 20ppm, d1 4s, d8 0.01s);
while in the 13C-1H-HSQC was used the hsqcetgpsisp2 pulse sequence (ns 16, TD1
512, TD2 2K, SW2 16ppm, SW1 165ppm, d1 1s). The chemical shifts in aqueous
sample were referred to TSP, while the samples in chloroform-d were referred to the
solvent signal. Spectra were acquired and processed using TopSpin 3.2 software
(Bruker); assignments were made by comparison with chemical shifts found in the
literature for metabolic intermediates and Human Metabolome Database (www.
hmdb.ca). The quantifications of the signals were performed by integration of the
peaks in the 1H-NMR spectra and of the volumes in the 13C-1H-HSQC spectra, using
the resonance due to the TSP as reference.
Metabolite measurements - Cells were cultured as described above. At day 6, cells
were detached from the plate with Versene (Life Technologies) and counted. At least
1x10^6 cells were lysed in 60μl 0.5% Triton-X in PBS. Metabolite concentrations were
determined by commercial assay kits for Acetyl CoA, fumarate, glutamate, malate,
NADPH, α-ketoglutarate (all Sigma), following the instructions of the manufacturer.
mRNA extraction and RT-PCR - Cells were cultured as described above, after 4h,
12h and 24h for fumarate stimulation or after 6 days after β-glucan training mRNA was
extracted by Trizol (Life technologies), according to the manufacturer’s instruction
and cDNA was synthesized using iScript reverse transcriptase (Invitrogen). Relative

| 135
Chapter 8

mRNA levels were determined using the Applied Biosciences Step-one PLUS and
the SYBR Green method (Invitrogen). Values are expressed as fold increases in
mRNA levels, relative to those in non-trained cells, with β-2-microglobulin or HPRT
as housekeeping genes. Primers are listed in Table S4. RNA sequencing was
performed as described before (9). Data accession codes: GSE86940 and GSE
85246.
Chromatin immunoprecipitation - 10x10^6 monocytes were trained in vitro in 10
cm-Petri dishes (Greiner) in 10ml-medium volumes. Cells were isolated and trained as
described above. After resting for 5 days in culture medium, the cells were detached
from the plate with Versene and fixed in methanol-free 1% formaldehyde. Cells were
then sonicated and immunoprecipitation was performed using antibodies against
H3K4me3 (Diagenode, Seraing, Belgium). After ChIP, DNA was processed further
for qPCR analysis using SYBR green. Samples were analyzed by a comparative Ct
method in which myoglobulin was used as a negative control and H2B as a positive
control according to the manufacturer’s instructions. Primers are listed in Table S4.
ChIP sequencing was performed as described before (9). Data accession codes:
GSE86940 and GSE 85246.
Metabolome assessment - Cells were cultured as described above. At 0h, 4h, 24h,
and 6d, cells were harvested and cell pellets were snap frozen and stored at -80°C until
metabolite analysis. Measurement of metabolites was performed by LC-MS. Polar
metabolites were extracted in 80% methanol. Metabolic profiles were obtained using
three LC-MS methods. Two separate hydrophilic interaction liquid chromatography
(HILIC) methods were used to measure polar metabolites in positive and negative
ionization mode MS, and one reversed phase method was used to profile lipids in the
positive ion mode. Polar metabolites were profiled in the positive ion MS mode using
an LC system comprising a 1200 Series Pump (Agilent Technologies) and an HTS
PAL autosampler (Leap Technologies) that was coupled to a 4000 QTRAP mass
spectrometer (AB SCIEX) equipped with an electrospray ionization source. Samples
were prepared by drying 100 ml of cell extracts under nitrogen and re-suspending the
residue in 100 ml of 10/67.4/22.4/0.2 v/v/v/v water/acetonitrile/methanol/formic acid
containing stable-isotope labeled internal standards (valine-d8, Sigma-Aldrich; and
phenylalanine-d8, Cambridge Isotope Laboratories). The samples were centrifuged
(10min, 1610xg, 4μC), and the supernatants were injected directly onto a 150mm
3μm 2.1mm Atlantis HILIC column (Waters). The column was eluted isocratically with
5% mobile phaseA (10mMammoniumformate/0.1%formic acid) for 1min followed
by a linear gradient to 40% mobile phase B (acetonitrile/0.1% formic acid) over
10min. The ion spray voltage was 4.5kV and the source temperature was 425μC.
All metabolites were measured using several reaction monitoring scans (MRM). MS
settings, including declustering potentials and collision energies, for each metabolite

136 |
 Immunometabolism in Trained Immunity

were optimized by infusion of reference standards before sample analyses.

MultiQuant software (version 1.2; AB SCIEX) was used to process all raw LC-
MS data and integrate chromatographic peaks. The processed data were manually
reviewed for quality of integration and compared against known standards to confirm
metabolite identities.
Metabolomics preprocessing - Missing values: If no peak was detected for a
certain metabolite in a particular sample, its concentration was assumed to be below
the detection limit. A value of half the minimum value of that metabolite over all
samples was used for these metabolites. In doing this, we assume that the minimum
value found for a particular metabolite is close to the detection limit. Data scaling:
The metabolomics data were log2 transformed before most of the analyses were
performed (exceptions are mentioned in the next sections). Depending on the type
of analysis, different additional scaling steps were performed.
Metformin proof-of-principle trial - The oral metformin study was performed in
twelve healthy volunteers, all of whom provided written informed consent. Exclusion
criteria consisted of obesity, kidney failure, or metabolic disorders. Volunteers
received increasing dosages of metformin for a total of five days (500mg on day 1,
2000mg on day 6). Blood sampling was performed one day before start of metformin
(day 0), during metformin intake (day 6), on day 9, and on day 20. The study was
approved by the local institutional review board (Arnhem-Nijmegen Medical Ethical
8
Committee) and conducted according to the principles of the International Conference
on Harmonisation–Good Clinical Practice guidelines.
Animal experiments - C57Bl/6J mice were trained by intraperitoneal injection with
1mg β-glucan as previously described (3). 1h before and 2h after intraperitoneal
injection of β-glucan or PBS, mice received an intraperitoneal injection of PBS,
200μg BPTES, or 125μg atorvastatine. After 7 days, mice were challenged with
10μg LPS intraperitoneally; after 3h, mice were sacrificed and circulating IL-1β and
TNFα concentrations were measured by ELISA (R&D systems) according to the
manufacturer’s instructions. The study was approved by the ethical animal committee
of the University of Colorado, Denver.
KDM5 activity assay - Nuclear extracts were prepared according to the method
of Schreiber et al (21). Cells were cultured as described above, 24h for fumarate
or α-ketoglutarate stimulation and 5 days after 24h stimulation with β-glucan or
LPS in 10cm-Petri dishes. 1x10^6 cell were resuspended in 400µl cell lysis buffer
(10mM HEPES; pH 7.5, 10mM KCl, 0.1mM EDTA, 1mM dithiothreitol (DTT), 0.5%
Nonidet-40 and 0.5mM PMSF along with the protease inhibitor cocktail (Sigma))
and allowed to swell on ice for 20min with intermittent mixing. Tubes were vortexed
and then centrifuged at 12,000xg at 4°C for 10min. The pelleted nuclei were washed
twice with the cell lysis buffer and resuspended in 25µl ice cold nuclear extraction

| 137
Chapter 8

buffer (20mM HEPES (pH 7.5), 400mM NaCl, 1mM EDTA, 1mM DTT, 1mM PMSF
with protease inhibitor cocktail) and incubated in ice for 30min with intermitted
sonication. Nuclear extract was collected by centrifugation at 12,000xg for 15min
at 4°C. The supernatant was used immediately in a fluorometric KDM5/JARID
Activity Quantification Assay Kit (Abcam), performed following the instructions of the
company.
Analysis methods - Principal Component Analysis (PCA): In the PCA analysis of the
metabolomics data, the data were first mean-centered. PCA was performed using
the function “prcomp” from the “stats” package, part of the “R” language. Univariate
statistical testing: For the univariate statistical tests no further scaling was performed.
P-values were calculated using a two-sided paired t-test, using the function “t.test”,
part of the “R” language. P-values were corrected using the Benjamini-Hochberg
false discovery rate procedure (as implemented in R). Pathway enrichment analysis:
Pathway enrichment analysis was performed using two different methods. The first
was “Pathway-tools” (22), the stand-alone version of the tool integrated into the
Biocyc online resource (23). This tool allows additional visualization of the data on
a metabolic pathway map (both metabolomic and transcriptomic), but this tool does
not allow the definition of a background metabolic set (all metabolites measured
by the used platform. Pathway-tools requires the definition of a set of significantly
differentially expressed metabolites/genes. Metabolites and genes were defined as
significantly changed between two conditions if they had a FDR < 0.1. The second
method used to perform pathway-enrichment analysis is “MetaboAnalyst” (24),
which does allow the definition of such a background set. MetaboAnalyst additionally
has the advantage of performing a quantitative enrichment analysis instead of
using a hard threshold, however, it does not allow the type of visualization that is
provided by Pathway-tools. This complementary set of options was the reason for
using both tools. A quantitative enrichment analysis was performed using the peak
intensities as an input (before log2 transform). The settings were as follows: missing
values were imputed as explained in the section “Metabolomics preprocessing” and
no data filtering or scaling was applied. The pathway-associated metabolite sets
were used to check for enrichment (before and after log transformation), using all
metabolites measured with mass spectrometry as a custom reference set. Pathways
of less than four compounds were filtered from our analysis. P-values for enriched
pathways in both methods were corrected using the Benjamini-Hochberg false
discovery rate procedure. Data visualization: The first explorative visualization was
performed using Pathway-tools, which allows visualization of both transcriptomic
and metabolomic data. Based on the pathways that were significantly differentially
expressed in either the metabolomic or transcriptomic data, the interesting parts
of the map were explored. Next, using the tool “Escher” (25), a pathway map was

138 |
 Immunometabolism in Trained Immunity

created, containing just the parts found to be of interest. A schematic overview of

the pathways is depicted in Figure 1C (the complete map as created by Escher is
depicted in Figure S1).
Statistics - Ex-vivo and in-vitro monocyte experiments were analyzed using a
Wilcoxon signed-rank test or one-way ANOVA, where applicable. A P-value below
0.05 was considered statistically significant. These data were analyzed using
GraphPad Prism 5.0 (La Jolla, CA, USA). *p < 0.05, **p < 0.01. Data are shown as
means ± SEM.

RESULTS
Cellular metabolic pathways in monocytes during induction of trained immu-
nity
β-glucan and bacterial lipopolysaccharide (LPS) induce different long-term functional
programs in monocytes and macrophages, i.e. enhanced function and tolerance,
respectively; with transcriptomic and epigenomic analyses revealing major differences
in glucose metabolism pathways (9, 12). To elucidate whether additional metabolic
pathways are differentially expressed between trained and tolerant cells, RNAseq
expression data at different time points after stimulation with β-glucan and LPS were
analyzed for metabolic pathways, and full intracellular metabolome assessment was
performed. We used the previously described in-vitro model of trained immunity
8
(12) in which purified monocytes are stimulated for 24h with RPMI, β-glucan, or
LPS, after which cells are washed and rested for 5 days in culture medium, followed
by a second 24h stimulation with either medium or LPS (Figure S1). Distinct RNA
expression patterns between β-glucan-trained and non-trained (RPMI) cells were
visible after 24h of stimulation, with the largest differences observed at the day
6-time point in LPS-treated cells (Figure 1A, Table S1). Metabolome data of trained
and tolerant cells showed that at early time points (4h and 24h after stimulation),
only small differences existed between the three conditions (RPMI, LPS, β-glucan).
On day 6 however, the intracellular metabolome of β-glucan-trained cells was clearly
different from the RPMI and LPS-treated cells, with major differences observed in
TCA cycle metabolites, fatty acid metabolism, and other pathways (Figure 1B, S1,
and Table S2, S3). Altogether, these data indicate that the majority of transcriptional
changes associated with metabolic pathways occur early (24h) in β-glucan-exposed
cells, and precede the metabolic phenotype observed in fully differentiated β-glucan-
trained macrophages on day 6.
Integration of the transcriptome and metabolome data in a network-level
context, revealed an upregulation of several major metabolic pathways in β-glucan-
trained macrophages, including glycolysis, pentose phosphate pathway (PPP),
and cholesterol metabolism (Figure 1C, S1). Interestingly, several important TCA

| 139
 Color Key
and Histogram
Chapter 8
Heatmap_metab_RNAseq_logeRPKM bg up
30
Count
0 10

−2 −1 0 1 2

A
Row Z−Score

ST6GALNAC2
HS3ST2
SARDH
HAGHL
NME1−NME2
RPL14
PDE8A
LTA4H
GALNT11
DBI
CHIT1
BG up – KEGG (n=320) P.adj BG down – KEGG (n=68) P.adj
B4GALT5
COL4A3BP
ACAT2
3.30E-39
ATP6V0D2
AGPS
NDUFB9
ADCY3
Arachidonic acid metabolism 1.10E-02
SLC28A3
OxidaAve phosphorylaAon
UGCG
NDUFB5
TFRC
SLC25A16
SCD
HEXB
COX6B1
COX7A2L
ACOT2
RDH12
ALDH1A1
ACAT1
PGAM1
SMPD2
PCBD1
GLO1
MAN1A1
MGLL
SLC19A2
PLD1
PPAP2B
ATP5B
ATP6V1H
3.70E-07
ETFA
SLC26A11
ACOT1
SLC17A5
Amino sugar metabolism Glycerophospholipid metabolism 1.30E-02
HEXA
SLC35A3
AKR7A2
B3GNT2
SDHD
ATP6V1E1
ATP6V1D
FBP1
GPX4
ACP1
ATP5F1
MCAT
AKR1A1
FECH
COX4I1
ATP5A1
ATP5C1
AK4
DDO
GART
NAGLU
NDUFS4
COQ7
7.20E-07
COMTD1
ASAH1
PEPD
FH
Cardiac muscle contracAon
PDXK
UROD
SOAT1
COX5B
MDH1
COX6C
ATP1B3
TXNRD1
NDUFA4
ACOT4
SEC11A
ATP6V1A
NDUFS5
SLC29A3
ALAS1
ATP5I
GCSH
COQ3
SLC2A8
PDHA1
SDHB
2.90E-05
ATP6V1F
GOT2
MGST3
GGH
PIGK
PGM2
Citrate cycle (TCA cycle)
ADH5
APOC1
PCCB
SMS
COX7C
TMEM91
PGM3
B-glucan

SLC9A7
LSS
FAH
NDUFS1
ACADS
PHYH
UQCRC1
GLRX2
LIPA
CBR1
PKM
UQCRH
RPE
PPAT
SLC5A2

320 genes
HPGDS
IMPDH2
ATP5H
MGST1
COX6A1
UQCR10
NDUFA1
GGCT
PCK2
ATP5J2
DLAT
up

GPD2
SLC1A3
NDUFA9
SOD1
DCTD
ATP6V1C1
AHCY
NDUFA7
FTL
GPAM
ACP5
ATP5G1
IDH1

Color Key
TALDO1

peaks
ECHS1
PDE3B
NDUFA13
ME3
NDUFB7
PI4K2A
SLC25A26
SLC22A1
UQCR11
AGA
NUDT2
SLC1A4
SDS
COX8A
UQCRFS1
ITPA
RENBP
GALE
HSD3B7
GNPDA1
MTHFS
ADSL
RFK
TXN
PRDX1
BCAT2
HK3
ATP5G3
AGPAT3
ACP2
NDUFS6
SPR
ATP5L
IDH3B
UCK2
GALNT6
ATP5S
ENO2
PRDX3
PFKP
ATP5O
ATP5E
SLC35B4
NDUFB2
DEGS2
NDUFB3
NDUFAB1
ADO
LPL
TSTA3
TYMS
APRT
RPN1
NDUFA6
GNPDA2
CRLS1
CYC1
UQCRQ
MTAP
PLA2G12A
PIGA
SHMT2
BCAT1
PPA2
PTDSS1
PIGU
NDUFB6
PHGDH
GLA
PNPLA4
ENO1
HSD11B1
COX7B
NIT2
PTS
NDUFA12
SLC27A4
MTHFD2
NLN
GUK1
ASL
ALDH1B1
CYP27A1
TXNRD3
PIK3R2
NME1
ALG1
UMPS
SLC5A6
SLC20A1
AK2
PGK1
SLC2A1
ALDH1L2
ATP6V1G1
DHODH
ALDH18A1
MDH2
PLA2G7
DAD1
DOLPP1
CBS
SDSL
ALG2
GSR
ATP1A1
SLC52A2
IDH3A
ACSL1
GLRX
AGPAT4
SEC11C
CYP27B1
PSAT1
SLC1A5
XYLB
PYCRL
COX7A2
ACOX3
HSD3B1
CHST7
RPN2
RPIA
MAOA
UXS1
MCCC2
PYCR2
GNPNAT1
ACSL4
ASPG
DPM1
PPA1
CTH
EPT1
PAICS
B3GALT6
PIGW
SLC4A2
SLCO4A1
MGAT2
KMO
SPCS3
ODC1
CHSY1
UAP1
ATP6V0B
SLC25A13
ACSL5
NT5C
UPP1
GCLM
SLC7A1
SLC2A3
CTPS1
HSD17B10
TKTL1
DPYSL3
KYNU
SLC3A2
MTHFD1L
SLC7A5
SLC25A15
PDE7A
GMPPB
ASNS
ST6GALNAC3
PAPSS2
68 genes
SPHK1
b-glucan

EXT1
SLC11A1
NT5E
SLC7A11
AKR1C1
down
RPMI_0h

RPMI_24h

LPS_24h

b.glucan_24h

RPMI_6d

LPS_6d

b.glucan_6d

sample

−2
Value

BB 6d
6d
LPS
6d
PC2 (expl. var = 17.2%)

6d
6d
6d
20 6d
6d
β-glucan
RPMI conditions_script
6d a RPMI
24h a b−glucan
24h a LPS
0 24h 6d6d
4h 24h
24h 6d
0h 4h
4h
4h
4h 4h 4h
0h
0h 4h4h4h
4h 24h24h
24h
24h
24h
−20
24h
−20 0 20 40
PC1 (expl. var = 51.2%)

C C
Legend
purines name/ = sig. upregulated
name/ = unchanged/
not meas.

glucose
penthose
fructose-6-
phosphate phosphate
pathway glutamine

2-hydroxy
glutamate
glycolysis glutarate

alpha-keto
lactate glutarate succinate
pyruvate semialdehyde

acetate succinate
acetyl-CoA
TCA cycle

citrate fumarate
cholesterol
biosynthesis malate
(>50% genes
b− L I_2 h

d
h
gl PS h

gl PS 4h

gl PS d
R an 4h

R n_2 h

an 6d

cholesterol
4

PM 4

_6
PM 0
b− L I_4

b− L I_6
a 24

upregulated)
PM _
R MI_

uc _

uc _
uc _
P
R

Figure 1 - Metabolism in trained and tolerant macrophages. (A) Heat map depicting average
mRNA expression of β-glucan-modulated metabolism-associated genes. Rows indicate different gene
transcripts; columns indicate different conditions and time points. Log(e)RPKM values were z-scored
and then plotted, with red indicating high RNA expression and blue indicating low RNA expression. The
PCA plot shows the relationship between samples based on the expression of dynamic metabolic genes.
RPMI, LPS, and β-glucan samples are shown at 24h (green) and day 6 (black). (B) Heat map depicting

140 |
 Immunometabolism in Trained Immunity

metabolites were strongly increased, such as succinate, malate, and fumarate, as

well as 2-hydroxyglutarate, leading us to hypothesize that TCA metabolites were
being replenished through glutaminolysis (Figure 1C, S1).

Glycolysis, but not PPP, is an essential metabolic pathway in trained immu-

nity
Glucose consumption is increased in β-glucan-trained macrophages (12), and our
metabolome analysis supports an increase in glycolysis. To obtain further insight
into the major accumulated products of glucose metabolism, we performed NMR
experiments with 13C-labeled glucose in trained monocytes. First, glucose was
converted into lactate, validating the upregulation of glycolysis with concomitant
lactate production in β-glucan-trained monocytes that we reported previously (12).
In addition, labeled purines were also detected, showing the activation of the PPP
(Figure 2A, S2). In contrast, neither 13C-labelled metabolites of the TCA cycle were
detected after incubation of trained monocytes with 13C-labeled glucose, nor 3-13C
lactate, indicating that the non-oxidative branch from the PPP back to glycolysis was
inactive (Figure 2A, S2).
As glucose can be metabolized by aerobic glycolysis and PPP, we assessed which
of these pathways was important for induction of trained immunity. Inhibition of mTOR
and glycolytic flux by rapamycin inhibited monocyte training, as previously shown
8
(12), whereas inhibition of the oxidative branch of the PPP by 6-aminonicotinamide
(6-AN) had no effect (Figure 2B). The increase in cytokine production by β-glucan-
induced trained immunity is accompanied by epigenetic changes, including an
increase of H3K4 trimethylation (H3K4me3) at promoter sites of inflammatory genes
(9). Consistent with similar observations in cytokine production, epigenetic changes
in H3K4me3 induced by β-glucan at the promoter sites of IL6 and TNFA were
abolished by rapamycin, but not by 6-AN (Figure 2B, S3). Thus, whereas glycolysis
is central for induction of trained immunity, inhibition of PPP does not have a direct
effect on increased cytokine production by trained monocytes.
Metformin activates AMPK and inhibits mTOR activity (Figure S3) (19). We
have previously shown that inhibition of the mTOR pathway that controls glucose
metabolism by metformin counteracts the induction of trained immunity by β-glucan
in mice (12). We now also show that metformin inhibits lactate production, 5 days

the average metabolite intensities in the metabolomics data. Rows indicate different metabolites; columns
indicate different conditions. Log transformed metabolite intensities were first z-scored/standardized and
then averaged over all replicates. A PCA score plot of PC1 vs PC2 of the standardized metabolomics data
is shown. Samples are color-coded according to the stimulus that was used; labels indicate time points
after stimulation. (C) Schematic pathway map depicting gene expression (arrows) and metabolic changes
(filled circles) in cells treated with β-glucan vs LPS at day 6. Transcripts and metabolites marked in red
were significantly upregulated in β-glucan vs LPS. The complete map as created by Escher is depicted
in Figure S1.

| 141
Chapter 8

Figure 2 - Glucose metabolism in trained immunity. (A) Accumulation of the 13C label that was
incorporated in 2-13C labeled glucose was determined in lysates from β-glucan vs non-trained monocytes
by NMR, therefore showing to which products glucose is metabolized. Arrows in grey are not active.
HSQC-NMR spectra are shown in Figure S2. (n=2). (B) Human monocytes were trained with β-glucan or

142 |
 Immunometabolism in Trained Immunity

after β-glucan training (Figure S3). To assess whether metformin has a similar effect
in vivo in humans, we initiated a proof-of-principle clinical trial in which healthy
volunteers received an incremental dose of metformin for 6 days (up to 1000mg
twice daily on day 6). In line with the in-vitro and murine experimental data, in-vivo
administration of metformin in humans decreased the ex-vivo β-glucan-induced
training of circulating monocytes, which was accompanied by a lower capacity
to mount glycolysis and release lactate (Figure 2C). When the study participants
stopped taking metformin, the capacity of monocytes to undergo β-glucan training
was fully restored (day 9 and 20), thereby confirming the importance of glucose
metabolism changes for inducing trained immunity in humans (Figure 2C).

Glutamine and cholesterol metabolism are important metabolic pathways in

trained immunity
In addition to glycolysis and PPP, glutamine metabolism, cholesterol, and fatty
acid synthesis pathways were also upregulated after β-glucan training. Glutamine
metabolism has been shown to play an important role in immune activation (26-28).
Incubation of trained monocytes with 13C-labeled glutamine resulted in increased
production of glutamate, a substrate that can replenish the TCA cycle (Figure 3A,
S2). Although no labeled succinate, fumarate, or malate were identified due to their
relatively low concentrations and the limited sensitivity of the assay, we were able
8
to measure increases in these TCA cycle metabolites using classical biochemical
methods (Figure S1, S4). Interestingly, no labeled lactate was detected, suggesting
that glutamine is not a source of pyruvate for lactic fermentation (Figure 3A, S2). This
interpretation was supported by the near 1:2 molar ratio of glucose:lactate observed
in the 13C-glucose experiment, suggesting that glucose is the sole source of lactate;
the ratio would have been lower if also other sources of lactate would have been
used.
Aspartic acid was also consumed in large amounts from the medium, indicating
that metabolism of amino acids other than glutamine may also be involved in trained
immunity (Figure S4). In line with this notion, production of 2-hydroxyglurate from
α-ketoglutarate was also significantly increased, just as methionine (Figure S1).
Finally, in addition to the well-known pathway in which glutamate enters the TCA
cycle via α-ketoglutarate, glutamate catabolism also enters the TCA cycle via
succinate semialdehyde metabolism (Figure 1C).
left in culture medium for 24h in the presence or absence of mTOR inhibitor (rapamycin) or PPP inhibitor
(6-AN). After 6 days, DNA was isolated for epigenetic analysis or cells were restimulated with LPS to
determine cytokine production. (n=5, * p < 0.05, ** p < 0.01, Wilcoxon signed-rank test). (C) Healthy
human volunteers received a twice-daily increasing dose (1-2 g) of metformin for 6 days. At indicated time
points, monocytes were trained ex vivo with β-glucan; after 5 days of rest, cells were restimulated with
P3C and cytokine production was assessed. For the effect of metfomin on the AMPK-mTOR pathway and
lactate production see Figure S3. (n=11, * p < 0.05, Wilcoxon signed-rank test).

| 143
Chapter 8

Figure 3 - Other metabolic pathways in trained immunity. (A) Accumulation of the 13C label that was
incorporated in 2-13C labeled glutamine was determined in supernatants and cell lysates from β-glucan vs

144 |
 Immunometabolism in Trained Immunity

In an additional set of experiments, we sought to establish the role of glutamine,

fatty acid, and cholesterol synthesis in trained immunity by adding inhibitors of these
pathways (BPTES, cerulenin, and fluvastatin, respectively) to the in-vitro trained
immunity model. Inhibition of glutaminolysis or cholesterol synthesis inhibited
trained immunity, whereas blockade of fatty acid synthesis had no effect (Figure 3B,
S3). In line with these results, H3K4me3 was downregulated by inhibition of either
glutaminolysis or cholesterol synthesis (Figure 3B). We next tested the relevance of
these pathways in an in-vivo model of trained immunity by assessing the effects of
BPTES that inhibits glutaminolysis, and atorvastatin, which inhibits the rate-limiting
enzyme in cholesterol syntheses HMG-CoA-reductase. Mice were treated with
1mg of β-glucan or vehicle control intraperitoneally, followed one week later by an
injection of 10μg LPS. 4h After the LPS challenge, induction of cytokine synthesis
was measured by ELISA in the circulating blood. We found that LPS induced a
significantly higher IL-1β concentration in plasma of β-glucan-trained mice than of
controls (Figure 3C), as previously reported (3). Importantly, when glutaminolysis was
inhibited by BPTES or cholesterol synthesis was inhibited by atorvastatin, trained
immunity, measured by IL-1β production, was significantly downregulated (Figure
3C). The plasma concentrations of TNFα at this time point after LPS injection were
low and not different between the various conditions. Together, these data show that
glutaminolysis and the cholesterol synthesis pathway are two metabolic pathways
8
that, in addition to glycolysis, are essential for the increased cytokine production and
epigenetic changes observed in β-glucan-induced trained immunity.

Fumarate induces epigenetic changes and trained immunity

Analysis of the metabolome of trained monocytes showed that succinate, fumarate,
and malate were strongly induced in these cells (Figure 1, S1). We first assessed
whether any of these metabolites by themselves can induce trained immunity. Training
of monocytes with fumarate on day 0 dose-dependently induced increased cytokine
production upon restimulation on day 6, whereas malate and succinate did not
induce this effect (Figure 4A). Inhibition of glycolysis or glutaminolysis by rapamycin
or BPTES, respectively, both pathways that inhibit β-glucan-induced trained
immunity, also decreased fumarate concentrations in trained monocytes (Figure
non-trained monocytes by NMR, therefore showing to which products glutamine is metabolized. HSQC-
NMR spectra can be found in Figure S2. (B) Human monocytes were trained with β-glucan or left in
culture medium for 24h in the presence or absence of glutaminase inhibitor (BPTES), fatty acid synthesis
inhibitor (cerulenin), or HMG-CoA reductase inhibitor (fluvastatin). After 6 days, DNA was isolated for
epigenetic analysis or cells were restimulated with LPS to determine cytokine production. (n=5, * p < 0.05,
** p < 0.01, Wilcoxon signed-rank test). (C) Mice were intraperitoneally trained with β-glucan or PBS in
the presence or absence of glutamine (BPTES) or cholesterol (atorvastatin) metabolism inhibitors. After
7 days, an intraperitoneal LPS challenge was performed and IL-1β production was assessed 3h later.
The fold of increase of IL-1β production of β-glucan trained mice to non-trained mice is shown. (n=4, * p
< 0.05, paired t test).

| 145
Chapter 8

AA

B C
B C

D
Monocytes Macrophages
RPMI RPMI-Mf
Fumarate Fuma-Mf ChIP-seq (H3K4me3/H3K27ac)
BG BG-Mf
24h 5 days

E
E F F
H3K4me3 read intensi7es H3K27ac read intensi7es
39 Fumarate 139 Fumarate
peaks up peaks up

85 Fumarate
193 Fumarate
peaks down peaks down

Fumarate Up Fumarate Up
DAVID GO biological process and KEGG pathways P.adj GREAT pathway P.adj
posi7ve regula7on of immune system process 5.70E-03 leukocyte migra7on 1.55E-02

regula7on of T-helper 1 type immune response 1.10E-02 regula7on of intracellular protein kinase cascade 1.47E-02

posi7ve regula7on of leukocyte ac7va7on 1.20E-02 cellular response to abio7c s7mulus 4.42E-02

Figure 4 - Fumarate-induced trained immunity.(A) Human monocytes were stimulated for 24h with
different concentrations of methyl-fumarate. At day 6, cells were restimulated for 24h with LPS and
cytokine production was assessed. (n=8, * p < 0.05, One-way ANOVA, Dunnett’s post test). (B) Human
monocytes were trained with β-glucan in the presence or absence of metabolic inhibitors for 24h. On day
6, cells were lysed and intracellular fumarate concentrations were determined. (n=9, * p <0.05, ** p <
0.01, one-way ANOVA). (C) Human monocytes were stimulated for 24h with 50μM methyl-fumarate. At
day 6, cells were fixed, chromatin was isolated, and H3K4me3 at the promoters of TNFA and IL6 were
determined. (n=5, * p < 0.05, Wilcoxon signed-rank test). (D) Experimental setup for the generation of

146 |
 Immunometabolism in Trained Immunity

4B). In addition, fumarate induced H3K4me3 at the promoters of pro-inflammatory

cytokines, as observed during induction of trained immunity by β-glucan (Figure 4C).
Considering these effects, we performed a whole-genome assessment of the histone
marks H3K4me3 and H3K27ac by ChIP sequencing in fumarate and β-glucan-
trained monocytes (Figure 4D). In total, 124 dynamic H3K4me3 regions (Figure 4E)
and 332 dynamic H3K27ac regions (Figure 4F) were identified in fumarate-trained
macrophages, with a log2 fold change >2.5 compared to non-trained macrophages
(RPMI). By the same criteria, β-glucan exposure induced 2,688 dynamic H3K27ac
changes (Figure S5), indicating that fumarate-induced chromatin remodeling
recapitulates only a small fraction of the total trained epigenome. However, 95%
of the genomic regions differentially regulated by fumarate were also differentially
regulated by β-glucan (>1 log2 fold change). If for β-glucan a log2 fold change of >2
were being used, this would account for 63% of the regions. Genes associated with
fumarate dynamic epigenetic regions were enriched in pathways involved in immune
response and leukocyte migration (Figure 4E,F), consistent with previous reports in
β-glucan-trained monocytes (3, 9).
Citric acid cycle metabolites (e.g. fumarate and succinate) have previously been
reported to regulate HIF-1α stabilization, by inhibiting hydroxylation and therefore
stabilizing HIF-1α (29, 30). We firstly assessed whether fumarate inhibited HIF-1α
hydroxylation in our in-vitro model. Incubation of human monocytes with fumarate
8
for 2h inhibited HIF-1α hydroxylation (Figure 5A), and HIF-1α targets (31) were
induced on transcriptional level (Figure 5B). This provides a first mechanism how
fumarate could induce the observed phenotypical changes, but it does not explain
the observed effects on histone modifications.
Therefore, given our finding that fumarate induces H3K4me3, we investigated
whether it could induce transcription of methyltransferases. However, none of the
detectable methyltransferases were differentially expressed between trained and
non-trained samples (Figure S6). We therefore assessed whether the activity of
KDM5 family of histone demethylases, which are responsible for demethylation of
H3K4 (32), was different in β-glucan trained macrophages. As shown in Figure 5C,
β-glucan training of monocytes resulted in decreased biological activity of KDM5
demethylases on day 6 after training, which corresponds to the time point with the
highest intracellular fumarate concentrations (Figure S1), an effect that was not
observed in LPS-induced immunotolerant macrophages (Figure 5C). Interestingly,
a similar effect was observed at transcription level (Figure S6). We also assessed
fumarate-treated macrophages for epigenomic analysis. (E) Heat map of H3K4me3 reads (purple) over
fumarate-specific peaks. The intensity over the center of the peak +/- 12kb is depicted for RPMI-Mf,
BG-Mf, and fumarate-Mf, with each row (x-axis) corresponding to a peak. (F) Heat map of H3K27ac
reads (red) over fumarate-specific peaks. The intensity over the center of the peak +/- 12kb is depicted
for RPMI-Mf, BG-Mf, and fumarate-Mf. The top GO pathways (from DAVID) associated with the nearest
genes to dynamic H3K4me3 and H3K27ac are shown, with adjusted p values.

| 147
Chapter 8

Figure 5 - Fumarate modulates HIF-1α degradation and epigenetic modulators. (A) Human
monocytes were stimulated for 2h with 50μM fumarate, after which cells were lysed and HIF-1α
hydroxylation was assessed by Western blot. Representative example of 5 experiments. (B) Human
monocytes were stimulated for 24h with 50μM fumarate, then mRNA was isolated and expression of HIF-
1α targets were determined. (n=8, * p < 0.05, Wilcoxon signed-rank test). (C) Human monocytes were
trained with β-glucan or tolerized with LPS for 24h. At day 6, nuclear extracts were isolated and KDM5
activity was determined. (n=6, * p < 0.05, One-way ANOVA, Dunnett’s post test). (D) Human monocytes
were incubated for 24h with fumarate or/and α-ketoglutarate after which nuclear extracts were isolated
and KDM5 activity was determined. (n=6, * p < 0.05, One-way ANOVA, Dunnett’s post test). (E) Human
monocytes were incubated for 24h with fumarate or/and α-ketoglutarate. At day 6, cells were restimulated
for 24h with LPS and cytokine production was assessed. (n=6, * p < 0.05, One-way ANOVA, Dunnett’s
post test).

expression of KDM3a/JMJD1a (a H3K9 demethylase) and KDM6b/JMJD3 (a H3K27

demethylase), but these genes were not significantly influenced during induction
of training (Figure S6). Finally, as α-ketoglutarate is a known cofactor for lysine
demethylases, whereas metabolites that have a comparable molecular structure
to α-ketoglutarate (e.g. fumarate or succinate) are natural antagonists (33), we
also determined whether the effect of fumarate on KDM5 activity is influenced by
α-ketogluterate. KDM5 activity was significantly inhibited by fumarate, and that was
restored by the addition of α-ketoglutarate (Figure 5D). Also at the level of cytokine
production α-ketoglutarate was able to partially counteract the training effect of
fumarate (Figure 5E).

DISCUSSION
In this study we provide the first mechanism linking stimulation of innate immune

148 |
 Immunometabolism in Trained Immunity

pathways with the induction of epigenetic and metabolic changes in trained immune
cells. We show that training of monocytes with β-glucan induces a rewiring of
cellular metabolism that modulates the epigenetic programming of metabolic genes.
Glycolysis, glutaminolysis, and cholesterol synthesis are non-redundant metabolic
pathways important for trained immunity in monocytes and macrophages. Among the
detailed metabolite changes, we identify fumarate as a key metabolite that induces
trained immunity (innate immune memory), an effect mediated at least partially by
induction of histone modifications such as H3K4me3 and H3K27Ac.
The role of cellular metabolites acting as cofactors for epigenetic enzymes has
only recently been revealed in several cell types and tissues (13, 34). By assessing
the interaction between transcriptional and metabolic profiles, we identified several
major metabolic pathways specifically activated in trained monocytes, compared
with naive and tolerant cells. Glucose enters both glycolysis and PPP during
activation of trained monocytes. Whereas glycolysis has been previously reported
to be important for trained immunity (12), very little is known regarding the role of

glucose
Dectin-1
stimulation
8
purines

X Fatty acids

X
Akt G-6-P phospholipids
PPP

mTOR

PDH TCA
NADPH
X
Malonyl CoA
pyruvate cycle
HIF-1α
citrate Acetyl-CoA
malate

fumarate
Lactic acid
Histone acetyl
cholesterol
transferases

glutamate
H3K4me3
H3K27Ac H3K27Ac
glutamine
Figure 6 - Overview figure showing the metabolic and epigenetic pathways through which
β-glucan induces trained immunity. Training of monocytes by β-glucan induces complex metabolic
pathways: while glycolysis, glutaminolysis and cholesterol synthesis are important for induction of trained
immunity, the pentose phosphate pathway (PPP) and fatty acid synthesis have no direct effect. Fumarate
accumulation through glutaminolysis has a central role for induction of histone modifications and induction
of trained immunity.

| 149
Chapter 8

the PPP in this process. Here we validate several previous studies of the role of
the mTOR pathway and glycolysis, and extend them in a proof-of-principle clinical
trial. By using metformin, an activator of AMP kinase and thus inhibitor of mTOR,
in healthy volunteers, we demonstrate a role for the mTOR pathway in trained
immunity in humans. This observation goes beyond answering a biological question,
as metformin is a widely used drug in patients with type 2 diabetes (35). Indeed, its
inhibition of trained immunity might have undesired consequences on antimicrobial
host defense; on the other hand, it may represent a potential new drug to be
employed in certain inflammatory diseases with excessive inflammation (16, 36, 37).
In contrast to glycolysis, the oxidative branch of PPP does not seem to have a major
impact on trained immunity.
Using a systems biology approach, our analysis of intracellular metabolites
of trained monocytes identified additional pathways that are involved in trained
immunity (Figure 6). The metabolism of several amino acids was enhanced,
including glutamine. Metabolism of glutamine into glutamate, α-ketoglutarate and
succinate semialdehyde provides substrates for the TCA cycle such as fumarate and
succinate. Interestingly, fumarate itself induces trained immunity as well. Trained
immunity induced by fumarate results in increased trimethylation of histones at H3K4,
and interestingly also acetylation at H3K27, linking immunometabolic activation
with long-term epigenetic changes. Importantly, the epigenetic program induced by
fumarate partially reproduces that of β-glucan-induced training, demonstrating its
likely involvement in mediating at least part of the effects of β-glucan.
KDMs of the JmjC and JmjD family need α-ketoglutarate as a cofactor for the
demethylation process (33), whereas metabolites with a similar molecular structure,
such as fumarate, can act as antagonizing factors (33, 38), thereby inhibiting
demethylation. The KDM5 family of demethylases (that is responsible for H3K4
demethylation) has been shown to be inhibited by fumarate (33, 38). Recently, locally
produced fumarate has also been shown to play a role in DNA repair by inhibition
of KDM2B histone demethylase activity, which resulted in enhanced H3K36me2
(39). We now show that fumarate inhibits the bioactivity of KDM5s in our model of
trained immunity and that α-ketoglutarate can counteract this effect. In addition to
fumarate, the concentration of 2-hydroxyglutarate, which has similar antagonizing
effects on α-ketoglutarate-dependent demethylases (40), is greatly increased in
β-glucan-trained macrophages too (Figure S1). Therefore, 2-hydroxyglutarate may
serve as another essential factor in modulating histone marks in trained immunity
induced by β-glucan. Xiao et al. have previously shown that fumarate (and potentially
2-hydroxyglutarate) does not only affect histone demethylases, but also affect DNA
demethylases (38). The effect of β-glucan training and metabolic alterations on DNA
methylation is therefore an intriguing topic for future research. In addition to the effects

150 |
 Immunometabolism in Trained Immunity

of fumarate on epigenetic enzymes, fumarate also inhibits proteasomal degradation

of HIF-1α, an essential transcription factor in β-glucan-induced trained immunity (12,
29, 41). In this process, α-ketoglutarate is a cofactor for the hydroxylation necessary
for HIF-1α degradation; fumarate is a natural antagonist of this reaction, thereby
stabilizing HIF-1α.
In conclusion, we show that β-glucan-induced trained immunity in monocytes
induces profound changes in cellular metabolism. The three most prominent
metabolic pathways involved in trained immunity are glycolysis, glutaminolysis, and
cholesterol synthesis, which are linked to enrichment in H3K4me3 that is essential
for trained immunity by β-glucan. Finally, we provide proof-of-principle of metabolo-
epigenomic circuits in innate immune memory by demonstrating an essential role for
fumarate in modulating HIF-1α degradation, histone methylation and acetylation. The
identification of the metabolic pathways contributing to induction of trained immunity
improves understanding of innate immune memory and opens new therapeutic
avenues.

Accession codes
GSE85246: RNA sequencing time course of control, β-glucan trained, and LPS
immunotolerant monocytes.
GSE86940: RNA sequencing and ChIP sequencing data of control, and fumarate
8
and β-glucan trained monocytes, at day 6.
Digital versions of Tables S1-3 can be obtained by sending a request to the author.

REFERENCES
1. Netea MG, Joosten LA, Latz E, Mills KH, Natoli G,
Stunnenberg HG, et al. Trained immunity: A program
of innate immune memory in health and disease.
Science. 2016;352(6284):aaf1098.
2. Sun JC, Beilke JN, Lanier LL. Adaptive
immune features of natural killer cells. Nature.
2009;457(7229):557-61.
3. Quintin J, Saeed S, Martens JH, Giamarellos-
Bourboulis EJ, Ifrim DC, Logie C, et al. Candida
albicans infection affords protection against
reinfection via functional reprogramming of
monocytes. Cell host & microbe. 2012;12(2):223-32.
4. Fu ZQ, Dong X. Systemic acquired resistance:
turning local infection into global defense. Annual
review of plant biology. 2013;64:839-63.
5. Kurtz J. Specific memory within innate immune
systems. Trends in immunology. 2005;26(4):186-92.
6. Netea MG, Quintin J, van der Meer JW. Trained
immunity: a memory for innate host defense. Cell
host & microbe. 2011;9(5):355-61.
7. Muthamilarasan M, Prasad M. Plant innate immunity:
an updated insight into defense mechanism. Journal
of biosciences. 2013;38(2):433-49.
8. Shah J, Chaturvedi R, Chowdhury Z, Venables
B, Petros RA. Signaling by small metabolites in
systemic acquired resistance. The Plant journal : for
cell and molecular biology. 2014;79(4):645-58.
9. Saeed S, Quintin J, Kerstens HH, Rao NA,
Aghajanirefah A, Matarese F, et al. Epigenetic
programming of monocyte-to-macrophage
differentiation and trained innate immunity. Science.
2014;345(6204):1251086.
10. Kleinnijenhuis J, Quintin J, Preijers F, Joosten LA,
Ifrim DC, Saeed S, et al. Bacille Calmette-Guerin
induces NOD2-dependent nonspecific protection
from reinfection via epigenetic reprogramming of
monocytes. Proceedings of the National Academy
of Sciences of the United States of America.
2012;109(43):17537-42.
11. O’Sullivan TE, Sun JC, Lanier LL. Natural Killer Cell
Memory. Immunity. 2015;43(4):634-45.
12. Cheng SC, Quintin J, Cramer RA, Shepardson KM,
Saeed S, Kumar V, et al. mTOR- and HIF-1alpha-
mediated aerobic glycolysis as metabolic basis for
trained immunity. Science. 2014;345(6204):1250684.
13. Donohoe DR, Bultman SJ. Metaboloepigenetics:
interrelationships between energy metabolism and
epigenetic control of gene expression. Journal of
cellular physiology. 2012;227(9):3169-77.
14. Hirschey MD, DeBerardinis RJ, Diehl AM, Drew JE,
Frezza C, Green MF, et al. Dysregulated metabolism
contributes to oncogenesis. Seminars in cancer
biology. 2015.
15. Pearce EL, Poffenberger MC, Chang CH,
Jones RG. Fueling immunity: insights into
metabolism and lymphocyte function. Science.
2013;342(6155):1242454.
16. Tan Z, Xie N, Cui H, Moellering DR, Abraham E,
Thannickal VJ, et al. Pyruvate dehydrogenase
kinase 1 participates in macrophage polarization
via regulating glucose metabolism. Journal of
immunology. 2015;194(12):6082-9.
17. Mills EL, O’Neill LA. Reprogramming mitochondrial
metabolism in macrophages as an anti-inflammatory
signal. European journal of immunology. 2015.
18. Van den Bossche J, Baardman J, de Winther MP.

| 151
Chapter 8

Metabolic Characterization of Polarized M1 and M2 clinical perspectives. Clinical cancer research : an

Bone Marrow-derived Macrophages Using Real-time official journal of the American Association for Cancer
Extracellular Flux Analysis. Journal of visualized Research. 2012;18(20):5562-71.
experiments : JoVE. 2015(105). 41. Serra-Perez A, Planas AM, Nunez-O’Mara A, Berra
19. Cheng SC, Scicluna BP, Arts RJ, Gresnigt MS, E, Garcia-Villoria J, Ribes A, et al. Extended ischemia
Lachmandas E, Giamarellos-Bourboulis EJ, et prevents HIF1alpha degradation at reoxygenation by
al. Broad defects in the energy metabolism of impairing prolyl-hydroxylation: role of Krebs cycle
leukocytes underlie immunoparalysis in sepsis. metabolites. The Journal of biological chemistry.
Nature immunology. 2016;17(4):406-13. 2010;285(24):18217-24.
20. Repnik U, Knezevic M, Jeras M. Simple and cost-
effective isolation of monocytes from buffy coats.
Journal of immunological methods. 2003;278(1-
2):283-92.
21. Schreiber E, Harshman K, Kemler I, Malipiero U,
Schaffner W, Fontana A. Astrocytes and glioblastoma
cells express novel octamer-DNA binding proteins
distinct from the ubiquitous Oct-1 and B cell type Oct-
2 proteins. Nucleic acids research. 1990;18(18):5495-
503.
22. Chen Q, Giedt M, Tang L, Harrison DA. Tools and
methods for studying the Drosophila JAK/STAT
pathway. Methods. 2014;68(1):160-72.
23. Caspi R, Altman T, Billington R, Dreher K, Foerster
H, Fulcher CA, et al. The MetaCyc database of
metabolic pathways and enzymes and the BioCyc
collection of Pathway/Genome Databases. Nucleic
acids research. 2014;42(Database issue):D459-71.
24. Xia J, Sinelnikov IV, Han B, Wishart DS. MetaboAnalyst
3.0--making metabolomics more meaningful. Nucleic
acids research. 2015;43(W1):W251-7.
25. King ZA, Drager A, Ebrahim A, Sonnenschein N,
Lewis NE, Palsson BO. Escher: A Web Application
for Building, Sharing, and Embedding Data-Rich
Visualizations of Biological Pathways. PLoS
computational biology. 2015;11(8):e1004321.
26. Sikalidis AK. Amino acids and immune response:
a role for cysteine, glutamine, phenylalanine,
tryptophan and arginine in T-cell function and cancer?
Pathology oncology research : POR. 2015;21(1):9-
17.
27. Roth E. Nonnutritive effects of glutamine. The Journal
of nutrition. 2008;138(10):2025S-31S.
28. Li P, Yin YL, Li D, Kim SW, Wu G. Amino acids and
immune function. The British journal of nutrition.
2007;98(2):237-52. Figure S1. Related to Figure 1-5.
29. Koivunen P, Hirsila M, Remes AM, Hassinen IE,
Kivirikko KI, Myllyharju J. Inhibition of hypoxia- Experimental setup. Monocytes were
inducible factor (HIF) hydroxylases by citric acid
cycle intermediates: possible links between cell isolated from buffy coats and plated to flat-
metabolism and stabilization of HIF. The Journal of bottom plates. Cells were left to adhere for
biological chemistry. 2007;282(7):4524-32.
30. Tannahill GM, Curtis AM, Adamik J, Palsson- 1h and were washed once with warm PBS
McDermott EM, McGettrick AF, Goel G, et to reach maximum purity. Then, depending
al. Succinate is an inflammatory signal that
induces IL-1beta through HIF-1alpha. Nature. on the experiment inhibitors and/or β-glucan
2013;496(7444):238-42.
31. Ke Q, Costa M. Hypoxia-inducible factor-1 (HIF-1). were added. After 24h incubation, cells were
Mol Pharmacol. 2006;70(5):1469-80. washed once with warm PBS and were left to
32. Secombe J, Eisenman RN. The function and
regulation of the JARID1 family of histone H3 lysine rest in culture medium for five days (with one
4 demethylases: the Myc connection. Cell cycle. medium change half way). At day six, cells
2007;6(11):1324-8.
33. Lu C, Ward PS, Kapoor GS, Rohle D, Turcan were restimulated for 24h with RPMI of 10ng/
S, Abdel-Wahab O, et al. IDH mutation impairs
histone demethylation and results in a block to cell ml LPS. The experiment was terminated at
differentiation. Nature. 2012;483(7390):474-8. several time points as depicted. Metabolome
34. Keating ST, El-Osta A. Epigenetics and metabolism.
Circulation research. 2015;116(4):715-36. and RNAseq samples were taken directly
35. Singh S. Type 2 diabetes pharmacoepidemiology after 4h, 24h and 6 days. Epigenetic analysis
update 2014: safety versus efficacy. Current diabetes
reports. 2014;14(12):563. was always performed on day six, prior to
36. Singhal A, Jie L, Kumar P, Hong GS, Leow MK,
Paleja B, et al. Metformin as adjunct antituberculosis restimulation. And cytokines were always
therapy. Science translational medicine. determined after the whole protocol was
2014;6(263):263ra159.
37. Robey RB, Weisz J, Kuemmerle NB, Salzberg AC, finished.
Berg A, Brown DG, et al. Metabolic reprogramming At day 6, cells were lysed and intracellular
and dysregulated metabolism: cause, consequence
and/or enabler of environmental carcinogenesis? concentrations of metabolites were
Carcinogenesis. 2015;36 Suppl 1:S203-31.
38. Xiao M, Yang H, Xu W, Ma S, Lin H, Zhu H, et al. determined. Metabolites are shown as circles;
Inhibition of alpha-KG-dependent histone and reactions are shown as arrows. Significantly
DNA demethylases by fumarate and succinate
that are accumulated in mutations of FH and upregulated (red), downregulated (green), and
SDH tumor suppressors. Genes & development. unchanged (gray) reactions/metabolites are
2012;26(12):1326-38.
39. Jiang Y, Qian X, Shen J, Wang Y, Li X, Liu R, et al. shown. Metabolites that were not measured
Local generation of fumarate promotes DNA repair
through inhibition of histone H3 demethylation. are depicted as small-unfilled circles. Figure
Nature cell biology. 2015;17(9):1158-68. was created using the tool “Escher.”
40. Yang H, Ye D, Guan KL, Xiong Y. IDH1 and IDH2
mutations in tumorigenesis: mechanistic insights and

152 |
 Immunometabolism in Trained Immunity

In vitro culture methods

24h
Monocytes 24h
+/- β-glucan Restimulation
+/- metabolic RPMI or LPS
inhibitors 5 days
Rest in culture medium

Time:

4h 24h
d6 d7

Metabolome
IL6/TNF
RNAseq
Metabolome
RNAseq
Epigenetics

Cholesterol synthesis
Pentose Phosphate Pathway L-Glutamate L-Glutamine
Zymstnl r Lthstrl r Cholesterol c
Acetate CO2 L-Glutamine
5-Phospho-alpha-D-ribose 1-diphosphate
alpha-keto-
glutarate
Cholesterol r 4 4 dimethylzymosterol Isocitrate
Acetate
Alpha-D-Ribose 5-phosphate Zymosterol
Farnesyl Citrate
D-Ribulose 5-phosphate
diphosphate Squalene
Glyceraldehyde Acetate
3-phosphate
Geranyl diphosphate Farnesyl diphosphate Lanosterol
D-Xylulose 5-phosphate
Isopentenyl diphosphate Acetyl-CoA
Acetoacetyl-CoA
TCA Cycle
6-Phospho-D-gluconate R Mevalonate
D-Erythrose 4-phosphate
Succinyl-CoA

8
Oxaloacetate
6-phospho-D- Pyruvate
glucono-1,5-lactone

Glycolysis Pyruvate GDP

D-Glucose Phosphoenolpyruvate
L-Malate Succinate
Glyceraldehyde 3-phosphate
L-Aspartate Fumarate GTP

D-Glucose D-Glucose D-Fructose

6-phosphate 6-phosphate L-Glutamate
Succinic
L-Glutamate L-Malate semialdehyde
L-Lactate
Oxaloacetate

L-Glutamine
L-Aspartate
L-Lactate
L-Glutamate L-Glutamine

Fumarate
Acetyl CoA alpha-ketoglutarate
100 1.5
4 *
**
nmol/1 million cells

3
pmol/1 million cells

nmol/1 million cells

80
1.0
60 2

40
0.5 1
20
0
0 0.0
n
I
PM

ca
n

n
I

I
PM

PM

u
R
ca

ca

gl
u

u
R

b-
gl

gl
b-

b-

Malate Glutamate NADPH

2.5 8 4 **
Ratio (glutamate/protein)

* *
Ratio (malate/protein)

2.0
nmol/1 million cells

6 3
1.5
4 2
1.0

2 1
0.5

0.0 0 0
n

n
I

I
PM

PM

n
I
ca

ca

PM

ca
u

u
R

u
R
gl

gl

gl
b-

b-

b-

| 153
Chapter 8

Figure S2. Related to Figure 2A and 3A. 1H-13C HSQC-NMR spectra. The destination of 13C labeled
glucose (left) or glutamine (right) was determined in β-glucan vs non-trained monocytes by NMR both in
cells (upper) and culture medium (lower panels).

154 |
 Immunometabolism in Trained Immunity

Figure S3. Related to Figure 2&3. Human monocytes were incubated for 24h with β-glucan in the
presence of absence of metabolic inhibitors in 10cm petri dishes. After 24h cells were washed and 10%
serum in RPMI was added, on day 3 medium was changed. On day 6 cells were washed once with 8
warm PBS. The adherent macrophages were deattached and 50.000 cells were reseeded in 96-well flat-
bottom plates and stimulated with RPMI or 10ng/ml LPS for 24h and cytokine and lactate production were
assessed. RPMI restimulated cells did not produce TNFα or IL-6.
Metformin activates AMPK and inhibits mTOR. Human monocytes were incubated for 2h with 3mM
of metformin, then cells were lysed and phosphorylation of ACC (downstream target of AMPK) and S6K
(downstream target of mTOR) were assessed by Western Blotting.

| 155
Chapter 8

Figure S4. Related to Figure 3. Amino acid consumption during β-glucan-induced trained immunity.
Monocytes were trained with β-glucan for 24h. Post-treatment amino acid concentrations in the culture
medium were determined at indicated time points. Culture medium was changed once after 24h.

156 |
 Immunometabolism in Trained Immunity

A H3K4me3 H3K27ac
Reads/peak Fum Up Fum Down Fum Up Fum Down

Reads/peak
B
Top GO for H3K4me3 Fumarate Up associated genes Top GO for H3K27ac Fumarate Up associated genes

DAVID GO biological process and KEGG pathways P.adj Genes GREAT pathway P.adj Genes
In top 1.55E-02 In top
posi,ve regula,on of immune system process 5.70E-03 leukocyte migra,on
pathways pathways
regula,on of T-helper 1 type immune response 1.10E-02 regula,on of intracellular protein kinase cascade 1.47E-02
ADORA2B ANGPT4
posi,ve regula,on of leukocyte ac,va,on 1.20E-02 cellular response to abio,c s,mulus 4.42E-02 CD48
IL4R
posi,ve regula,on of cell ac,va,on 1.30E-02 Fumarate down CXCL3
SLC11A1
immune response 2.00E-02 CXCR4
TNFSF14 GREAT and DAVID pathway P.adj EPS8
regula,on of leukocyte ac,va,on 2.70E-02
CCL22 1.62E-02 FN1
regula,on of cell ac,va,on 3.00E-02 regula,on of immune system process
4.56E-02 PRKCA
T cell prolifera,on 4.10E-02 regula,on of cell ac,va,on
3.13E-02 SLC7A11
Cytokine-cytokine receptor interac,on 6.30E-01 estrous cycle phase
SPP1
Fumarate down
regula,on of specific transcrip,on
from RNA polymerase II promoter 7.80E-02 SRC
ACTN1
8
No significant enrichment in DAVID or GREAT

C H3K27ac read intensi,es for BG induced and Fumarate induced changes

H3K27ac read intensi,es

1991
peaks
BG up BG
697
peaks down

193 Fumarate
peaks down
RPMI BG Fumarate

139
peaks
Fumarate up
RPMI BG Fumarate
Figure S5. Related to Figure 4E,F. Epigenetic analysis of fumarate-induced trained macrophages.
β-glucan- and fumarate-induced epigenetic changes. (A) Boxplots of H3K4me3 and H3K27ac reads/
peak for fumarate “up” and fumarate “down” peaks. (B) Dynamic H3K4me3 and H3K27ac peaks (genomic
regions with signal) were assigned to the nearest protein-coding gene using GREAT (http://bejerano.
stanford.edu/great/public/html/). The top pathways from GREAT or DAVID gene ontology tools are shown
as a table. Selected genes in the top pathways are also shown. (C) Heat map showing H3K27ac signal
intensity at regions that are modulated by β-glucan (“BG up” and “BG down”) or fumarate (“Fumarate up”
and “Fumarate down”). Each row of the heat map is a peak, and the y axis shows distance from the center
of the peak (+/- 12kb). The height of the heat map corresponds to the number of peaks.

| 157
Chapter 8

Figure S6. Related to Figure 5. Modulatation of epigenetic enzymes by fumarate. Human monocytes
were stimulated for 4h, 12h, and 24h with 50μM fumarate, after which mRNA was isolated and expression
of histone methyltransferases or demethylases was determined. Or human monocytes were trained with
β-glucan. After 24h cells were washed and after 5 days of rest KDM5 expression was determined.

158 |
 Immunometabolism in Trained Immunity

Supplemental Tables
Table S1, related to Figure 1 and Figure S1. Pathway enrichment based on the metabolomics data
constructed with the MetaboAnalyst tool (with all measured metabolites as a background). Raw data
intensities were used for analysis. Details of the procedure are described in Methods.

Table S2, related to Figure 1 and Figure S1. Pathway enrichment of upregulated metabolites based on
the metabolomics data constructed with the Pathway-tools tool. Metabolites were considered significant
if they have a FDR (Benjamini-Hochberg) of < 0.1. Details of the procedure are described in Methods.

Table S3, related to Figure 1 and Figure S1. Pathway enrichment based on the transcriptomics data
constructed with the Pathway-tools tool. Genes were considered significant if they have a FDR (Benjamini-
Hochberg) of < 0.1. Details of the procedure are described in Methods.

Digital versions of Tables S1-3 can be obtained by sending a request to the author.
Table S4. Primers used for qPCR.

Epigenetic promoter primers

Gene Forward (5’-->3’) Reverse (5’-->3’)

MYO AGCATGGTGCCACTGTGCT GGCTTAATCTCTGCCTCATGAT

H2B TGTACTTGGTGACGGCCTTA CATTACAACAAGCGCTCGAC

TNFA GTGCTTGTTCCTCAGCCTCT ATCACTCCAAAGTGCAGCAG

IL6 AGGGAGAGCCAGAACACAGA GAGTTTCCTCTGACTCCATCG 8

qPCR primers

Gene Forward (5’-->3’) Reverse (5’-->3’)

B2M ATGAGTATGCCTGCCGTGTG CCAAATGCGGCATCTTCAAAC

HPRT CCTGGCGTCGTGATTAGTGAT AGACGTTCAGTCCTGTCCATAA

HK2 TTGACCAGGAGATTGACATGGG CAACCGCATCAGGACCTCA

ALDOA CAGGGACAAATGGCGAGACTA GGGGTGTGTTCCCCAATCTT

ENO1 TGGTGTCTATCGAAGATCCCTT CCTTGGCGATCCTCTTTGG

LDHA ATGGCAACTCTAAAGGATCAGC CCAACCCCAACAACTGTAATCT

KDM5A AGCCGAGTTGGGAGGAGTT TGGACTCTTGGAGTGAAACGA

KDM5B CCATAGCCGAGCAGACTGG GGATACGTGGCGTAAAATGAAGT

KDM5C GGGTCCGACGATTTCCTACC ATGCCCGATTTCTCTGCGATG

KDM5D CAAGACCCGCTTGGCTACATT TTGGACGCGAGGAGTAAATCT

KDM3A GTGCTCACGCTCGGAGAAA GTGGGAAACAGCTCGAATGGT

KDM6B CACCCCAGCAAACCATATTATGC CACACAGCCATGCAGGGATT

| 159
 Chapter 9

The mevalonate pathway drives

metabolic and epigenetic reprogramming
during induction of trained immunity

Siroon Bekkering*, Rob J.W. Arts*, Boris Novakovic, Yiannis Kourtzelis, Calin
D. Popa, Rob ter Horst, Julia van Tuijl, Anna Simon, Frank L. van de Veerdonk,
Triantafyllos Chavakis, Leo A.B. Joosten, Jos W.M. van der Meer, Hendrik G.
Stunnenberg, Niels P. Riksen#, Mihai G. Netea#.

*These authors have equally contributed to the study

#
These authors share senior authorship

Submitted
Chapter 9

ABSTRACT

Innate immune cells can display functional adaptation characteristics after infections
or vaccinations, a process designated trained immunity, which is mediated by
intimate interactions between immunological, metabolic, and epigenetic pathways.
Metabolome and transcriptome analysis of human trained monocytes identified the
cellular cholesterol synthesis pathway to play an important role in trained immunity.
Pharmacological and genetic modulation of the cholesterol synthesis pathway
revealed that the metabolite mevalonate is a crucial mediator of trained immunity.
Mevalonate induces a trained immunity phenotype in human primary monocytes via
IGFR and mTOR activation, accompanied by whole-genome histone modifications
in inflammatory pathways. HMG-CoA-reductase inhibitors (statins) that block
mevalonate generation prevent trained immunity with regards to cytokine production,
activation of glycolysis, and enrichment of H3K4me3 histone marks. Finally,
monocytes of patients with hyper IgD syndrome (HIDS), which are mevalonate
kinase deficient and accumulate mevalonate, demonstrate a trained immunity
phenotype at both immunological and epigenetic level, which could likely explain
the attacks of fever and inflammation of these patients. In conclusion, unraveling
the role of the mevalonate pathway for the induction of trained immunity contributes
to our understanding of the pathophysiology of HIDS, and identifies potential novel
therapeutic strategies in clinical conditions linked with excessive induction of trained
immunity.

162 |
 Mevalonate-induced trained immunity

The immune system is classically divided into the innate and the adaptive immune
system. The innate immune system is rapid, relatively non-specific and cannot
build immunological memory, whereas the adaptive immune system, in turn, is
slower, specific, and can build memory. However, the recent observation that
innate immune cells can exert adaptive characteristics and can build a non-specific
memory challenged this paradigm (1). This is supported by a wide variety of recent,
but also older studies, in plants, invertebrates and mammals (2, 3). Cells of the
innate immune system, such as monocytes and NK-cells, are able to build memory,
a process that is dependent on epigenetic changes (4). Once these cells encounter
a secondary stimulus, either similar or unrelated to the first insult, their response is
altered, which could result both in a stronger or attenuated response. The induction
of a non-specific memory resulting in an enhanced function of the innate immune
system was termed ‘trained (innate) immunity’ (1, 2).
Analysis of differentially regulated pathways in trained monocytes and
macrophages already revealed an important role for changes in intracellular
metabolism. A shift from oxidative phosphorylation to aerobic glycolysis (the Warburg
effect), regulated via the mTOR/HIF-1α pathway was identified as a central regulatory
mechanism for β-glucan-induced trained immunity (5). Shifts in cellular metabolism
are known to be important drivers of cell phenotype and activation (6). Interestingly,
not only glucose metabolism, but also other metabolic pathways play an important
role in reprogramming and polarization of cells. Recently, we described that also
glutaminolysis and accumulation of fumarate contributes to the trained-immunity
phenotype, by inhibiting KDM5 demethylases and thus influencing the epigenetic 9
remodeling (7). Here, we sought to unravel how the cholesterol synthesis pathway
modulates trained immunity and epigenetic reprogramming, combining transcriptomic
and epigenomic studies in both β-glucan and oxLDL trained monocytes. We validated
the role of these processes in patients with hyper IgD syndrome (HIDS), who have a
defective cholesterol synthesis pathway due to mevalonate kinase deficiency.

MATERIALS AND METHODS

Study subjects - Inclusion of healthy controls and HIDS patients was approved
by the local institutional review board (CMO region Arnhem-Nijmegen, #2299
2010/104) and conducted according to the principles of the International Conference
on Harmonization-Good Clinical Practice guidelines.
Cells and reagents - Buffy coats from healthy donors were obtained after written
informed consent (Sanquin blood bank, Nijmegen, The Netherlands). β-glucan (β-1,3-
(D)-glucan) was kindly provided by Professor David Williams (College of Medicine,
Johnson City, USA). oxLDL was freshly prepared as previously described (8). Stimuli
and pharmacological inhibitors used include lipopolysaccharide (LPS; Sigma-

| 163
Chapter 9

Aldrich, St. Louis, MO; from E. coli serotype 055:B5, further purified as described
(9)), Pam3Cys (EMC microcollections, Tübingen, Germany), PolyI:C (Invivogen,
San Diego, CA, USA), Macrophage-activating lipopeptide-2 (MALP2; Sigma-
Aldrich), Phytohemagglutinin (PHA; Sigma-Aldrich), fluvastatin sodium hydrate
(Sigma-Aldrich), (R)-mevalonic acid lithium salt (Sigma-Aldrich), zaragozic acid
(SantaCruz Biotechnology), 6-fluoromevalonate (Sigma-Aldrich), 2-deoxyglucose
(Sigma-Aldrich), rapamycin (Sigma-Aldrich), methyltioadenosine (Sigma-Aldrich),
IGF1-R inhibitor Picropodophyllin (IGFR-i, Sigma-Aldrich), LXR-inhibitor GSK2033
(Axon Medchem), or PPARδ-inhibitor GSK3787 (Tocris).
PBMC and monocyte isolation - PBMC isolation was performed by dilution of blood
in pyrogen-free PBS and differential density centrifugation over Ficoll-Paque (GE
healthcare, UK). Cells were washed thrice in PBS. Percoll isolation of monocytes
was performed as previously described (10). Briefly, 150-200x10^6 PBMCs were
layered on top of a hyperosmotic Percoll solution (48,5% Percoll (Sigma-Aldrich, St
Louis, MO, USA), 41,5% sterile H2O, 0.16M filter sterilized NaCl) and centrifuged
for 15min at 580 g. The interphase layer was isolated and cells were washed with
cold PBS. Cells were resuspended in RPMI culture medium (Roswell Park Memorial
Institute medium; Invitrogen, CA, USA) supplemented with 50μg/ml gentamicin, 2mM
glutamax, and 1mM pyruvate and counted. An extra purification step was added by
adhering Percoll-isolated monocytes to polystyrene flat bottom plates (Corning, NY,
USA) for 1h at 37°C; subsequently a washing step with warm PBS was performed
to yield maximal purity.
Monocyte training and inhibition experiments - Monocytes were trained as
described before (11). Briefly, 1x10^5 cells were added to flat-bottom 96-well plates.
After washing with warm PBS, monocytes were incubated either with culture medium
only as a negative control or 5μg/ml of β-glucan, 10μg/ml oxLDL or 100-1000 μM (R)-
mevalonic acid for 24h (in 10% pooled human serum). Cells were washed once with
200μl of warm PBS and incubated for 5d in culture medium with 10% pooled human
serum, and medium was changed once. Cells were restimulated with either 200μl
RPMI, LPS 10ng/ml, or Pam3Cys 10μg/ml. After 24h supernatants were collected
and stored at -20oC. In some experiments, cells were pre-incubated (before β-glucan,
mevalonate or oxLDL training) for 1h with 20μM fluvastatin sodium hydrate, 1-5µM
zaragozic acid, 200µM 6-fluoromevalonate, 10μM GSK2033, or 10μM IGFR-i.
Concentrations were chosen as being highest non-toxic concentrations, based on
pilot-experiments (not shown).
Mouse experiments - Blood mononuclear cells from wild type mice were isolated
using the density gradient cell separation medium histopaque 1083 (Sigma). Cells
were incubated with β-glucan (5μg/ml) or mevalonate (500μM) for 24h in the presence
of 20ng/ml recombinant mouse granulocyte-macrophage colony-stimulating factor

164 |
 Mevalonate-induced trained immunity

(GM-CSF, PeproTech). Cells were then washed with PBS and were cultured until
day 6 in 10% fetal bovine serum. Afterwards, they were stimulated with LPS (10ng/
ml) for 24h in RPMI without fetal bovine serum. Concentrations of TNFα and IL-6
were measured in cell culture supernatants.
The effect of fluvastatin (20μM) and potent inhibitors for LXR (1μM, 10μM;
GSK2033, Axon Medchem) or PPARδ (1μM, 10μM; GSK3787, Tocris) on β-glucan-
induced training was examined. Compounds were added during the first 24h.
Treatment of cells with dimethyl sulfoxide (DMSO; Sigma) served as control in the
case of LXR and PPARδ antagonism.
Cytokine and lactate measurements - Cytokine production was determined in
supernatants using commercial ELISA kits for human IL-1β, TNFα (R&D systems,
MN, USA), human IL-6 (Sanquin, Amsterdam, The Netherlands), and mouse TNFα
and IL-6 (Meso Scale Discovery) following the instructions of the manufacturer.
Lactate concentration was measured using a Lactate Fluorometric Assay Kit
(Biovision, CA, USA).
Foam cell formation - To induce foam cell formation at day 6, trained macrophages
were incubated with RPMI alone or RPMI containing oxidized LDL at 50µg/mL for
24h. Incubation with this concentration of oxLDL alone caused no secretion of IL-
6, TNFα or MCP-1, compatible with absence of endotoxin in the prepared LDL
fractions. Accumulation of oxLDL was visualized by Oil-Red-O staining as described
before (12).
Western blotting - 10x10^6 monocytes were trained in vitro with (R)-mevalonate
with or without 10μM IGFR-i in 10cm-Petri dishes in 10ml-medium volumes. After 9
resting for 5 days in culture medium, the cells were harvested for Western blotting.
Total protein amounts were determined by BCA assay (Thermo Fisher Scientific) and
equal amounts of proteins were loaded on pre-casted 4-15% gels (Biorad, CA, USA).
The separated proteins were transferred to a nitrocellulose membrane (Biorad),
which was blocked in 5% BSA (Sigma). Incubation overnight at 4°C with rabbit
polyclonal antibodies against p-S6K, p-4EBP1, p-mTOR (Cell Signaling, Danvers,
MA, USA), and actin (Sigma) were used to determine the protein expression,
which was visualized using a polyclonal secondary antibody (Dako, Belgium) and
SuperSignal West Femto Substrate (Thermo Fisher Scientific).
RNA sequencing and chromatin immunoprecipitation - 10x10^6 monocytes
were trained in vitro with β-glucan, oxLDL or (R)-mevalonate in 10cm-Petri dishes
in 10ml-medium volumes. After resting for 5 days in culture medium, the cells were
harvested for RNA extraction or chromatin immunoprecipitation.
RNA extraction and cDNA synthesis: Monocytes isolated from HIDS patients
and controls, and in-vitro derived naive and mevalonate exposed macrophages,
were lysed in Trizol reagent and stored at -80°C (Life Technologies). Total RNA

| 165
Chapter 9

was extracted from cells using the Qiagen RNeasy RNA extraction kit (Qiagen,
Netherlands), using on-column DNAseI treatment. Ribosomal RNA was removed
using the riboZero rRNA removal kit (Illumina). RNA was then fragmented into
200bp fragments by incubation for 4min at 95°C in fragmentation buffer (200 mM
Tris-acetate, 500mM Potassium Acetate, 150mM Magnesium Acetate, pH 8.2). First
strand cDNA synthesis was performed using SuperScript III (Life Technologies),
followed by synthesis of the second cDNA strand. Library preparation was performed
using the KAPA hyperprep kit (KAPA Biosystems), using the USER enzyme to
degrade the second cDNA strand. Quality of cDNA and the efficiency of ribosomal
RNA removal was confirmed using quantitative RT-PCR using the IQ Sybr Supermix,
with primers for GAPDH, 18S and 28S rRNA.
Chromatin immunoprecipitation (ChIP): Purified cells were fixed with 1%
formaldehyde (Sigma-Aldrich) at a concentration of approximately 15x10^6 cells/
ml. Fixed cell preparations were sonicated using a Diagenode Bioruptor Pico
sonicator using 5 cycles of 30s on, 30s off. One µg of chromatin (approx. 0.5-1
million cells) was incubated with dilution buffer, 12µl protease inhibitor cocktail and
1µg of H3K27ac antibody or H3K4me3 (Diagenode) to a final volume of 300µl, and
incubated overnight at 4oC with rotation. Protein A/G magnetic beads were washed
in dilution buffer with 0.15% SDS and 0.1% BSA, added to the chromatin/antibody
mix and rotated for 60min at 4oC. Beads were washed with 400µl buffer for 5min at
4oC with five rounds of washes. After washing, chromatin was eluted using 200 µl
elution buffer for 20min. Supernatant was collected, 8µl 5M NaCl, 3µl proteinase
K were added and samples were incubated for 4 hours at 65oC. Finally, samples
were purified using Qiagen Qiaquick MinElute PCR purification Kit and eluted in 20µl
elution buffer.
For qPCR analysis, samples were analyzed using a comparative Ct method
in which myoglobulin was used as a negative control and H2B as a positive
control according to the manufacturer’s instructions. The following primers
were used for this analysis: MYO forward AGCATGGTGCCACTGTGCT;
MYO reverse GGCTTAATCTCTGCCTCATGAT; H2B forward
TGTACTTGGTGACGGCCTTA; H2B reverse CATTACAACAAGCGCTCGAC;
TNFA forward GTGCTTGTTCCTCAGCCTCT; TNFA reverse
ATCACTCCAAAGTGCAGCAG; IL6 forward AGGGAGAGCCAGAACACAGA; IL6
reverse GAGTTTCCTCTGACTCCATCG.
Library preparation for sequencing: Illumina library preparation was done using
the Kapa Hyper Prep Kit (Kapa Biosystems). For end repair and A-tailing double
stranded DNA was incubated with end repair and A-tailing buffer and enzyme and
incubated first for 30min at 20oC and then for 30min at 65oC. Subsequently adapters
were ligated by adding 30µl ligation buffer, 10 Kapa l DNA ligase, 5µl diluted adaptor

166 |
 Mevalonate-induced trained immunity

in a total volume of 110µl and incubated for 15min at 15oC. Post-ligation cleanup
was performed using Agencourt AMPure XP reagent and products were eluted in
20µl elution buffer. Libraries were amplified by adding 25µl 2x KAPA HiFi Hotstart
ReadyMix and 5µl 10x Library Amplification Primer Mix and PCR, 10 cycles. Samples
were purified using the QIAquick MinElute PCR purification kit and 300bp fragments
selected using E-gel. Correct size selection was confirmed by BioAnalyzer analysis.
Sequencing was performed using the Illumina NextSeq500 machine and generated
43bp paired end reads. Samples for RNAseq were treated to the above protocol
exactly, except for a single additional step: After post-ligation cleanup, and before
library amplification, samples were incubated with 3μL USER enzyme for 15min at
37°C to digest the second cDNA strand.
RNAseq data analysis: To infer gene expression levels, RNAseq reads were
aligned to the Ensembl v68 human transcriptome using Bowtie 1 (13). Quantification
of gene expression was performed using MMSEQ (https://github.com/eturro/mmseq)
(14). Differential expression was determined using DEseq (http://bioconductor.org/
packages/release/bioc/html/DESeq.html) (15). Differentially expressed genes were
determined using pair-wise comparison between treatments, with a fold change
>1.5, adjusted p value of <0.1, and RPKM >1.
The metabolic maps were created based on output generated with Escher (16).
ChIPseq data analysis: Sequencing reads were aligned to human genome
assembly hg19 (NCBI version 37) using bwa (17). Duplicate and low quality reads
were removed after alignment using Samtools and Bamtools (18, 19). For peak calling
the BAM files were first filtered to remove the reads with mapping quality less than 15, 9
followed by fragment size modeling (http://code.google.com/p/phantompeakqual-
tools/). MACS2 (http://github.com/taoliu/MACS/) was used to call the peaks (20).
H3K27ac peaks were called using the default (narrow) setting. Reads/peak tables
were merged using Bedtools (21). Data were normalized using the R package
DESeq1 and then pair-wise comparisons were performed (fold change 1.5, adjusted
p-adj value <0.1 and reads/peal ≥10 in at least in any condition) to determine the
differential peaks.
Statistics - In-vitro monocyte experiments were performed at least 6 times and
analyzed using a Wilcoxon signed-rank test or one-way ANOVA, where applicable.
A P-value below 0.05 was considered statistically significant. All data were analyzed
using Graphpad prism 5.0 (La Jolla, CA, USA). * p < 0.05, ** p < 0.01. Data are
shown as means ± SEM.

| 167
 A
4,4-dimethylcholesta-
8,14,24-trienol 4-Methylzymosterol
Acetyl-CoA
intermediate 1
4,4-dimethyl- Acetyl-CoA
zymosterol

Acetoacetyl-CoA Lanosterol 4-Methylzymosterol HMG-CoA

intermediate 2
Statins
Mevalonate

Chapter
CoA
9
Hydroxymethylglutaryl- S-Squalene-
2,3-epoxide
Zymosterol
intermediate 2
HIDS
Mevalonate-5-P
(transport reaction)

Hydroxymethylglutaryl- Squalene Zymosterol Mevalonate-5-PP

CoA
6-Fluoromevalonate
(transport reaction)
Isopentyl-PP
Hydroxymethylglutaryl- Farnesyl Zymostenol
CoA diphosphate
Geranyl -PP

R-Mevalonate Farnesyl Lathosterol Farnesyl-PP Geranylgeranyl-PP

diphosphate
ZaragozicAcid
Squalene
Prenylatedproteins
R-5-Phosphomevalonate Geranyl 7-Dehydrocholesterol 21 steps
diphosphate

Cholesterol Intracellular signaling

Isopentenyl
diphosphate
Dimethylallyl
Cholesterol
diphosphate
R-5-Diphospho-
mevalonate

2
log2FoldChange
1
0
A

1
S2

R
VK

VK

VD

I1

I2
PS

1
LE

TM A1
F2

N 1

SD L

D B4

24

D D

7
AT

FT

R
H

LS

EB
C

5
ID

ID

R
7S
C

SQ

51

17
SD

SC

C
M
PM

FD

SM
AD

AD

M
G
AC

FD

C
G

H
M

YP

H
M
H

M
H
H

H
B TNFα
TNFα TNF α
LPS restimulation Lactate
LPS restimulation LPS restimulation RPMI
6000 * * 3000 * 8000
* * 5000 β-glucan
* *
4000 6000
4000 2000 *
pg/mL

pg/ml
3000
pg/mL

uM

4000
ns 2000
2000 1000
2000
1000

0 0 0 0
- - - - 1 2 5 - + - +
- + - + + +
Fluvastatin Fluvastatin 6-fluoromevalonate
Zaragozic Acid (uM)
C TNFα D TNFα
LPS restimulation LPS restimulation Lactate TNFA
4000 * *
2000 2000 3 *
* * * * RPMI
fold %input H3K4me3

3000 oxLDL
1500 1500 ns
2
pg/mL
pg/ml

2000 ns
uM

1000 1000

1
500 1000 500

0 0 0 0
- + - + - + - + - + - + -/+ - +
Fluvastatin Fluvastatin Fluvastatin Fluvastatin

RPMI RPMI oxLDL oxLDL

+Fluvastatin +Fluvastatin

Figure 1 - The cholesterol synthesis pathway in trained immunity. (A) Transcriptional expression
of macrophages five days after β-glucan exposure. Red arrow = significant upregulation. Overview of
the cholesterol synthesis pathway and the used inhibitors. (B) Monocytes were trained with β-glucan +/-
inhibitors of the cholesterol synthesis pathway. Five days after β-glucan exposure, lactate concentrations
were measured in the supernatants and macrophages were restimulated for 24h with LPS and TNFα
concentrations were measured in the supernatant. (n=6, mean ± SEM). (C) Mouse blood mononuclear

168 |
 Mevalonate-induced trained immunity

RESULTS
Activation of the cholesterol synthesis pathway, but not the synthesis of cho-
lesterol itself, is essential for induction of trained immunity
β-glucan can induce a long-term reprogramming in monocytes and macrophages,
resulting in enhanced function (22). Integration of the transcriptome and metabolome
of β-glucan-trained macrophages revealed an upregulation of several major metabolic
pathways, such as glucose metabolism, glutaminolysis, and the cholesterol synthesis
pathway (5, 7). The expression of several key enzymes in the cholesterol synthesis
pathway was strongly increased by β-glucan training (Figure 1A), leading to the
hypothesis that the cholesterol synthesis pathway contributes to trained immunity.
Pharmacological inhibition of the rate-limiting enzyme HMG-CoA-reductase with
fluvastatin prevented the induction of trained immunity by β-glucan, illustrated by
decreased cytokine production upon re-stimulation. Moreover, lactate production
was also decreased, indicating reduced glycolysis, which is an important component
of the trained immunity phenotype (Figure 1B) (7). Additionally, when mouse blood
mononuclear cells were trained with β-glucan, the induction of cytokine production
upon LPS restimulation could also be inhibited with fluvastatin (Figure 1C). To further
unravel which part of the cholesterol synthesis pathway is essential for this effect,
several inhibitors of enzymes downstream of HMG-CoA-reductase were assessed
for their capacity to modulate trained immunity (Figure 1A,B). To study whether
cholesterol synthesis itself is necessary for training, cells were preincubated with
zaragozic acid A, which inhibits squalene synthase. Preincubation of monocytes
with zaragozic acid, however, did not inhibit the induction of pro-inflammatory 9
cytokine production (Figure 1B), indicating that cholesterol itself is not essential
for trained immunity. Secondly, 6-fluoromevalonate was used to inhibit mevalonate
pyrophosphate (PP) decarboxylase. Mevalonate PP decarboxylase catalyzes the
formation of isopentenyl-PP from mevalonate-5-PP. Pre-incubation of monocytes
with 6-fluoromevalonate augmented the induction of pro-inflammatory cytokine
production by β-glucan (Figure 1B), indicating that the accumulation of a molecule
upstream of 6-fluoromevalonate plays a role in the induction of cytokine production,
and excluding a role for protein prenylation.
We have previously reported that brief exposure to oxLDL also induces trained
immunity (23). Pre-incubation of cells with fluvastatin also prevented oxLDL-induced

cells were trained with β-glucan +/- fluvastatin on day 1. At day 6, cells were stimulated for 24h and
cytokines were determined in the supernatants. (n=6, mean ± SEM). (D) Monocytes were trained with
oxLDL +/- fluvastatin for 24h. Five days later, epigenetic (H3K4me3) changes at the TNFA promoter and
lactate concentrations in the supernatant were measured. Macrophages were also restimulated for 24h
with LPS to determine TNFα concentrations in the supernatant. (n=6, mean ± SEM). (E) Monocytes were
trained with oxLDL +/- fluvastatin for 24h. Five days later foam cell formation was induced by exposure to
high concentration of oxLDL. After 24h cells were stained with Oil-Red-O. (* p < 0.05).

| 169
Chapter 9

A TNFα
LPS restimulation
TNFα
LPS restimulation
4000 * * * 8000
RPMI RPMI
β-glucan * ** ** oxLDL
3000 ** 6000

pg/mL
pg/mL

2000 4000 **

1000 2000

0 0
Mevalonate : - + - + - + - + Mevalonate : - + - + - + - +
Fluvastatin : - - + + - - + + Fluvastatin : - - + + - - + +
TNFα TNFα
B TNFα C LPS restimulation D LPS restimulation
LPS restimulation 1500 6000
* * RPMI
2500 ** *
* Mevalonate
2000 **
1000 4000

pg/ml
pg/ml

1500
pg/mL

1000 500 2000

500

0 0 0
- 200 500 1000 - + - +
-

e
at

6-fluoromevalonate
on

Mevalonate (uM)
al
ev
M

Lactate
E F TNF α
RPMI restimulated LPS restimulation
1000 **
LPS restimulated 4000 *
800 * RPMI
3000
Mevalonate
600 ** β-glucan
pg/ml
uM

400 2000

200 1000
0
0
e

e
I

I
M
at

at
M

TA

TA

TA
-

-
RP

on
RP

on

M
al
al

ev
ev

M
M

G TNFA IL6
Figure 2 - Mevalonate induces trained
*
10 immunity. (A) Adding mevalonate during the
2.0

8
* first 24h can rescue the inhibition of oxLDL/β-
% input H3K4me3

% input H3K4me3

1.5
glucan-induced training by fluvastatin. (n=6,
6 mean ± SEM). (B) Human and (C) mouse
1.0
4 monocytes were trained with mevalonate
0.5 for 24h and restimulated with LPS at day 6.
2
TNFα concentration was measured in the
0 0.0 supernatants. (n=6, mean ± SEM). (D) When
6-fluoromevalonate was added during the
I

e
M
M

at

at
RP
RP

first 24h, training with mevalonate could be

on

on
al

al
ev

ev

enhanced. (n=6, mean ± SEM). (E) Lactate

M

production of RPMI or LPS re-stimulated mevalonate-trained macrophages at day 6. (n=10, mean ±

SEM). (F) Adding a methyltransferase inhibitor (MTA) inhibits the induction of trained immunity. (N=6,
mean ± SEM). (G) H3K4me3 at promoters of TNFA and IL6 was assessed at day 5 of mevalonate-trained
macrophages. (n=6, mean ± SEM, * p < 0.05, ** p < 0.01).

170 |
 Mevalonate-induced trained immunity

trained immunity, both in terms of cytokine production upon restimulation and

decreased lactate production and glycolysis. Incubation with fluvastatin prevented
epigenetic reprogramming of both oxLDL and β-glucan-induced training (Figure 1D,
(7)), and prevented increased foam cell formation, which was induced by training
with oxLDL (Figure 1E). OxLDL- and β-glucan-induced training was associated
with enrichment of H3K4me3 on the promoter of TNFA, which was prevented by
fluvastatin (Figure 1D, (7)).

Mevalonate induces trained immunity by epigenetic reprogramming

As the induction of trained immunity is inhibited by fluvastatin and increased with
6-fluoromevalonate, we hypothesized that mevalonate is the metabolite from the
cholesterol synthesis pathway that drives the development of the trained immunity
phenotype. Indeed, addition of exogenous mevalonate recaptured the β-glucan- and
oxLDL-induced trained phenotype in the presence of fluvastatin (Figure 2A). We
further investigated the induction of training by mevalonate and found that incubation
of monocytes with mevalonate on day 0 augmented cytokine production upon
restimulation 6 days later (Figure 2B). Again, this could be reproduced in mouse
monocytes (Figure 2C). Furthermore, pre-incubation with 6-fluoromevalonate
potentiated the effect of mevalonate (Figure 2D). Interestingly, lactate production
was also increased in mevalonate-trained macrophages (Figure 2E). In addition,
to determine the role of histone methylation in the induction of trained immunity by
mevalonate, we added methyltioadenosine (MTA, a non-selective methyltransferase
inhibitor) to the in-vitro system during the first 24h. Addition of MTA prevented 9
mevalonate-induced trained immunity in terms of increased cytokine production
(Figure 2F). Indeed, mevalonate induced an enrichment of H3K4me3 on the
promoters of IL6 and TNFA (Figure 2G), similar to the training by β-glucan and
oxLDL (22, 23). The increase in lactate suggested activation of the glycolytic
pathway similar to β-glucan-trained macrophages (5). Indeed, inhibition of glycolysis
with 2-deoxyglucose and inhibition of mTOR with rapamycin prevented mevalonate-
induced trained immunity (Figure 3A). Western blot analysis showed an increase
in phosphorylated mTOR upon training with mevalonate, as well as an increase in
phosphorylated mTOR-targets: S6K and 4EBP1 (Figure 3B). This shows a crucial
role for glucose metabolism and mTOR signaling in mevalonate-induced trained
immunity. In contrast, induction of training by mevalonate could not be counteracted
by inhibition of LXR or PPARδ (data not shown).
Previous studies have shown that mevalonate signals via the IGF1 receptor
(IGF1-R) (24). To study whether mevalonate exerts its effects extracellularly in
an autocrine fashion, we inhibited the IGF1-R during the 6 days resting period of
β-glucan training. IGFR-i diminished the effect of β-glucan training (Figure 3C). Next,

| 171
Chapter 9

172 |
 Mevalonate-induced trained immunity

Figure 3 – Signaling in mevalonate-trained monocytes. (A) When 2-deoxyglucose (2-DG) or rapamycin

were added during the first 24h, mevalonate and β-glucan-induced training could be inhibited. (n=6, mean
± SEM). (B) Western blot showing increased p-mTOR, p-S6K and p-4EBP1 upon mevalonate training.
Treatment with IGF1-R inhibitor (IGFR-i) inhibited these effects. (C) Inhibition of the IGF1-R (IGFR-i)
during resting of β-glucan-induced training inhibits the induction of trained immunity. (D) When IGFR-i was
added to mevalonate training, the induction of trained immunity was diminished. (n=6, mean ± SEM). (E)
Blocking the IGF1-R inhibits the epigenetic changes induced by mevalonate training. (n=6, mean ± SEM).
(F) Proposed working mechanism of mevalonate-induced trained immunity. (* p < 0.05).

we inhibited mevalonate training itself with this inhibitor and showed that the IGF1-R
is responsible for signal-transduction of mevalonate training (Figure 3D). When the
IGF1-R was blocked, also the increase in mTOR, S6K and 4EBP1 phosphorylation
was diminished (Figure 3B), as well as the increased H3K4me3 (Figure 3E), indicating
that mevalonate induces epigenetic changes via IGF1-R and subsequently mTOR,
S6K and 4EBP1 (Figure 3F).
To further elucidate the mechanism through which mevalonate induces trained
immunity, we performed RNA sequencing and a whole-genome assessment of the
histone mark H3K27ac by ChIP sequencing in mevalonate-trained macrophages.
Monocytes were trained as described above, and after 5 days of rest (before
restimulation), monocyte-derived-macrophages were harvested for ChIP and RNA
sequencing (Figure 4A). Similar to fumarate-trained macrophages (7), no consistent
differences were found in transcription profiles at this time point. This is consistent with
previous observation for β-glucan-trained macrophages that the major differences
in gene expression are present during the first 24h after β-glucan stimulation,
whereas at later time points transcriptional differences are less pronounced (25).
Whole genome epigenetic analysis of mevalonate-trained macrophages, by 9
chromatin immunoprecipitation of histone 3 lysine 27 acetylation (H3K27ac) did
reveal noticeable differences between trained and non-trained macrophages. In total
233 defined peaks showed an upregulation of H3K27ac and 554 peaks showed
a downregulation in mevalonate-trained macrophages (Figure 4B-D, Table S1).
When these peaks were compared with β-glucan-trained macrophages, of the
233-upregulated peaks only few were also found in β-glucan-trained macrophages.
However, of the 554 downregulated peaks 397 were also found in the β-glucan-
trained macrophages. Of these peaks 45% also showed a downregulation of at least
2-fold, showing a comparable signature in mevalonate and β-glucan-induced trained
immunity (Table S1). Pathway analysis of these differentially regulated peaks in
mevalonate-trained monocytes, can be found in Figure 4E and shows the modulation
of several important inflammatory pathways.

Monocytes of HIDS patients with mevalonate kinase deficiency have a trained

immunity phenotype with higher cytokine production
Mevalonate kinase deficiency in humans leads to Hyper-IgD syndrome (HIDS), an

| 173
Chapter 9

A Mevalonate training model B H3K27ac change in mevalonate exposed Mf

d0 1h 4h 24h d6

Wash
out 233 554
up down
peaks peaks
RPMI (-)
Naive-Mf
Mevalonate
Mev-Mf

C H3K27ac peaks affected by mevalonate exposure D Intensity of H3K27ac signal around peak
up down
80
120
H3K27ac level (reads / peak)

60 100

H3K27ac signal
80
40
60

20 40

20

0 0
Donor 1

Donor 2

Donor 1

Donor 2

Donor 1

Donor 2

Donor 1

Donor 2

Donor 1

Donor 2

Donor 1

Donor 2
Naive-Mf Mev-Mf Naive-Mf Mev-Mf Naive-Mf Mev-Mf

E Top pathways linked to genes near mevalonate -modulated H3K27ac peaks

Term Name Binom Raw P-Value Binom FDR Q-Val Observed Hits
cellular response to organic substance 1.14E-09 1.19E-05 48
cellular response to chemical stimulus 1.75E-08 4.58E-05 51
immune system process 1.10E-07 1.28E-04 44
H3K27ac up in response to organic substance 1.33E-07 1.39E-04 52
mevalonate response to oxygen-containing compound 2.21E-07 1.78E-04 34
natural killer cell activation 8.21E-07 4.28E-04 6
Top pathways
cellular response to oxygen-containing compound 8.42E-07 4.19E-04 25
response to lipid 1.22E-06 4.88E-04 25
regulation of phospholipid catabolic process 4.69E-06 1.81E-03 3
cellular response to lipopolysaccharide 4.88E-06 1.82E-03 9
cellular response to molecule of bacterial origin 5.60E-06 2.02E-03 9
cellular response to lipid 6.60E-06 2.30E-03 16

Term Name Binom Raw P-Value Binom FDR Q-Val Observed Hits
immune system process 1.55E-14 1.61E-10 104
H3K27ac down regulation of immune system process 2.30E-13 1.20E-09 76
in mevalonate lymphocyte activation 4.26E-12 1.48E-08 37
leukocyte activation 9.70E-12 2.53E-08 40
Top pathways cell activation 1.47E-11 3.06E-08 51
positive regulation of cell activation 3.72E-11 6.48E-08 32
T cell activation 5.61E-11 8.37E-08 28

Figure 4 - Epigenetic changes induced by mevalonate. (A) Experimental set-up for mevalonate-
induced trained macrophages. (B) Summary of H3K27ac peaks that show higher or lower deposition in
mevalonate-trained cells relative to control macrophages. (C) Boxplots of H3K27ac peaks. (D) Heatmap
of H3K27ac intensity at peaks that show increased and decreased H3K27ac in mevalonate-trained
macrophages. Data is plotted over an area of +/- 12kb from peak center. (E) Pathway analysis of H3K27ac
differentially regulated genes. (n=2).

174 |
 Mevalonate-induced trained immunity

A IL-1β IL-6
60000
3000
* HIDS * HIDS
Control Control

2000 40000

pg/ml
*
pg/ml

*
1000
* 20000 *
*
* *
0 0

C
C
R I
I

LP 1
1

L P 00

A
A

p o I :C
M 2
P2

I :C
PM
PM
C

C
I

L P 00

p o :C
I :C
M 2
P2

10

P
P3
P3
PM

PM

PH
PH
S
S
10

1
P3

P3

AL
AL
S

LP
I
1

ly
ly
AL

AL

S
S
LP

LP

ly

ly
R

po
M
LP
po
M
LP

Color Key
TNFα B HIDS and controls response to LPS and Histogram

Mean log2RPKM (n=3 each)

80
800 * HIDS row Z-score plotted

Count
40
Control
600
SOCS3
DLL4
AMPD3
SGPP2
NAMPTL
ITGA1
SLC30A4
TRAF3IP2
HS3ST3B1
IRAK2
TNIP3
RRAD
C1QTNF1
FSD1L
MMP14
NAMPT
IL1B
PPAP2B
KIAA0226L
CCL4
AK4
SLC11A2
ADORA2A
ABTB2
AF165138.7
TPRA1
TRIM36
CCL7
C22orf45
AKR1B1
OSGIN2
MGLL
IL6
CCL3
ITGB8
GALNT6
ZC3H12A
HEY1
TRAF1
MFSD2A
BASP1
GPR137B
GJB2
CCL3L1

0
GCKR
IL10
SLCO4A1
GNA15
DCUN1D3
MSANTD3
EHD1
MICALL1
DNAJC3
CCL4L1
C5orf62
SOD2
HRH1
IL1A
NINJ1
SERPINB9
C15orf48
GCLM
IL7
SERPINB7
UPB1
CCL4L2
CD82
TNIP1
FAM108C1
CXCL1
CSF3
MEI1
C1orf21
DFNA5
HMSD
WTAP
IER3
G0S2
SLC25A37
BCAT1

−2 −1 0 1 2
SMS
SOX5
WNT5A
PKIG
pg/ml

CYSTM1
ZP3
PDE4B
TRIP10
AK8
IL8
C8orf56
ELOVL7
CPD
LAMB3
FEZ1
AGPAT4
CEP135
NRP2
CTSL1
SCARF1
LRP12
KIAA1199
ENTPD7

400
SAMSN1
DYRK3
SNX9
SMG9
LIMK2
PFKFB3
NEDD4L
VAC14
GPX3
TNFRSF6B
P2RX4
TMEM38B
C20orf160
MAFG
BCL2A1
MARCKS
CCL20

Row Z−Score
ZBTB17
MET
PHACTR1
FCAR
RFTN1
FNIP2
PLAUR
DLL1
WBP5
HTR7
EAF1
BTG3
CA12
EHF
LACC1
PANX1
ELL2
RHOH
EDN1
ACSL1
BAALC
PLD1
MUCL1
PDE4DIP
TLE1
PSD3
HS3ST3A1
GPR84
EBI3
ATP2C1
ATP13A3
DUSP5
PIM1
GK
PDPN
CPM
PLEKHM3
PTX3
SH3BP5
RDX
CCL2
SCN1B
FERMT2
DOCK4
IL12B
ST3GAL1
PTGS2
NBN
CXCL3
CXCL2
ZC3H12C
ADA
GGT5
EMILIN1
ARFGAP3
PTPN1
MVD
RELB
LAD1
CKB
PNMA1
AGRN
ACSL5
FSCN1
ETS2
HIF1A
C19orf59
DSE
PIK3AP1
LYSMD3
UBTD2
RNF19B
OSM
RABGEF1
CCR7
NQO1
SSTR2
PLGRKT
MST4
ICAM1
TMEM63B
STX1A
NFKB2
MTF1
CXCL5

200
PTGR1
CYB5R2
PIM2
DDR1
AQP9
FNDC3B
CRLF2
N4BP1
KREMEN1
TSPAN13
NDP
PLAT
TNFAIP6
CD274
AIFM2
MSC
IL36RN
RHOQ
SH3D21
OPTN
NFKB1
SESN2
TP53BP1
NPC1
FMN1
HMGA2
UPP1
CHST2
RIPK2
CCL22
KYNU
RHOU
ADM
AC099552.4
CDCP1
CSNK1E
TGFA
PLK3
SLC16A10
USP12
INHBA
MB21D2
NFKBIA
FPR2
HSPA13
APITD1
SGMS1
SYT17
CDC42EP2
HAS1
SH3PXD2B
FAM124A
MYO1B
SLC7A11
SLC22A1
BRCA2
TNFAIP8
CD59
IL19
DUSP4
NFKBIB
Mar−03
TNFSF15
ADTRP
AKAP2
BCAS1
SLC1A2
SDC4
DHCR7
NRIP3
FADS3
PHF1
IL1R1
SLAMF1
SLC39A1
PAG1
MMP7
GGH
TBK1
PTGIR
DDIT4
PELO
VNN3
SAV1
CYP27B1
SLC39A8
MAP1LC3A
ARMC9
PMP22
DUSP16
AP001468.1
TMEM54
TFPI2
DRAM1
FICD
GRAMD1A
TOM1
GFPT1
FLT1
FPGS
PLEKHB2
DNAJC5B
SERPINB2

0
RAI14
CASP5
FIGNL1
CCRL2
KANK1
ABCA1
EBF1
SLC43A3
DNAJB9
CEP170
RAB13
C14orf109
CD83
ADAMDEC1
LSS
MCOLN2
TNFRSF9
MAOA
DYNLT3
ABHD16B
PSMA6
CSTB
SMPDL3A
ARID5B
EMR1
SLC41A2
SQRDL
CD80
IL36G
PROCR
SLC3A2
HK2
TMEM45B
ITGAV
CHI3L1
HMGCS1
BIRC3
IRGQ
C1orf61
TBC1D9
NRP1
ATP6V1H
SLAMF7
GLIS3
ZNF267
PLA2G4A
CCL19
TDP2
CCDC93
SLC2A3
IL3RA
FDPS
LAMC1

Gene
FAM18B1
RP11−382A20.3
NOL3
RP11−383H13.1
CD44
PPIF
C
C
R I
I

LP 1
1

L P 100

PI3
A
A

M 2

p o I :C
I :C
P2

RUSC2
LDLR
MAPK6
KCNN4
ARNTL2
PM
PM

MMP1
TUBB
C1orf122
LAMP3
PIR
RGL1
10

FAM40B
IL9R
P

NT5E
PDSS1
P3
P3
PH
PH

SQLE
B4GALT5
S
S

PVRL2
CCL18
PDGFA
SPHK1
ZNF365
TXN
FAM83G
CDK2
SERPINB4
RALGDS
AL
AL

PAPSS2
RASGRP1
HIVEP2
ACO1
GBA
LP

FMNL3
LILRA3
TNFAIP3
GSTO1
ly
ly

PDGFRA
SLC2A6
R

SLC5A3
IRG1
BATF
SLC7A5
S
S

EPB41L3
PHC1
LONRF3
NMB
SPG20
KIFC3
SPINK1
PLAU
F3
AHI1
IL7R
KBTBD8
po
M

IDO1
MMP10
LP

PIM3
SQSTM1
RRP1
GFPT2
UGCG
SPRED2
ADARB1
GPR157
ETV5
SRC
MSMO1
SLC6A6
C7orf60
SNX10
YRDC
ARNT2
IDO2
EBF4
C22orf42
PID1
RAPGEF2
SASH1
RP11−872D17.8
FFAR2
SCG5
MVK
SC5DL
SLC39A14
IL1RN
FAM18A
HSD17B7
CYP19A1
TNNT2
LILRB1
PCID2
HBEGF
RGS16
CALCRL
HES1
JAKMIP2
NBPF15
ASPH
CDK14
PDCD1LG2
SLC39A7
TNFSF14
C17orf96
CRIM1
CCND1
RHOBTB3
PRPF40B
ZNF697
CRADD
SPAG9
RAPSN
ZNRF2
MAPK13
MLLT4
IDI1
CAPG
ARRDC4
ZFYVE16
ABLIM1
ABCB6
TMEM44
INSIG1

C
TFRC
SPPL2A
LRP8
GPD2
PLEK2
RTN2
PDP2
IL4I1
RAPGEF5
OTUD7B
KCTD7
MRPS6
AMN1
ABCG1
CLEC4E
CSF1
TMEM41B
TBC1D30
PDXK
SLC1A3
CALU
ST3GAL2
ATXN1
BHLHE40
MYO1C
UGDH
GPR68
FASN
RNF13
ABL2
CLIC4
CCDC64
CREG1
RAB20
ACHE
RASSF8
CRY1
ADAM17
DAB2
COL7A1
PLA2G7
CLDND1
CHI3L2
NEU4
APBB2
FBXO2
GPR161
TXNRD1
PSMB5
MYEOV
TRPM2
ARL8B
TSPAN33
DNAJB5
ARHGAP22
FRMD6
SOCS1
SLC26A11
TUBB6
ANXA5
P2RX5
PLEK
MMP19
PLXNA3
GCH1

HIDS day 1 RPMI > control day 1 RPMI

SKIL
SRXN1
MAFF
NFKBIE
IL2RA
SCN7A
PPARD
DGKB
MANF
CD40
SLC6A8
CNN3
RHBDF1
EGR3
PDLIM7
ZC3H12D
LHFPL2
LILRB4
ATP1B3
RAB39A
PKM
CTSB
NRG4
PSMD14
TMED7−TICAM2
SLC12A8
GLA
MMAB
TMEM217
SMAD7
RP11−1035H13.3
PXDC1
CD163
SOCS2
TNF
TIFA
CLDN12
FAM20A
PAX8
RASGRP3
ADAM9
TRAF2
AC018816.3
OCSTAMP
TMEM97
IL36B
CYP51A1
ACSL3
CD63
ENO2
ALAS1
SEMA6B
TNFRSF12A
TNS3
CLEC2D
TPRG1
TDRD6
SPIRE1
EPAS1
HILPDA

Rheumatoid arthritis
CDKN1A
MDC1
RP11−571M6.15
SLC35E4
AL121758.1
DDIT3
CYP27A1
SYP
HMGCR
SEMA7A
DST
CCR5
TNFRSF4
MMP9
CDKN2B
RAMP1
TNFRSF18
FAM129B
UBE2S
FADS2
BCAR3
SH2D2A
TCEB1
DTX2
TGM2
MYO7A
FADS1
SLC50A1
AREG
P2RY10
C21orf67
EMP1
FDFT1
AC120194.1
STARD4
C2orf62
MTHFD2
CTNS
ANPEP
RASGEF1B
VEGFB
MREG
SOWAHC
NCAM1
SLC35F2
TARS

Type I diabetes mellitus

GAS2L3
AHRR
HSD11B1
SPR
GEM
CLN8
CD81
DHCR24
SCD
LMNA
UBD
SNX8
MICALL2
NEK6
C3
ARHGAP31
PRDX1
MRC2
GOT1
STIP1
ITGA7
METTL1
METTL7B
VAT1
NR4A3
P2RY6
DBF4
CCR1
SDC2
CLEC5A
TM4SF19
CNPY2
ASPHD1
RAPGEF1
SLC17A5
CAMSAP2
TUBA1B
SCIN
SLAMF8
LRRC28
SPP1
MATK
OLR1
RAB26
SLC25A19
PDLIM4
RGCC

NF-kappa B signaling pathway

SERPINE1
MRC1
CXCL16
RHBDD2
SLC1A4
AP000304.12
FAM213A
RNF19A
ACAT2
PI4K2A
ALDH1A2
PMFBP1
PHLDA1
SPOCD1
ST6GALNAC4
TIE1
ALCAM
GADD45G
CTNNAL1
LGALS3
RGS1
RASAL2
TACSTD2
MITF
TMEM51
MRC1L1
CCL24
HOMER1
NAB2
EGR2
DCSTAMP
SLC25A25
CD109
ENG
BHLHE41
CD276
CENPN
ARHGAP18
EEF1E1
LIMK1
SPRY2
HMG20B
C19orf71
ATF3
MFSD12
SPRED1

T cell receptor signaling pathway

GPNMB
FABP5
PPARG
PLA2G4C
MRAS
HSPA2
ID3
MAP4K3
APOE
ARHGAP10
SPINT1
AGPAT9
GPC4
ABCC3
MYO1E
CST6
HSD3B7
LPL
GSN
APOC1
ATP1B1
GCLC
CD9
FABP4
ACP5
FPR3

Inflammatory bowel disease (IBD)

24h RPMI
Control

HIDS
24h LPS
HIDS
T=0 unstimulated

T=0 unstimulated

HIDS
24h RPMI

24h LPS
Control

Control
Chagas disease (American
Salmonella infection
Measles
0 10 20 30 sample
log adjusted p value

D
Glycolysis Glycolysis mTOR pathway mTOR pathway

D
Unstim RPMI LPS Unstim RPMI LPS Unstim RPMI LPS Unstim RPMI LPS
ACSS1 GALM AKT1
ACSS2 GAPDH AKT1S1 PIK3R5
ADH1A GAPDHS AKT2 PRKAA1
ADH1B GCK AKT3 PRKAA2

9
ADH4 GPI BRAF PRKCA
ADH5 HK1
CAB39 PRKCB
ADH6 HK2
CAB39L PRKCG
ADH7 HK3
DDIT4 PTEN
ADPGK HKDC1
AKR1A1 LDHA
EIF4B RHEB
ALDH1A3 LDHAL6A EIF4E RICTOR
ALDH1B1 LDHAL6B EIF4E1B RPS6
ALDH2 LDHB EIF4E2 RPS6KA1
ALDH3A1 LDHC EIF4EBP1 RPS6KA2
ALDH3A2 PCK1 HIF1A RPS6KA3
ALDH3B2 PCK2 IGF1 RPS6KA6
ALDH7A1 PDHA1 IKBKB RPS6KB1
ALDH9A1 PDHA2 INS RPS6KB2
ALDOA PDHB IRS1 RPTOR
ALDOB PFKL MAPK1 RRAGA
ALDOC PFKM MAPK3 RRAGB
BPGM PFKP
MLST8 RRAGC
DLAT PGAM1
MTOR RRAGD
DLD PGAM2
PDPK1 STK11
ENO1 PGAM4
PIK3CA STRADA
ENO2 PGK1
ENO3 PGK2 PIK3CB TNF
FBP1 PGM1 PIK3CD TSC2
FBP2 PGM2 PIK3CG ULK1
G6PC PKLR PIK3R1 ULK2
G6PC2 PKM PIK3R2 ULK3
G6PC3 TPI1 PIK3R3 VEGFA

Cytokines
Figure 5 - HIDS patients display a trained-immunity
unstim RPMI LPS like phenotype. (A) Monocytes from HIDS patients and
IFNG
matched healthy volunteers were exposed ex vivo to
IL10
IL18
several ligands for 24h. Cytokine were measured in the
IL1A
IL1B
supernatants. (n=4, mean ± SEM). (B) Heatmap showing
IL1RN
IL12A
expression data of monocytes of HIDS patients versus
IL12B

healthy volunteers either unstimulated, or 24h stimulated

IL6
TNF

with RPMI or LPS. (n=3 vs n=3). (C) Top pathways

associated with genes that show higher expression in HIDS patients exposed to 24h RPMI compared to
controls. (n=3 vs n=3). (D) Monocytes of 3 HIDS patients and 3 healthy volunteers were exposed to RPMI/
LPS for 24h or left unstimulated (unstim). Fold increases of HIDS/controls were calculated for genes in the
glycolysis pathway, mTOR pathway or cytokines. (n=3 vs n=3, * p < 0.05).

| 175
Chapter 9

autoinflammatory disorder characterized by an accumulation of mevalonate (26, 27).

HIDS patients experience periodic attacks of sterile inflammation with symptoms
such as fever, skin lesions, lymphadenopathy, and arthralgia (28). Interestingly, white
blood cells of HIDS patients were described to produce more cytokines, unstimulated
as well as stimulated, indicating a pre-activated state (29). We hypothesized that this
is due to a trained immunity phenotype of HIDS monocytes, likely induced by the
accumulation of mevalonate. We investigated the cells of 3 adult HIDS patients (2
male, 1 female), all three with V377I mutations. In line with our hypothesis, purified
monocytes from these patients produced significantly more TNFα, IL-6 and IL-1β
upon stimulation with several ligands compared to healthy controls (Figure 5A).
RNAseq analysis revealed that HIDS monocytes incubated in medium for 24h in
the absence of exogenous stimulation display an overexpression of multiple genes
(Figure 5B, Table S2), although with substantial interdonor variation (Figure S1).
Pathway analysis of these expression data is displayed in Figure 5C and shows
upregulated inflammatory pathways, such as NFκB signalling, supporting the
hypothesis of a hyperinflammatory state. We performed whole-genome assessment
of the histone mark H3K27ac by ChIP sequencing in non-stimulated monocytes from
the HIDS patients and controls. Due to variation between the three HIDS patients,
only 147 upregulated and 69 downregulated peaks were found to be different
comparing HIDS patient to healthy controls (Table S3). The overlap between
the in vitro mevalonate-trained macrophages and HIDS circulating monocytes in
terms of H3K27ac peaks was limited, due to differences in the cell types analysed
(Figure S2). When specifically comparing peak-related genes between HIDS and
mevalonate-activated samples one upregulated gene and 22 downregulated genes
were found (Table S3), but these could not be allocated to certain cellular pathways,
because of the low number. When specifically assessing the expression data of
HIDS patients for trained immunity-related genes an interesting comparison can
be made. Expression profiles of pathways known to be important for induction of
trained immunity such as glycolysis, mTOR pathway, and (innate) cytokines were
assessed (4, 5, 22), comparing HIDS patients and healthy controls. This shows a
clear increased induction of glycolysis and mTOR pathway in HIDS patients when
their monocytes are stimulated with LPS (Figure 5D). Moreover, transcription of
cytokines was evidently increased in monocytes of HIDS patients after 24h in RPMI
medium (Figure 5D).

DISCUSSION
Trained immunity is associated with an upregulation of several cellular metabolic
pathways, including glycolysis and glutamine metabolism. In this paper, we explored
the role of the cholesterol synthesis pathway in the induction of trained immunity.

176 |
 Mevalonate-induced trained immunity

We show that the cholesterol synthesis pathway is essential for inducing trained
immunity, and its inhibition by statins down-regulated the increased cytokine
production and epigenetic reprogramming induced by either β-glucan or oxLDL. We
also show that not the synthesis of cholesterol itself is essential, but the accumulation
of the metabolite mevalonate. Epigenome analysis showed that incubation of healthy
monocytes with mevalonate alone results in trained macrophages that resemble the
β-glucan-induced trained immunity phenotype, especially on the genes that were
epigenetically down-regulated. This indicates that next to fumarate, mevalonate
is an essential metabolite in the metabolo-epigenetics of trained immunity. RNA
sequencing analysis showed that monocytes from patients with HIDS due to
mevalonate kinase deficiency exhibit a trained immunity phenotype.
The cholesterol synthesis pathway has been shown to affect epigenetic
remodeling via induction of LXRα, which is induced by intermediates downstream
in the cholesterol synthesis pathway (30, 31). Furthermore, downregulation of
geranylgeranylation suppresses HDAC1 activity and FPP and GGPP have been
shown to inhibit the lysine specific demethylase 1 (32, 33). However, surprisingly in
the present study, we show that intermediates downstream in the pathway are not
essential for inducing trained immunity, while metabolites in the proximal part of the
pathway, especially mevalonate, play an important role. We, thus, show that it is
unlikely that isoprenylation plays a major role for the induction of trained immunity.
HIDS is one of the prominent hereditary autoinflammatory (‘periodic fever’)
syndromes. HIDS patients carry mutations in mevalonate kinase that are responsible
for the clinical picture of febrile attacks, skin lesions, arthritis and lymphadenopathy. 9
The mutation in mevalonate kinase leads to accumulation of mevalonate and results
in elevated excretion of mevalonic acid during attacks (27). In the treatment of HIDS,
inhibition of IL-1 with anakinra has become one of the cornerstones of the therapy (34),
but HIDS is considered more and more a ‘multi-cytokine disease’, as also inhibition
of IL-6 with tociluzimab and even anti-TNF treatment with etanercept have shown
promising results in specific cases (35-38). We thus hypothesized that induction of
a trained immunity phenotype, characterized by exaggerated cytokine production by
monocytes due to mevalonate accumulation, could play a role in the pathophysiology
of HIDS. This hypothesis was validated by demonstration of exaggerated cytokine
production in HIDS monocytes, accompanied by transcriptional and epigenetic
changes. Interestingly, statin treatment showed a reduced excretion of mevalonic
acid in HIDS patients, and a decreased number of febrile days, supporting the
concept that lowering mevalonate levels is beneficial for disease activity (39).
Kastner et al. have shown that isoprenylation is an important mechanism that
is deficient in HIDS patients and causative to the disease symptoms. The absence
of protein geranylgeranylation results in compromised PI(3)K activity, which allows

| 177
Chapter 9

an unopposed TLR-induced inflammatory response with constitutive activation

of the pyrin inflammasome. Moreover, due to prenylation defects the GTPase
RhoA is inactivated, which also results in pyrin inflammasome activation (40, 41).
Interestingly, it was also shown that isoprenylation is not defective in HIDS patients
due to increased flux through the isoprenoid/cholesterol biosynthesis pathway by
elevating intracellular mevalonate levels (42). However, we now show that next to
this mechanism based on defective prenylation, also the accumulation of mevalonate
itself seems to play a causative role in developing the hyperinflammatory state
observed in HIDS.
A crucial aspect relates to the mechanisms through which mevalonate induces
and modulates trained immunity. In T-cells, activation induces a shift from oxidative
phosphorylation to aerobic glycolysis, similar to trained monocytes. In these cells
it was shown that the increased glycolysis also fuels mevalonate metabolism (43).
Glucose is increasingly taken up and converted into pyruvate. Subsequently, via
a truncated TCA cycle, pyruvate is converted into acetyl-CoA and citrate, which is
exported to the cytosol. There, the citrate is converted back into acetyl-CoA by ATP
citrate lyase (44) and enters either the mevalonate pathway or fatty acid biosynthesis
(43). Previously we have shown an increase in intracellular citrate in β-glucan
trained cells, which might provide evidence of a similar mechanism in monocytes
(7). An interesting observation of our study is the involvement of glycolysis and
mTOR for the induction of trained immunity by mevalonate. Mevalonate-induced
training can be counteracted by inhibiting glycolysis and mTOR signaling. We
identified the IGF1-receptor as the responsible receptor through which mevalonate
can signal extracellularly, activating the mTOR pathway and subsequently inducing
epigenetic changes. This would then fuel a self-reinforcing activating mechanism in
which glycolysis promotes mevalonate accumulation, which subsequently activates
glycolysis via IGF1 signaling (Figure 3F). However mevalonate could theoretically
also exert an effect intracellularly.
Clinically, the discovery of a role for mevalonate for the induction of trained
immunity, and for a hyperinflammatory phenotype in specific diseases, has important
consequences. Inhibition of the cholesterol synthesis pathway in inflammatory
conditions is thus potentially very relevant. Earlier studies have already shown
that statins can improve survival from sepsis in mice (45) and also human studies
demonstrate that statin use may be associated with better survival in sepsis (46).
Also the development of rheumatoid arthritis is thought be reduced by statin
treatment (47). Inhibition of the cholesterol synthesis pathway could therefore be
an effective therapy in other hyperinflammatory disorders in which trained immunity
plays a role (1). However, to fully implement inhibition of the mevalonate pathway as
a therapeutic option, the exact role of trained immunity and mevalonate accumulation

178 |
 Mevalonate-induced trained immunity

in these conditions should first be elucidated further.

In conclusion, the cholesterol synthesis pathway, and in particular the intermediate
mevalonate, is essential for inducing trained innate immunity. Incubation of
monocytes with mevalonate induces a trained immunity phenotype, which covers
a part of the β-glucan trained immunity phenotype, similar to fumarate. Patients
with mevalonate accumulation acquire a trained immunity phenotype, characterized
by an increased expression of cytokines and genes in the glycolysis pathway.
Furthermore, inhibition of the cholesterol synthesis pathway by statins prevents the
trained immunity phenotype. Statins could therefore be used as a treatment option
for diseases, which are mediated via trained immunity, until more specific drugs for
inhibiting trained immunity are available.

REFERENCES
1. Netea MG, et al. Trained immunity: A program of
innate immune memory in health and disease.
Science. 2016;352(6284):aaf1098.
2. Netea MG, Quintin J, Van der Meer JW. Trained
immunity: a memory for innate host defense. Cell
Host Microbe. 2011;9(5):355-61.
3. Milutinovic B, Kurtz J. Immune memory in
invertebrates. Semin Immunol. 2016;28(4):328-42.
4. Saeed S, et al. Epigenetic programming of monocyte-
to-macrophage differentiation and trained innate
immunity. Science. 2014;345(6204):1251086.
5. Cheng SC, et al. mTOR- and HIF-1alpha-mediated
aerobic glycolysis as metabolic basis for trained
immunity. Science. 2014;345(6204):1250684.
6. Murray PJ, Rathmell J, Pearce E. SnapShot:
Immunometabolism. Cell Metab. 2015;22(1):190-190
e1.
7. Arts RJ, et al. Glutaminolysis and Fumarate
Accumulation Integrate Immunometabolic and
Epigenetic Programs in Trained Immunity. Cell
8.
Metab. 2016;24(6):807-819.
van Tits LJ, et al. Oxidized LDL enhances pro-
inflammatory responses of alternatively activated M2
macrophages: a crucial role for Kruppel-like factor 2.
Atherosclerosis. 2011;214(2):345-9.
9. Hirschfeld M, et al. Cutting edge: repurification of
lipopolysaccharide eliminates signaling through both
human and murine toll-like receptor 2. J Immunol.
2000;165(2):618-22.
10. Repnik U, Knezevic M, Jeras M. Simple and cost-
effective isolation of monocytes from buffy coats. J
Immunol Methods. 2003;278(1-2):283-92.
11. Bekkering S, et al. In-vitro experimental model of
trained innate immunity in human primary monocytes.
Clin Vaccine Immunol. 2016.
12. Xu S, et al. Evaluation of foam cell formation
in cultured macrophages: an improved method
with Oil Red O staining and DiI-oxLDL uptake.
Cytotechnology. 2010;62(5):473-81.
13. Langmead B, et al. Ultrafast and memory-efficient
alignment of short DNA sequences to the human
genome. Genome Biol. 2009;10(3):R25.
14. Turro E, et al. Haplotype and isoform specific
expression estimation using multi-mapping RNA-seq
reads. Genome Biol. 2011;12(2):R13.
15. Anders S, Huber W. Differential expression
analysis for sequence count data. Genome Biol.
2010;11(10):R106.
16. King ZA, et al. Escher: A Web Application for Building,
Sharing, and Embedding Data-Rich Visualizations
of Biological Pathways. PLoS Comput Biol.
2015;11(8):e1004321.
17. Li H, Durbin R. Fast and accurate short read alignment
with Burrows-Wheeler transform. Bioinformatics.
2009;25(14):1754-60.
18. Li H, et al. The Sequence Alignment/Map format and
SAMtools. Bioinformatics. 2009;25(16):2078-9.
19. Barnett DW, et al. BamTools: a C++ API and toolkit for
analyzing and managing BAM files. Bioinformatics.
2011;27(12):1691-2.
20. Zhang Y, et al. Model-based analysis of ChIP Seq
(MACS). Genome Biol. 2008;9(9):R137.
21. Quinlan AR, Hall IM. BEDTools: a flexible suite
of utilities for comparing genomic features.
Bioinformatics. 2010;26(6):841-2.
22. Quintin J, et al. Candida albicans infection affords
protection against reinfection via functional
reprogramming of monocytes. Cell Host Microbe.
2012;12(2):223-32.
23. Bekkering S, et al. Oxidized low-density lipoprotein
induces long-term proinflammatory cytokine
production and foam cell formation via epigenetic
reprogramming of monocytes. Arterioscler Thromb
Vasc Biol. 2014;34(8):1731-8.
24. Dricu A, et al. Mevalonate-regulated mechanisms
in cell growth control: role of dolichyl phosphate in
expression of the insulin-like growth factor-1 receptor
(IGF-1R) in comparison to Ras prenylation and
expression of c-myc. Glycobiology. 1997;7(5):625-
33.
25. Novakovic B, et al. beta-Glucan Reverses the
Epigenetic State of LPS-Induced Immunological
Tolerance. Cell. 2016;167(5):1354-1368 e14. 9
26. Drenth JP, et al. Mutations in the gene encoding
mevalonate kinase cause hyper-IgD and periodic
fever syndrome. International Hyper-IgD Study
Group. Nat Genet. 1999;22(2):178-81.
27. Houten SM, et al. Mutations in MVK,
encoding mevalonate kinase, cause
hyperimmunoglobulinaemia D and periodic fever
syndrome. Nat Genet. 1999;22(2):175-7.
28. van der Meer JW, et al. Hyperimmunoglobulinaemia
D and periodic fever: a new syndrome. Lancet.
1984;1(8386):1087-90.
29. Drenth JP, Van der Meer JW, Kushner I. Unstimulated
peripheral blood mononuclear cells from patients
with the hyper-IgD syndrome produce cytokines
capable of potent induction of C-reactive protein
and serum amyloid A in Hep3B cells. J Immunol.
1996;157(1):400-4.
30. Yu H, et al. Involvement of liver X receptor alpha
in histone modifications across the target fatty acid
synthase gene. Lipids. 2012;47(3):249-57.
31. Lee S, et al. Activating signal cointegrator-2 is an
essential adaptor to recruit histone H3 lysine 4
methyltransferases MLL3 and MLL4 to the liver X
receptors. Mol Endocrinol. 2008;22(6):1312-9.
32. Chang CC, et al. 3-Methylcholanthrene, an AhR
agonist, caused cell-cycle arrest by histone
deacetylation through a RhoA-dependent recruitment
of HDAC1 and pRb2 to E2F1 complex. PLoS One.
2014;9(3):e92793.
33. Li Q, et al. Binding of the JmjC demethylase
JARID1B to LSD1/NuRD suppresses angiogenesis
and metastasis in breast cancer cells by repressing
chemokine CCL14. Cancer Res. 2011;71(21):6899-
908.
34. Bodar EJ, et al. On-demand anakinra treatment
is effective in mevalonate kinase deficiency. Ann
Rheum Dis. 2011;70(12):2155-8.
35. Shendi HM, Devlin LA, Edgar JD. Interleukin 6

| 179
Chapter 9

blockade for hyperimmunoglobulin D and periodic
fever syndrome. J Clin Rheumatol. 201;20(2):103-5.
36. Demirkaya E, et al. A patient with hyper-IgD syndrome
responding to anti-TNF treatment. Clin Rheumatol.
2007;26(10):1757-9.
37. Stoffels M, et al. TLR2/TLR4-dependent exaggerated
cytokine production in hyperimmunoglobulinaemia
D and periodic fever syndrome. Rheumatology
(Oxford). 2015;54(2):363-8.
38. Bodar EJ, et al. Effect of etanercept and anakinra
on inflammatory attacks in the hyper-IgD syndrome:
introducing a vaccination provocation model. Neth J
Med. 2005;63(7):260-4.
39. Simon A, et al. Simvastatin treatment for inflammatory
attacks of the hyperimmunoglobulinemia D and
periodic fever syndrome. Clin Pharmacol Ther.
2004;75(5):476-83.
40. Akula MK, et al. Control of the innate immune
response by the mevalonate pathway. Nat Immunol.
2016;17(8):922-9.
41. Park YH, et al. Pyrin inflammasome activation and
RhoA signaling in the autoinflammatory diseases
FMF and HIDS. Nat Immunol. 2016;17(8):914-21.
42. Houten SM, et al. Regulation of isoprenoid/cholesterol
biosynthesis in cells from mevalonate kinase-
deficient patients. J Biol Chem. 2003;278(8):5736-
43.
43. Thurnher M, Gruenbacher G. T lymphocyte
regulation by mevalonate metabolism. Sci Signal.
2015;8(370):re4.
44. Kroemer G, Pouyssegur J. Tumor cell metabolism:
cancer’s Achilles’ heel. Cancer Cell. 2008;13(6):472-
82.
45. Merx MW, et al. Statin treatment after onset of sepsis
in a murine model improves survival. Circulation.
2005;112(1):117-24.
46. De Loecker I, Preiser JC. Statins in the critically ill.
Ann Intensive Care. 2012;2(1):19.
47. Tascilar K, et al. Statins and Risk of Rheumatoid
Arthritis: A Nested Case-Control Study. Arthritis
Rheumatol. 2016;68(11):2603-2611.

Digital versions of Tables S1-3 can be obtained by sending a request to the author.

Table S1, related to Figure 4 – Differentially regulated H3K27ac peaks in mevalonate-trained

monocytes. In the first tab genes related to peaks induced by mevalonate-induced trained immunity
can be found. In the second tab these peaks are compared with H3K27ac peaks from β-glucan-induced
trained immunity from Arts et al. (7).

Table S2, related to Figure 5 – RNA sequencing analysis of monocytes of HIDS patients versus
healthy controls. Up- and down-regulated expression is shown in separate tabs for non-stimulated
monocytes and monocytes that were cultured in RPMI medium for 24h.

Table S3, related to Figure 5 – ChIP sequencing of monocytes of HIDS patients versus healthy
controls. In the first tab H3K27ac peaks comparing HIDS patients to healthy controls is shown. In the
second tab the overlap between the in-vitro mevalonate-trained macrophages and HIDS circulating
monocytes in terms of H3K27ac peaks are shown.

180 |
 Mevalonate-induced trained immunity

Figure S1, related to Figure 5 - HIDS expression analysis. Heat map of individual donors for genes
that show LPS responses in controls and HIDS patients. Monocytes were either unstimulated (=baseline)
or stimulated for 24h with RPMI or LPS.

| 181
Chapter 9

Figure S2, related to Figure 5 - Comparison of H3K27ac peaks in HIDS monocytes versus
mevalonate-trained macrophages. At the left, graphs display the median and mean read counts of the
H3K27ac peaks that were significantly up or down in HIDS patient monocytes. At the right, graphs display
median and mean read counts at the same H3K27ac peaks.

182 |
Mevalonate-induced trained immunity

| 183
 Chapter 10

Broad defects in energy metabolism of

leukocytes underlie immunoparalysis in
sepsis

Shih-Chin Cheng*, Brendon P. Scicluna*, Rob J.W. Arts*, Mark S. Gresnigt,

Ekta Lachmandas, Evangelos J. Giamarellos-Bourboulis, Matthijs Kox, Ganesh
R. Manjeri, Jori Wagenaars, Olaf L. Cremer, Jenneke Leentjens, Anne J. van
der Meer, Frank L. van de Veerdonk, Marc J. Bonten, Marcus J. Schultz, Peter
Willems, Peter Pickkers, Leo A.B. Joosten, Tom van der Poll#, Mihai G. Netea#.

*These authors have equally contributed to the study

#
These authors share senior authorship

Nat Immunol 2016;4:406-13

Chapter 10

ABSTRACT

The acute phase of sepsis is characterized by a strong inflammatory reaction.

At later stages in some patients immune paralysis may be encountered, which is
associated with poor outcome. By transcriptional and metabolic profiling in human
sepsis patients we showed that a shift from oxidative phosphorylation to aerobic
glycolysis is an important component of initial activation of host defense. Blocking
metabolic pathways with metformin reduced cytokine production and increased
mortality in systemic fungal infection in mice. In contrast, in leukocytes rendered
tolerant by exposure to lipopolysaccharide or after isolation from patients with sepsis
and immune paralysis, a generalized metabolic defect at the level of both glycolysis
and oxidative metabolism was apparent, which was restored after recovery of the
patients. Finally, the immunometabolic defects in humans could be partially restored
by therapy with recombinant interferon-γ, suggesting that metabolic processes could
represent a therapeutic target in sepsis.

186 |
 Immunometabolism in Immunotolerance

The immune response during the acute phase of sepsis is characterized by

inflammation and activation of immune effector mechanisms (e.g. phagocytosis,
intracellular killing) aimed at eliminating the pathogen. During the late phase, the
immune system shifts towards an anti-inflammatory state to reduce inflammation and
initiate tissue repair. This chain of events can be distorted with dire consequences
for the outcome: an exaggerated systemic release of cytokines in the acute phase
(cytokine storm) can cause hypotension, cardiovascular dysfunction, tissue damage
and multi-organ failure, while during the later phases of the disease activation
of modulatory pathways may prematurely inhibit host defense (innate immune
tolerance or innate immune paralysis) (1). However, recent studies demonstrated
that these functional states can occur simultaneously. In agreement, a recent
study showed that phagocytes from sepsis patients who had survived the infection
displayed both decreased inflammation and increased expression of genes involved
in phagocytosis, microbial killing and tissue repair, which was found to be mediated
by a HIF-1α transcription factor-dependent pathway (2). Nevertheless, exaggerated
inhibitory effects on leukocytes during the late phase of sepsis can lead to immune
paralysis, associated with an increased susceptibility to secondary infections and
a poor outcome (3). Understanding the mechanisms that regulate inflammatory
responses in sepsis is crucial to identify new therapeutic strategies for reversing
immune dysregulation in severely ill septic patients.
Studies have identified a crucial role for cellular metabolism of glucose in the
functional fate of immune cells. In this respect, naive or tolerant cells mainly rely on
oxidative phosphorylation and β-oxidation as energy sources, while after stimulation
leukocytes shift their metabolism towards aerobic glycolysis (attuned to the Warburg
effect) (3, 4). Defects in tissue metabolism have been reported in sepsis, and
seemed correlated with outcome. Elevated ATP concentration in muscle biopsies 10
of sepsis patients are associated with better survival (5), whereas mitochondrial
dysfunction and energy shortage have been hypothesized to be an underlying cause
of organ dysfunction (6, 7). In addition, two small studies reported mitochondrial
dysfunction (8) and redox imbalance (9) in leukocytes of sepsis patients. However,
a comprehensive investigation of cellular metabolism of leukocytes in sepsis and its
impact on immune function and outcome has not been performed.
In this study we aimed to assess energy metabolism of immune cells in two
clinically relevant infection models, namely bacterial sepsis caused by the Gram-
negative bacterium Escherichia coli and fungal sepsis caused by the opportunistic
fungal pathogen Candida albicans. On the one hand we investigated the role for host
defense of a metabolic shift towards aerobic glycolysis during acute infection, and
on the other hand, the relationship between the dysregulation of cellular metabolism
and innate immune paralysis (or innate immune tolerance) in patients with severe

| 187
Chapter 10

sepsis.

MATERIALS AND METHODS

PBMC and monocyte isolation - Buffy coats from healthy donors were obtained after
written informed consent (Sanquin blood bank, Nijmegen, The Netherlands). PBMC
isolation was performed by dilution of blood in pyrogen-free PBS and differential
density centrifugation over Ficoll-Paque (GE healthcare, UK). Cells were washed
twice in PBS and resuspended in RPMI culture medium (Roswell Park Memorial
Institute medium; Invitrogen, CA, USA) supplemented with 50μg/ml gentamicin,
2mM Glutamax, and 1mM pyruvate (Gibco). PBMCs were counted in a Coulter
counter (Coulter Electronics) and adjusted to 5×10^6 cells/ml. A 100μl volume was
added to round bottom 96-well plates (Greiner, Frickenhausen, Germany) for PBMC
experiments. For monocytes experiments, monocytes were separated from other
cells by hyperosmotic density gradient centrifugation over Percoll (Sigma-Aldrich, St.
Louis, MO, USA), and afterwards washed once with PBS. Monocytes were counted
and adjusted to 1×10^6 cells/ml. A 100μl volume was added to flat bottom 96-well
plates (Corning, NY, USA) and cells were let to adhere for 1h at 37°C; subsequently
a washing step with 200μl warm PBS was performed to yield maximal purity.
Monocyte isolation from septic patients was performed by CD14 positive magnetic
beads (MACS Miltenyi) isolation after the PBMC isolation step.
Monocyte/PBMC stimulation - Cells were stimulated with RPMI, Escherichia coli
LPS (serotype 055:B5, Sigma-Aldrich, 10ng/ml), or 1x10^6/ml Candida albicans
ATCC MYA-3573 (UC 820) for 24h or 7 days (in the presence of 10% serum for
lymphocyte derived cytokines) and supernatants were stored at -20oC until cytokine/
lactate measurements were performed. For NAD+ measurements, cells were lysed in
lysis buffer and stored at -800C. To induce tolerance, monocytes were pre-incubated
with LPS (10ng/ml) or C. albicans (10^4 CFU/ml) in the presence of 10% serum. After
24h cells were washed once with warm PBS and let to rest for 24h in 10% serum
supplemented medium. Thereafter, cells were restimulated with RPMI or 10ng/ml
LPS for 2h (for Western blot) or for 24h (for cytokines/lactate/NAD+ production).
Supernatants and lysates were stored as described above. In some experiments,
cells were pre-incubated for 1h with the mTOR pathway inhibitors 10nM rapamycin
(Sigma), 100nM torin1 (Tocris, Bristol, UK), or the AMPK inducer 3mM metformin
(R&D, Abingdon, UK), after which the stimulus was added. For the IFNγ experiments
were preincubated for 1h with 1µg/ml of recombinant IFNγ (Immukine, Boehringer
Ingelheim, Vienna, Austria) before restimulation.
Cytokine, lactate, NAD+, and ATP measurements - Cytokine production was
determined in supernatants using commercial ELISA kits for TNFα, IL-17, IL-22 (R&D
systems, MN, USA) and IL-1β, IL-6, IFNγ (Sanquin, Amsterdam, The Netherlands)

188 |
 Immunometabolism in Immunotolerance

following the instructions of the manufacturer. Lactate concentration was measured

using a Lactate Fluorometric Assay Kit (Biovision, CA, USA) and NAD+ by a NAD+/
NADH Fluorometric Quantification Kit (Biovision). Lactate results are depicted as
increase (Δ) lactate production: the difference of lactate production between RPMI
and LPS stimulated samples. ATP was measured by a bioluminescence ATP
determination kit (Thermo Fisher Scientific, Waltham, MA, USA).
Western blots - Cells were cultured, lysed and stored as described above. Monocytes
from septic patients were directly lysed after CD14 positive MACS isolation and
stored at -20°C. Total protein amounts were determined by BCA assay (Thermo
Fisher Scientific) and equal amounts of proteins were loaded on pre-casted 4-15%
gels (Biorad, CA, USA). The separated proteins were transferred to a nitrocellulose
membrane (Biorad), which was blocked in 5% BSA (Sigma). Incubation overnight at
4°C with rabbit polyclonal antibodies against p-S6K, p-4EBP1, p-Akt (Cell Signaling,
Danvers, MA, USA), CPT1, CD36 (Santa Cruz, TX, USA), and actin (Sigma) were
used to determine the protein expression, which was visualized using a polyclonal
secondary antibody (Dako, Belgium) and SuperSignal West Femto Substrate
(Thermo Fisher Scientific) or ECL (Biorad).
Oxygen consumption - 5x10^6 PBMCs were incubated for 48h with RPMI, LPS or
C. albicans in the presence of 10% serum. Culture medium was collected after which
the cells were washed, and resuspended in 60μl of the collected culture medium.
Oxygen consumption for septic patients or healthy volunteers was performed on
5x10^6 freshly isolated PBMCs collected in 50μl RPMI. The cell suspensions
were then used for cellular O2 consumption analysis. Oxygen consumption was
measured at 37°C using polarographic oxygen sensors in a two-chamber Oxygraph
(OROBOROS Instruments, Innsbruck, Austria). First, basal respiration was measured.
Next, leak respiration was determined by addition of the specific complex V inhibitor 10
oligomycin A (OLI; 2.5µM). Then, maximum oxygen consumption was quantified by
applying increasing concentrations of the mitochondrial uncoupler p-trifluoromethoxy
carbonyl cyanide phenyl hydrazone (FCCP 0.5 to 14µM final concentration). Finally,
non-mitochondrial oxygen consumption (ROX) was assessed by adding the specific
complex I inhibitor rotenone (ROT; 30nM) and the complex III inhibitor antimycin A
(AA; 2.5µM).
Animal experimental models - Animals experiments were conducted in accordance
at the Center of Animal Use for Research Purposes of ATTIKON University hospital
in accordance with the 56/2013 EU law (license 4/2013). Forty C57Bl6 male mice
7-9 weeks old weighting 25-27g were studied. Mice were staying at cages with a
constant flow air exchange, they were fed standard lab chow and they had access
to water ab libitum. Mice were randomly assigned to each of three groups and
interventions were performed after ether anesthesia. Researchers were blinded

| 189
Chapter 10

for the interventions: a) treated intraperitoneally (ip) on days -1, 0, 1, 2, 3, 4, 5, 6

and 7 with 200μl PBS. These mice were challenged with one log-phase 5x10^6/
mice inoculum of C. albicans intravenously (iv) by the tail vein on day 0; b) treated
intraperitoneally (ip) on days -1, 0, 1, 2, 3, 4, 5, 6 and 7 with 250mg/kg of metformin
(Glucophage, Bristol, Athens, Greece) diluted in PBS. These mice were challenged
with one log-phase 5x10^6/mice inoculum of C. albicans intravenously (iv) by the tail
vein on day 0. Survival was monitored for 28 days for 10 mice/group and animals
were sacrificed as 5/group on days 3 and 7. During sacrifice, one midline abdominal
incision was performed under aseptic conditions and tissue samples were taken
from the liver, spleen and right kidney. Once weighed, segments of liver and right
kidney were homogenized with 1ml RPMI-1640 (Biochrom, Berlin, Germany)
nutrient broth and 100μl of the homogenate were four times serially diluted 1:10 in
0.9% NaCl. A 0.1-ml aliquot of each dilution was plated onto Sabouraud (Becton
Dickinson, Cockeysville Md) agar. Plates were incubated at 37oC for 48h and the
number of viable colonies in each dilution was multiplied by the appropriate dilution
factor. Results were expressed in log10 CFU/g. The lower detection limit was 10
CFU/g. The spleen was gently squeezed and then passed through a sterile filter
(250μm, 12x13cm, Alter Chem Co) for splenocytes collection. After counting the
splenocytes with tryptan blue exclusion of dead cells, splenocytes were incubated
into sterile flat wells at a density of 5x10^6/ml in 1ml of RPMI-1640 supplemented
with 2mM glutamine, 10% fetal bovine serum, 100U/ml of penicillin G, and 0.1mg/ml
of streptomycin in the absence or presence of 10ng/ml LPS, Escherichia coli O55:B5
(24h), or 1x10^6 CFU/ml of heat-killed yeasts Candida albicans (5d) at 37°C in 5%.
At the end of incubation, the plates were centrifuged and the supernatants were
collected. Cytokines were measured in supernatants by an enzyme immunoassay
(R&D Inc, Minneapolis, USA).
Human endotoxemia - Eight healthy men (mean age 22.9, SE ± 0.5 years) were
intravenously administered with LPS (from E. coli; U.S. standard reference endotoxin,
kindly provided by the National Institutes of Health, Bethesda, MD; 4ng/kg body
weight). Blood was collected before and 4h after LPS administration in PAXgene
tubes (Becton-Dickinson, Breda, the Netherlands) for microarray analysis of total
RNA isolated using the PAXgene blood RNA kit (Qiagen) according to manufacturer’s
instructions. Blood was also collected in heparin tubes (Becton-Dickinson, Breda,
the Netherlands) for whole blood and PBMC restimulation with 100ng/ml LPS for
h. After re-stimulation, cytokine release was assessed by Luminex-based multiplex
assay. The study was approved by the institutional scientific and ethics committees,
and written informed consent was obtained from all subjects (NCT01014117).
Patient studies - Clinical samples were obtained from patients with blood culture
proven E. coli or C. albicans sepsis who had been enrolled in the MARS (Molecular

190 |
 Immunometabolism in Immunotolerance

Diagnosis and Risk Stratification of Sepsis) cohort, a large prospective observational

study in the ICUs of two tertiary teaching hospitals (Academic Medical Center,
Amsterdam and University Medical Center Utrecht, Utrecht) in the Netherlands that
took place from 2011 to 2014 (ClinicalTrials.gov identifier NCT01905033). Blood
was collected in PAXgene tubes and total RNA isolated by means of the PAXgene
blood RNA kits using the QIAcube system (Qiagen) according to manufacturer’s
instructions. The Medical Ethical Committees of both study centers gave approval
for an opt-out consent method (IRB no. 10-056C). PAXgene blood was also obtained
from 42 healthy controls (age range 30-63 years; 24 males, 18 females) after providing
written informed consent. For ex-vivo cytokine and lactate production of septic
patients, blood was drawn via an arterial catheter from eight newly admitted septic
patients within 24h after admission to the intensive care unit of Radboud University
Medical Center Nijmegen. Once a patient had recovered, blood was drawn before
release from the ICU and if possible once more at a later time point. For the IFNγ
pilot study the primary end point data have been published elsewhere (10). In short,
eight patients with an invasive Candida spp and/or Aspergillus fumigatus infection
were next to the standard antifungal therapy treated with recombinant IFNγ (100mg
thrice a week, for 2 weeks), at indicated time points blood was drawn, and ex-vivo
PBMC stimulations were performed (10). From the 24h cultured supernatants lactate
was measured.
Microarray analysis - Genome-wide blood gene expression analysis of the human
endotoxemia cohort was done using the Illumina HumanHT-12 V3.0 expression
beadchip (GSE48119); whereas the sepsis patients from the MARS cohort were
analyzed by hybridizing to the human genome U219 96-array plate and scanned
using the GeneTitan® instrument (Affymetrix) (GSE65682). Genome-wide gene
expression analysis of in-vitro stimulated PBMCs from healthy volunteers was done 10
by using the Illumina HumanHT-12 V4.0 expression beadchip (GSE42606), further
details can be found from Smeekens, et al. (11).
Statistics - Differences in cytokine/lactate/NAD+ were analysed using a Wilcoxon
signed-rank test or one way Anova, where applicable. Survival curves were analysed
by a log-rank test and for oxygen consumption a student t test was used. All these
analyses were performed in Graphpad prism 5 (CA, USA). * p < 0.05, ** p < 0.01,
*** p < 0.0001. Data are shown as means ± SEM. Dichotomous and continuous
clinical data were assessed by Fisher’s exact test and Wilcoxon’s rank sum test,
respectively. Microarray data are presented in the form of volcano plots (integrating
log2 fold changes and multiple-test adjusted probabilities) and heat map plots,
generated in R studio (12).
Study design and patient selection - The study was performed within the context
of the Molecular diAgnosis and Risk stratification of Sepsis (MARS) project in the

| 191
Chapter 10

mixed ICUs of two tertiary referral centers in the Netherlands (Academic Medical
Center, Amsterdam, and University Medical Center Utrecht, Utrecht; clinicaltrials.
gov identifier NCT01905033).(13, 14) The Medical Ethics committees of both
participating centers approved an opt-out consent method (IRB no. 10-056C).
MARS patient cohort: The MARS ICU patient cohort was enrolled between
January, 2011 and July, 2012, comprised of 46 sepsis patients with blood culture
proven infection Escherichia coli (E. coli) (n=33) or Candida species (n=13, C.
albicans (n=7), C. glabrata (n=5), C. lusitaniae (n=1), and C. tropicalis (n=1)).
Severity was assessed on a daily basis from ICU admission by means of the Acute
Physiology and Chronic Health Evaluation (APACHE IV) score (15). Shock was
defined as hypotension requiring the use of noradrenaline in a dose of >0.1 µg/kg/min
during at least 50% of the day. Blood was collected in PAXgene blood tubes (Becton-
Dickinson, Breda, the Netherlands) for RNA isolation. Total RNA was isolated by
means of the PAXgene blood mRNA kit (Qiagen) and Qiacube automated system
(Qiagen). Blood was also obtained from 42 healthy controls (age range 30-63 years;
24 males, 18 females) after providing written informed consent.
RUMC cohort: Eight newly admitted sepsis patients (age range 33-76 years,
3 males, 5 females) were included after informed consent. Shock was defined as
described above. Blood was drawn via an arterial catheter within 24h after admission
to the intensive care unit of the Radboud university medical center Nijmegen. Blood
cultures were positive for E. coli (n=2) or C. albicans (n=1), and in other patients
pathogens were cultured from urine, or pleural effusion, containing E. coli (n=4), or
C. glabrata (n=1).
Microarray data processing and normalization - MARS cohort in-vivo blood
gene expression data: Quality and integrity of RNA was assessed by Nanodrop
spectrophotometry (260:280nm) and bioanalysis (Agilent, Amstelveen, the
Netherlands). RNA (RIN > 6.0) was processed and hybridized to the Human
Genome U219 96-array plate using the GeneTitanR instrument (Affymetrix) as
described by the manufacturer at the Cologne Center for Genomics (CCG),
Cologne, Germany. Raw data scans (.CEL files) were read into the R language and
environment for statistical computing (version 2.15.1; R Foundation for Statistical
Computing, Vienna, Austria; http://www.R-project.org/). Pre-processing and quality
control was performed by using the Affy package version 1.36.1.(16) Array data were
normalized using the Robust Multi-array Average (RMA) method and summarized by
medianpolish. The resultant 49,386 log-transformed probe intensities were filtered
by means of a 0.5 variance cutoff using the genefilter method (17) to recover 24,646
probes in at least one sample. The occurrence of non-experimental chip effects was
assessed by means of the Surrogate Variable Analysis (18) and corrected using
the ComBat method (19). Differential gene expression across healthy subjects, E.

192 |
 Immunometabolism in Immunotolerance

coli and Candida blood culture positive patient samples was done by means of the
limma method (20, 21). We adjusted for the potential impact of age in our model
(additive). Throughout Benjamini-Hochberg (BH) (22) multiple comparison adjusted
probabilities, correcting for 24,646 tests, defined significance. Probes were annotated
using the U219 annotation database available through R/Bioconductor (23).
Human endotoxemia in-vivo blood gene expression data: PAXgene blood total RNA
was isolated by means of the Qiacube automated system (Qiagen) using PAXgene
blood RNA kits according to manufacturer’s instructions. Synthesis, amplification and
purification of anti-sense RNA was performed by using the Illumina TotalPrep RNA
Amplification Kit (Ambion art. No. AM-IL1791) following the Illumina Sentrix Array
Matrix expression protocol at ServiceXS (Leiden, the Netherlands). A total of 750ng
biotinylated cRNA was hybridized onto the HumanHT-12v3 Expression BeadChip
(Illumina). The raw scan data were read using the beadarray package (version 1.16.0)
(24), using the R statistical environment (version 2.11.0) (25). Illumina’s default pre-
processing steps were performed using beadarray. Briefly, estimated background was
subtracted from the foreground for each bead. For replicate beads, outliers greater
than 3 median absolute deviations from the median were removed and the average
signal was calculated for the remaining intensities. Log-transformation was applied
to summarized data in order to remove mean-variance relationship in intensities.
Resulting data were then quantiles normalized (26). Quality control was performed
both on bead level and on bead summary data using the arrayQualityMetrics package
(v2.6.0) (27). For each of the 48,804 probes a detection score was calculated by
comparing their average signals with the summarized values for the negative control
probes. This step filtered the non-expressed probes, thus yielding 20,700 probes.
Probes were re-annotated using the illuminaHumanv3BeadID.db package available
from Bioconductor. Assessment of differential gene expression was done by means 10
of the limma method (20, 21). Throughout Benjamini-Hochberg (BH) (22) multiple
comparison adjusted probabilities, correcting for 20,700 tests, defined significance.
Human in-vitro gene expression data: Genes pertaining to metabolic signaling
pathways were selected and analyzed for differential expression in RPMI (control),
LPS and candida stimulated samples (4h and 24h) as described before (11) by using
limma (20, 21). Multiple-comparison BH-adjusted p-value < 0.05 defined significance.
Gene expression pathway analysis - Ingenuity pathway analysis (IPA, www.
ingenuity.com) was used to identify significant enrichment of canonical signaling
pathways. Genes were stratified as over- or under-expressed and analyzed by
selecting the Ingenuity gene knowledgebase as reference and specifying human
species. All other parameters were kept default. Association significance was
measured by Fisher’s exact test BH-adjusted p-values. Transcription factor binding
site motif analysis was performed on all multiple-comparison significant genes (BH

| 193
Chapter 10

p < 0.05) per comparison using the oPossum methodology (28, 29). The initial
2000bp of DNA sequence upstream and downstream of the gene transcription start
site was used. All other parameters were default. Fisher’s scores above median
and percent TFBS hits of all input DNA sequences > 50% were used as cutoffs for
transcription factor pathway analysis using the ToppGene bioinformatics suite (30,
31). Significance was demarcated using Fisher’s exact test BH-adjusted p-values
(BH p < 0.05).

RESULTS
The shift towards aerobic glycolysis in acute inflammation
The first aim of the study was to investigate cellular metabolism during stimulation
of leukocytes by pathogens. Microarray assessment of human peripheral blood
mononuclear cells (PBMCs) stimulated for 4h and 24h with either C. albicans (11)
(Figure S1A,B) or E. coli-derived lipopolysaccharide (LPS) (Figure S1C) revealed
a strong upregulation of mRNA pertaining to genes involved in glycolysis, whereas
expression of rate-limiting enzymes in the tricarboxylic acid (TCA; Krebs) cycle was
downregulated. In addition, expression of key genes involved in the mTOR/HIF-1α
pathway (important for regulation of glycolysis (25)) were also upregulated (Figure
S1A). These gene transcription data were validated by a strong increase in lactate
production and NAD+ concentration when cells were stimulated with C. albicans or
LPS (Figure 1A) demonstrating a shift towards aerobic glycolysis, thus illustrating
the induction of the Warburg effect (32). This shift towards glycolysis has been
shown to be driven by mTOR activation as an intracellular sensor of glucose (33). In
line with this, both C. albicans- and LPS-induced phosphorylation of the mTORC1
(mTOR complex 1) downstream targets S6K and 4EBP1 (33) after 2h of stimulation
(Figure 1B), showing that an mTOR regulated increase in anaerobic glycolysis is a
key metabolic pathway in acute inflammation.

The mTOR pathway is essential for survival in sepsis

Inhibition of the mTOR pathway in human PBMCs by metformin (an AMPK activator
(34)) inhibited S6K and 4EBP1 phosphorylation (Figure 1B); in addition, inhibition
of mTOR with metformin, rapamycin or torin1 (35) decreased cytokine production
induced by C. albicans after stimulation for 24h (TNFα, IL-1β, but not IL-6) or 5
days (IFNγ, IL-17, IL-22) (Figure 2A,B). In-vivo inhibition of metabolic pathways by
metformin resulted in a significantly lower survival in Candida sepsis in mice, lower
ex-vivo cytokine production by splenocytes and an increased fungal outgrowth in
kidneys but not liver. Taken together these results attest to the importance of the
mTOR pathway for robust cytokine production and an effective host defense (Figure
2C-E).

194 |
 Immunometabolism in Immunotolerance

10
Figure 1 – Immunometabolism is upregulated during the acute inflammatory phase. (A) Stimulation
of human PBMCs with LPS or C. albicans for 24h induces pro-inflammatory cytokine, lactate and NAD+
production (n=8). (B) Stimulation of human PBMCs for 2h with LPS or C. albicans upregulates the mTOR
complex 1 pathway targets p-S6K and p-4EBP1. 1h preincubation with the AMPK activator metformin
reverses activation of mTOR targets. (* p < 0.05, ** p < 0.01, Wilcoxon signed-rank test).

Regulation of cellular metabolism pathways in sepsis

After showing the important role of mTOR-induced glycolysis for host defense
during the acute phase of infection, we aimed to assess glycolysis and oxidative
phosphorylation in leukocytes of patients with sepsis. We assessed genome-
wide gene expression of whole blood leukocytes isolated from healthy volunteers
undergoing experimental endotoxemia, a human model of the inflammatory
response observed during sepsis, induced by intravenous administration of low-

| 195
Chapter 10

Figure 2 – Inhibition of the mTOR pathway reduces cytokine production and increases mortality.
(A) Inhibition of the mTOR pathway by rapamycin, torin-1, or metformin blocks the induction and release
of the pro-inflammatory cytokines TNFα and IL-1β after 24h by C. albicans in human PBMCs. (B) mTOR
inhibitors block human lymphocyte-derived cytokines IFNγ, IL-17 and IL-22 in vitro upon 7d RPMI or
C. albicans stimulation (n=6, each first bar represents a negative (RPMI) control). (C-E) In-vivo mTOR
inhibition with metformin (daily i.p. injection with PBS or metformin starting 1 day before C. albicans
inoculum until 7 days afterward) increases mortality for C. albicans sepsis in mice (C), increases fungal
outgrowth in the kidneys of the mice (D), and reduces pro-inflammatory cytokine production (at day 7)
upon restimulation of splenocytes for in vitro (E) with LPS (IL-1β, IL-6, TNFα after 24h) or C. albicans
(IFNγ, IL-17, IL-22 after 5 days) (each first bar represents a negative (RPMI) control). (n=5 mice per group
and for survival experiments 10 mice per group). (* p < 0.05, Wilcoxon singed-rank test, or Kaplan-Meier
curve).

dose E. coli LPS (4ng/kg) (36). This model is commonly characterized by robust
blood transcriptome alterations after LPS administration e.g. elevated expression of
typical pro- (IL-1, IL-6 signaling) and anti-inflammatory (IL-10 signaling) as well as
Toll-like receptor signaling genes at 4h post-LPS administration (Figure S2B) (36-
38).Genes from glycolysis I and mTOR pathways, but also oxidative phosphorylation
and fatty acid oxidation were under-expressed in blood leukocytes 4h after LPS
administration (Figure 3A), a time point at which the cytokine production capacity
of leukocytes was strongly reduced (Figure S2C,D). Metabolic regulators HIF1A,
NAMPT and EPAS1 (HIF2A) were over-expressed after LPS administration,
whereas no differences were uncovered for PPARA, PPARG and HIF1AN (HIF-1A
inhibitor) (Figure S3A-C). Moreover, M1 macrophage-like markers were largely over-

196 |
 Immunometabolism in Immunotolerance

A oxidative phosphorylation mTOR signaling fatty acid oxidation

B
E.coli C. albicans
50
1,624 676 40
1,367 766

Adj P value (-log10)

Adj P value (-log10)

40
30

30
20
20

10
10

0 0

M1 markers Expression (log2 fold) Expression (log2 fold)

C
8

Expression (log2 fold)

6

4
943 1,956 492 2
M2 markers

C. albicans
775 4,021 338 0
-2
-4

glycolysis I Unique patients’ response to E. coli

Expression (log2 fold)
Unique patients’ response to C. albicans E. coli
Common patients’ response common patients’ response
before LPS scaled expression
after LPS

D E oxidative phosphorylation mTOR signaling

fatty acid oxidation

10
glycolysis I

M2 markers

M1 markers

Healthy subjects
scaled expression
Patients’ response to C. albicans infection
Patients’ response to E. coli infection

Figure 3 – Blood transcriptome analysis of human endotoxemia and sepsis patients with Candida
and E. coli systemic infection. (A) Eight healthy male subjects were administered 4ng/kg E. coli LPS in
a clinically controlled setting and genome-wide blood transcriptional profiles were assessed before and
4h after LPS administration. (B-E) Clinically well-defined sepsis patients with E. coli or Candida blood
stream infections were enrolled (Table S1). Genome-wide blood transcriptome analysis of sepsis patients
revealed a pronounced alteration in gene expression compared to healthy subjects (B), which was a
predominantly common host response in both E. coli and Candida sepsis patients (Spearman’s rho =
0.91, p < 2.2x10^-16) (C). (D,E) Top 10 common over- or underexpressed gene pathways in Candida and
E. coli sepsis, demonstrating changes in metabolic pathways and macrophage differentiation markers.

| 197
Chapter 10

expressed after LPS administration, in contrast to predominant under-expression of

M2 macrophage-like markers (Figure 3A).
To assess whether these changes could be identified in actual sepsis patients
as well, genome-wide blood microarray analysis was performed in a cohort of 33
patients with bacterial sepsis (positive blood cultures for E. coli) and in 13 patients
with fungal sepsis (positive blood cultures for Candida spp.) (Figure 3B-E and Table
S1). Both bacterial and fungal sepsis induced strong changes in transcriptome
profiles, encompassing more than 2000 genes (fold change ≥ 2 or ≤ -2) for each
infection (Figure 3B). Most of the genes modified were common for both bacterial and
fungal sepsis, although specific gene sets for either infection could also be identified
(Figure 3C). Among the common pathways that were influenced in both types of
sepsis, changes in the expression of genes involved in cellular metabolism were
very prominent, including oxidative phospohorylation, glycolysis and mTOR signaling
pathways (Figure 3D). Sepsis patients manifested over-expression of glycolysis and
oxidative phosphorylation genes coupled with mitochondrial dysfunction, whereas
fatty acid oxidation and mTOR signaling genes were under-expressed (Figure 3E).
Furthermore, sepsis patients presented overexpression of M2-like genes and under-
expression of M1-like genes (Figure 3E). Analysis of transcription factor binding site
motifs in promoter regions of genes altered during sepsis revealed a clear role for
the mTOR-dependent HIF-1α axis in leukocyte gene regulation during both E. coli
and Candida sepsis (Figure S3D). This is in line with the findings of others, who
have shown the importance of HIF-1α in other processes than metabolism during
functional reprogramming of human monocytes in sepsis (2). These data show that
during sepsis profound changes in metabolism of leukocytes are encountered.

Tolerant monocytes display defective energy metabolism

In a following set of experiments we assessed whether induction of innate immune
tolerance in human monocytes modulates cellular metabolism. We used an in-vitro
model of innate immune tolerance induced by stimulation of monocytes with high
concentrations of LPS or C. albicans (in contrast with the low level stimulation that
induces priming (25, 39, 40)). When monocytes were rendered immunotolerant,
pro-inflammatory cytokine production upon restimulation was almost completely
abolished (Figure 4A). In line with this, restimulation of tolerant monocytes with
LPS resulted in reduced lactate and enhanced NAD+ production compared with
control cells, indicative of defective capacity to mount a Warburg effect (Figure
4A). Immunoblotting of the mTOR pathway showed decreased phosphorylation of
mTORC1 targets (Figure 4B). When glycolysis is impaired, β-oxidation of fatty acids
is often used as an alternative source of energy (41). However, monocytes that
were rendered tolerant by LPS pre-exposure were also characterized by decreased

198 |
 Immunometabolism in Immunotolerance

    
  

  

 


 
 
 

 
 



  

 

  


 
 

 

 

 













 
 
 
 
   


     




  


 





 




     


 

  

 
 

10






 







Figure 4 – In vitro innate immune tolerant monocytes have impaired metabolism. (A) To induce
immunotolerance, monocytes were pre-incubated with LPS (10 ng/ml) or C. albicans (10^4 CFU/ml). After
resting for 24h, cells were restimulated with RPMI (first 2 or 3 grouped bars) or 10ng/ml LPS (last 2 or 3
grouped bars) for 24h. Tolerant monocytes produced less pro-inflammatory cytokines and lactate (n=6
individual donors). (B) Activation of the downstream mTOR targets S6K and 4EBP1 is downregulated
in tolerant monocytes (24h stimulation, 24h rest), as are the fatty acid transporters CD36 and CPT1
(representative Western blot of 4 separate individual donors). (C) Tolerant monocytes (24h stimulation,
24h rest) display decreased oxygen consumption (n=6 first 2 panels display a representative donor).
basal = basal respiration, leak = proton leak after inhibition of ATP synthase, max = maximal oxygen
consumption, rox = residual oxygen consumption or non-mitochondrial oxygen consumption. (* p < 0.05,
** p < 0.01, *** p < 0.001. Wilcoxon signed-rank test).

| 199
Chapter 10

amounts of fatty acid transporters CD36 and CPT1 compared to the control
cells exposed to culture medium alone (Figure 4B). Finally, the assessment of
immunotolerant monocytes also showed a marked decrease in oxygen consumption
compared with naive monocytes (Figure 4C). Therefore, a decrease in all major
metabolic pathways (glycolysis, OxPhos, β-oxidation) is seen in immunotolerant
monocytes.

Severe metabolic defects in leukocytes of sepsis patients

To assess whether similar defects of cellular metabolism characterize leukocytes
from patients with sepsis, we assessed cytokine production capacity and glycolysis
in cells from a separate set of sepsis patients who either responded normally to
stimulation (Figure 5A; high responders, n=6), or those who lacked the capacity to
produce cytokines upon ex vivo stimulation with LPS (Figure 5A; immunotolerant,
n=5). Stimulation of PBMCs from healthy controls and high responder sepsis patients
showed normal secretion of cytokines. These cells were also able to mount lactate
and NAD+ release. In contrast, PBMCs of immunotolerant sepsis patients were
unable to produce lactate and NAD+ upon LPS stimulation (Figure 5A). Metabolic
processes in monocytes of patients during septic shock and recovery were also
assessed. When immunotolerant sepsis patients were followed in time (> 7 days),
ex-vivo cytokine and lactate production was restored upon patient recovery (Figure
5B).
Assessment of the mTOR pathway and fatty acid transporters (CD36 and CPT1)
in monocytes by immunoblot showed reduced activation in patients with sepsis.
These effects were reverted once patients recovered (Figure 5C). Consistent with
the data above showing severe metabolic disturbances in sepsis patients, maximum
oxygen consumption of PBMCs was also significantly impaired in sepsis patients,
compared to healthy controls (Figure 5D). These data demonstrate that both
glycolysis and oxidative metabolism pathways are strongly downregulated in sepsis
patients, leading to what we term here as ‘immunometabolic paralysis’ (Figure S4).

IFNγ partially restores cellular metabolism

Restoring energy metabolism might represent a potential therapy in sepsis patients
with immunometabolic paralysis. IFNγ is a cytokine with the capacity to potently
stimulate monocyte function and recombinant IFNγ therapy in septic patients has
been shown to (partially) reverse immunoparalysis both in vitro and in vivo (10, 42,
43). Moreover, IFNγ polarizes macrophage differentiation towards an M1 macrophage
phenotype, which is associated with increased glycolysis (44) and mTOR/HIF-1α
regulated metabolic switch from oxidative phosphorylation to glycolysis in mouse
dendritic cells (DC) and splenocytes, is dependent on autocrine IFNγ production (45).

200 |
 Immunometabolism in Immunotolerance

  
   

  

 
       
 

 

 


             



 




   

 
   

  
  
 





 
  


 

   

     

     


      
 

 

 


 

 

 



 


      

    

       
    
 
 
  

 
 

 



 
 

 
 


 














Figure 5 – Tolerant monocytes from septic patients show impaired metabolic pathways. (A) Cytokine
production, as well as lactate and NAD+ synthesis was strongly downregulated in a subgroup of patients
defined as immunotolerant or displaying immune paralysis, compared to healthy controls and patients
with normal cytokine responsiveness (‘high responders’) (healthy volunteers = 11, high responders =
6, low responders = 5). (B) Tolerant monocytes from septic patients have reduced cytokine production
upon ex vivo LPS stimulation, as well as reduced lactate and NAD+ production, which are restored upon
patient recovery (healthy volunteers = 10, patients = 8). (C) Activation of the mTOR targets S6K and
4EBP1 and fatty acid transporters CD36 and CPT1 are downregulated during sepsis and are restored
once patients have recovered. The last value for each patient represent the samples after recovery, while
the other samples are collected during the phase of immune paralysis. (D) Maximal oxygen consumption
is decreased in PBMCs of sepsis patients (red line) compared with PBMCs from healthy controls (black
line). basal = basal respiration, leak = proton leak after inhibition of ATP synthase, max = maximal oxygen 10
consumption, rox = residual oxygen consumption or non-mitochondrial oxygen consumption (last panel
are pooled data of the 3 patients). (* p < 0.05, ** p < 0.01, *** p < 0.001, One-way ANOVA).

We therefore hypothesized that IFNγ might be able to restore glycolysis in tolerant

monocytes. Firstly, we showed that treating LPS tolerant human monocytes in vitro
with IFNγ restored lactate production upon stimulation with LPS (Figure 6A), while
oxygen consumption was not influenced (Figure 6B). The inhibition of the mTOR
pathway with rapamycin abrogated the effect of IFNγ (Figure 6A). To further assess
the mTOR pathway in IFNγ therapy, tolerant and non-tolerant (naive) monocytes
were exposed to IFNγ for 2h, after which the phosphorylation of the mTOR pathway
was assessed by immunoblot. IFNγ was able to induce phosphorylation of the mTOR
pathway in both tolerant and non-tolerant monocytes (Figure 6C). Furthermore, in a
proof of concept trial (10), eight fungal sepsis patients were treated with recombinant
IFNγ three times a week. Ex-vivo stimulation of isolated PBMCs after subcutaneous

| 201
Chapter 10

administration of recombinant IFNγ showed an increase in lactate production, that

accompanied the upregulation of cytokine production capacity (10), indicating a
restoration of the capacity to mount glycolytic responses (Figure 6D). Therefore,
IFNγ is able to partially restore the metabolic defects in innate immune tolerance by
promoting glycolysis, which is impaired in immunotolerant monocytes.

DISCUSSION
Collectively, our study supports three main conclusions. Firstly, during an acute
phase of infection the shift from oxidative phosphorylation to aerobic glycolysis
(Warburg effect) is an important mechanism of host defense. Secondly, leukocytes
of patients with severe sepsis display severe defects in cellular energy metabolism

Figure 6 – Immune therapy with IFNγ partially restores the metabolic defects by induction of the
mTOR pathway. (A) When LPS-induced tolerant purified monocytes (24h stimulation, 24h rest) were
treated in vitro with IFNγ in various concentrations, the capacity of the cells to mount aerobic glycolysis
and respond with lactate release upon LPS stimulation was restored. In addition, lactate production
restored by 1000 or 100ng/ml IFNγ can be inhibited by rapamycin. (n=6) (B) Tolerant monocytes (24h
stimulation, 24h) were treated for 3h with PBS, or 1µg/ml IFNγ and oxygen consumption was measured.
(n=4) (C) Treating tolerant and normal monocytes with 1µg/ml IFNγ for 2h induces phosphorylation of the
mTOR pathway (n=6). (D) The impaired lactate production can be (partially) restored with recombinant
IFNγ therapy, when administered s.c three times a week (100 mg). Ex-vivo restimulation of PBMCs for
24h (with LPS, PHA or C. albicans) from sepsis patients (11) before (day 1=D1) and after (from day 2=D2)
start of therapy shows that IFNγ partially restores the capacity of cells to release lactate (n=5). (* p < 0.05,
** p < 0.01, *** p < 0.001, One-way ANOVA, or Wilcoxon signed-rank test).

202 |
 Immunometabolism in Immunotolerance

that are associated with impaired capacity to respond to secondary stimulation, a

process that is equivalent to a true ‘immunometabolic paralysis’. Thirdly, therapeutic
approaches that restore this metabolic defect might represent a novel therapeutic
approach for the treatment of sepsis.
In our experiments, tolerant leukocytes had broad defects in metabolic pathways,
failing to increase not only glycolysis, but also displaying decreased oxygen
consumption and lower fatty acid transport. This observation is somewhat unexpected,
as it shows that leukocytes of sepsis patients not merely reverse glucose metabolism
from glycolysis to oxidative phosphorylation, but display multiple energy metabolism
defects. These defects correlated with the loss of cytokine production capacity, which
were reversed upon recovery. Mitochondrial dysfunction has been previously shown
to correlate with a poor outcome in sepsis, but these studies mainly focused on non-
hematopoietic cells (46), with only one study reporting defects in leukocytes (8). Here
we show that the defects comprise several metabolic pathways and correlate with
immune function. A remaining point of discussion is whether the metabolic defects
are one of the main causes of the immunological phenotype or whether they are a
feature of adaptation of the immune cells during infection. However, there are strong
suggestions that infection and metabolic defects are intertwined for example on the
one hand we show that inhibition of metabolic pathways influences the immunologic
response, and on the other it has been shown that IL-10 downregulates glycolysis
in a murine model (47), suggesting a relation between cytokine production and
metabolism. Finally, an important aspect regards the cell populations in which these
metabolic changes occur during sepsis. Our experiments showing the importance
of regulation of metabolic pathways in innate immune tolerance were performed in
a whole blood stimulation assay that mimics the interplay of all cells of the immune
system. Although additional experiments were performed to assess the effects on 10
more specific cell populations (monocytes) in vitro, a comprehensive analysis of the
in-vivo changes in different cell subpopulations in sepsis patients is warranted.
An important discussion point is the fact that metformin, used as a modulator
of metabolic pathways, displays more effects than only activation of AMPK and
inhibition of the mTOR pathway. We have nevertheless decided to investigate its
effects due to the broad clinical use, making these experiments relevant from a
translational perspective. The mTOR inhibitor rapamycin could not be used to study
cellular metabolism in the live infection model, due to its well-known antifungal effect
(48). However, our use of more specific mTOR inhibitors in vitro such as torin-1
and rapamycin validated the mTOR effect on inflammation. Furthermore, a number
of studies reported that rapamycin inhibits TNFα production suggesting an anti-
inflammatory effect, similar to our observations. In contrast, other studies have shown
rapamycin to upregulate IL-12 production and downregulate IL-10 production, thus

| 203
Chapter 10

resulting in immunostimulatory effects, as seen for IL-6 in our in-vitro experiments.

Several hypotheses have been raised to explain these differences, most likely
the Akt/mTOR/HIF-1α pathway has differential effects on the various cytokines,
depending on the cell type and stimulus or infection present (49).
The present study identifies cellular metabolic processes as a potential therapeutic
target in sepsis. So far only very few agents with known metabolic regulatory capacity
have been tested in sepsis models. Among them, PPARγ transcription factor
activation, that is associated with increased glycolysis and fatty acid metabolism
(50-52), has been shown to have a beneficial effect on mortality in murine sepsis
models (53-55). Furthermore, several therapeutic agents capable of restoring
mitochondrial activity have been studied in sepsis rodent models with beneficial
outcomes (56). In the present study we investigated IFNγ as it has been known to
upregulate cytokine production in innate immune tolerance (10, 42, 43). Autocrine
IFNγ production is involved in the mTOR/Hif-1α-dependent metabolic switch from
oxidative phosphorylation to glycolysis in mouse DCs and splenocytes (45). Indeed,
our data show that in-vitro exposure of immunotolerant monocytes to IFNγ activates
the mTOR pathway and partially restores the capacity of leukocytes to mount a
glycolytic response. These data and our findings differ from a recent report which
shows the downregulatory capacity on mTORC1, with methodological differences
and different cell populations as likely causes for this (57). Thus, metabolic and
immunologic recoveries seem to be correlated, and improved strategies to correct
the metabolic abnormalities should be considered in patients with sepsis and immune
paralysis.
Apart from the IFNγ effects on mTOR, other potential mechanisms might play
a role as well. Firstly, IFNγ induces sustained occupancy of transcription factors
STAT1 and IRF1, as well as induces histone acetylation at promoter and enhancer
sites of pro-inflammatory cytokines (58), and possibly metabolic genes. Secondly,
miRNA-146 plays an important role in disruption of pro-inflammatory cytokine
synthesis in innate immune tolerance (59), and IFNγ could potentially influence
its expression, as shown for other miRNAs (60, 61). Thirdly, restoring metabolism
pathways by IFNγ could potentially lead to an increase of succinate, an important
positive regulator of IL-1β production via HIF-1α (62). Finally, sirtuins have been
shown to play an important role in the regulation of the immunotolerant phenotype
of monocytes, and inhibition of SIRT1 can restore the immunotolerant (metabolic)
features of monocytes (41). Promisingly, IFNγ has also been shown to repress the
expression of SIRT1 in muscle cells (63).
In conclusion, the switch from oxidative phosphorylation to aerobic glycolysis
is an important component of the cellular response to infection. Broad defects in
the energy metabolism of leukocytes comprising both glycolysis and oxidative

204 |
 Immunometabolism in Immunotolerance
mechanisms characterize a state of immunometabolic paralysis in patients with
severe sepsis, and this gives both important new insights in the pathophysiology
of the disease, and may represent a novel therapeutic target. Immunotherapy with
recombinant IFNγ is one of the potential approaches to correct these defects.
Accession codes.
GSE65682: MARS sepsis patient samples;
GSE48119: Human endotoxemia model (4ng/kg E. coli LPS);
GSE42606: Healthy volunteer in-vitro stimulation gene expression data.
REFERENCES
1. Angus DC, van der Poll T. Severe sepsis and septic
shock. The New England journal of medicine.
2013;369(21):2063.
2. Shalova IN, Lim JY, Chittezhath M, Zinkernagel AS,
Beasley F, Hernandez-Jimenez E, et al. Human
Monocytes Undergo Functional Re-programming
during Sepsis Mediated by Hypoxia-Inducible Factor-
1alpha. Immunity. 2015;42(3):484-98.
3. Vachharajani V, Liu T, McCall CE. Epigenetic
coordination of acute systemic inflammation:
potential therapeutic targets. Expert review of clinical
immunology. 2014;10(9):1141-50.
4. Emanuelli B, Vienberg SG, Smyth G, Cheng C,
Stanford KI, Arumugam M, et al. Interplay between
FGF21 and insulin action in the liver regulates
metabolism. The Journal of clinical investigation.
2014;124(2):515-27.
5. Carre JE, Orban JC, Re L, Felsmann K, Iffert W,
Bauer M, et al. Survival in critical illness is associated
with early activation of mitochondrial biogenesis. Am
J Respir Crit Care Med. 2010;182(6):745-51.
6. Singer M. Cellular dysfunction in sepsis. Clinics in
chest medicine. 2008;29(4):655-60, viii-ix.
7. Carre JE, Singer M. Cellular energetic metabolism in
sepsis: the need for a systems approach. Biochimica
et biophysica acta. 2008;1777(7-8):763-71.
8. Belikova I, Lukaszewicz AC, Faivre V, Damoisel C,
Singer M, Payen D. Oxygen consumption of human
peripheral blood mononuclear cells in severe human
sepsis. Critical care medicine. 2007;35(12):2702-8.
9. Chen T, Lin X, Xu J, Tan R, Ji J, Shen P. Redox
imbalance provokes deactivation of macrophages
in sepsis. Proteomics Clinical applications.
2009;3(8):1000-9.
10. Delsing CE, Gresnigt MS, Leentjens J, Preijers
F, Frager FA, Kox M, et al. Interferon-gamma as
adjunctive immunotherapy for invasive fungal
infections: a case series. BMC infectious diseases.
2014;14:166.
11. Smeekens SP, Ng A, Kumar V, Johnson MD,
Plantinga TS, van Diemen C, et al. Functional
genomics identifies type I interferon pathway as
central for host defense against Candida albicans.
Nature communications. 2013;4:1342.
12. R ct. R: A language and environment for statistical
computing. R Foundation for Statistical Computing,
Vienna, Austria URL http://wwwR-projectorg/. 2014.
13. Klein Klouwenberg PM, Ong DSY, Bos LDJ, de
Beer FM, van Hooijdonk RTM, Huson MA, et al.
Interobserver Agreement of Centers for Disease
Control and Prevention Criteria for Classifying
Infections in Critically Ill Patients. Critical Care
Medicine. 2013;41(10):2373-8.
14. Klein Klouwenberg PM, van Mourik MSM, Ong DSY,
Horn J, Schultz MJ, Cremer OL, et al. Electronic
Implementation of a Novel Surveillance Paradigm
for Ventilator-associated Events Feasibility and
Validation. American Journal of Respiratory and
Critical Care Medicine. 2014;189(8):947-55.
15. Knaus WA, Draper EA, Wagner DP, Zimmerman
JE. Apache-Ii - A Severity of Disease Classification-
System. Critical Care Medicine. 1985;13(10):818-29.
16. Gautier L, Cope L, Bolstad BM, Irizarry RA. affy -
analysis of Affymetrix GeneChip data at the probe
level. Bioinformatics. 2004;20(3):307-15.
17. Bourgon R, Gentleman R, Huber W. Independent
filtering increases detection power for high-
throughput experiments. Proc Natl Acad Sci U S A.
2010;107(21):9546-51.
18. Leek JT, Storey JD. Capturing heterogeneity in gene
expression studies by surrogate variable analysis.
Plos Genetics. 2007;3(9):1724-35.
19. Johnson W, Li C, Rabinovic A. Adjusting batch effects
in microarray expression data using empirical Bayes
methods. Biostatistics. 2007;8(1):118-27.
20. GK S. Limma: linear models for microarray data. In: R
G, VJ C, H W, RA I, S D, editors. Bioinformatics and
Computational Biology Solutions using R: Springer;
2005. p. 397-420.
21. van Lieshout MH, Scicluna BP, Florquin S, van der
Poll T. NLRP3 and ASC Differentially Affect the Lung
Transcriptome during Pneumococcal Pneumonia.
Am J Respir Cell Mol Biol. 2014;4(50):699-712.
22. Benjamini Y, Hochberg Y. Controlling the False
Discovery Rate - A Practical and Powerful Approach
to Multiple Testing. Journal of the Royal Statistical
Society Series B-Methodological. 1995;57(1):289-
300.
23. Gentleman RC, Carey VJ, Bates DM, Bolstad B,
Dettling M, Dudoit S, et al. Bioconductor: open
software development for computational biology and
bioinformatics. Genome biology. 2004;5(10):R80.
24. Dunning MJ, Smith ML, Ritchie ME, Tavare S.
beadarray: R classes and methods for Illumina bead-
25.
based data. Bioinformatics. 2007;23(16):2183-4.
Cheng SC, Quintin J, Cramer RA, Shepardson KM,
10
Saeed S, Kumar V, et al. mTOR- and HIF-1alpha-
mediated aerobic glycolysis as metabolic basis for
trained immunity. Science. 2014;345(6204):1250684.
26. Bolstad BM, Irizarry RA, Astrand M, Speed TP.
A comparison of normalization methods for high
density oligonucleotide array data based on variance
and bias. Bioinformatics. 2003;19(2):185-93.
27. Kauffmann A, Gentleman R, Huber W.
arrayQualityMetrics--a bioconductor package
for quality assessment of microarray data.
Bioinformatics. 2009;25(3):415-6.
28. Ho Sui SJ, Fulton DL, Arenillas DJ, Kwon AT,
Wasserman WW. oPOSSUM: integrated tools for
analysis of regulatory motif over-representation.
Nucleic acids research. 2007;35(Web Server
issue):W245-52.
29. Ho Sui SJ, Mortimer JR, Arenillas DJ, Brumm
J, Walsh CJ, Kennedy BP, et al. oPOSSUM:
identification of over-represented transcription factor
binding sites in co-expressed genes. Nucleic acids
research. 2005;33(10):3154-64.
30. Chen J, Bardes EE, Aronow BJ, Jegga AG.
ToppGene Suite for gene list enrichment analysis and
candidate gene prioritization. Nucleic acids research.
2009;37(Web Server issue):W305-11.
31. Hoeksema MA, Scicluna BP, Boshuizen MC, van der
Velden S, Neele AE, Van den Bossche J, et al. IFN-
gamma Priming of Macrophages Represses a Part of
the Inflammatory Program and Attenuates Neutrophil
Recruitment. J Immunol. 2015.
| 205
Chapter 10

32. Rodriguez-Prados JC, Traves PG, Cuenca J, Rico Heart failure. 2013;6(3):550-62.
D, Aragones J, Martin-Sanz P, et al. Substrate Fate 54. Lin H, Tong ZH, Xu QQ, Wu XZ, Wang XJ, Jin XG,
in Activated Macrophages: A Comparison between et al. Interplay of Th1 and Th17 cells in murine
Innate, Classic, and Alternative Activation. Journal of models of malignant pleural effusion. American
immunology. 2010;185(1):605-14. journal of respiratory and critical care medicine.
33. Inoki K, Ouyang H, Li Y, Guan KL. Signaling by 2014;189(6):697-706.
target of rapamycin proteins in cell growth control. 55. Ferreira AE, Sisti F, Sonego F, Wang S, Filgueiras
Microbiology and molecular biology reviews : MMBR. LR, Brandt S, et al. PPAR-gamma/IL-10 axis
2005;69(1):79-100. inhibits MyD88 expression and ameliorates murine
34. Choi YK, Park KG. Metabolic roles of AMPK and polymicrobial sepsis. Journal of immunology.
metformin in cancer cells. Molecules and cells. 2014;192(5):2357-65.
2013;36(4):279-87. 56. Dare AJ, Phillips AR, Hickey AJ, Mittal A, Loveday
35. Zhou H, Luo Y, Huang S. Updates of mTOR B, Thompson N, et al. A systematic review of
inhibitors. Anti-cancer agents in medicinal chemistry. experimental treatments for mitochondrial dysfunction
2010;10(7):571-81. in sepsis and multiple organ dysfunction syndrome.
36. van der Meer AJ, Scicluna BP, Moerland PD, Lin J, Free radical biology & medicine. 2009;47(11):1517-
Jacobson EW, Vlasuk GP, et al. The Selective Sirtuin 25.
1 Activator SRT2104 Reduces Endotoxin-Induced 57. Su X, Yu Y, Zhong Y, Giannopoulou EG, Hu X, Liu H,
Cytokine Release and Coagulation Activation in et al. Interferon-gamma regulates cellular metabolism
Humans. Critical care medicine. 2015;43(6):e199- and mRNA translation to potentiate macrophage
202. activation. Nature immunology. 2015;16(8):838-49.
37. Scicluna BP, van ‘t Veer C, Nieuwdorp M, Felsmann 58. Qiao Y, Giannopoulou EG, Chan CH, Park SH,
K, Wlotzka B, Stroes ES, et al. Role of tumor necrosis Gong S, Chen J, et al. Synergistic activation of
factor-alpha in the human systemic endotoxin- inflammatory cytokine genes by interferon-gamma-
induced transcriptome. PloS one. 2013;8(11):e79051. induced chromatin remodeling and toll-like receptor
38. Calvano SE, Xiao WZ, Richards DR, Felciano RM, signaling. Immunity. 2013;39(3):454-69.
Baker HV, Cho RJ, et al. A network-based analysis 59. Brudecki L, Ferguson DA, McCall CE, El Gazzar
of systemic inflammation in humans. Nature. M. MicroRNA-146a and RBM4 form a negative
2005;437(7061):1032-7. feed-forward loop that disrupts cytokine mRNA
39. Saeed S, Quintin J, Kerstens HH, Rao NA, translation following TLR4 responses in human
Aghajanirefah A, Matarese F, et al. Epigenetic THP-1 monocytes. Immunology and cell biology.
programming of monocyte-to-macrophage 2013;91(8):532-40.
differentiation and trained innate immunity. Science. 60. Schmitt MJ, Philippidou D, Reinsbach SE, Margue C,
2014;345(6204):1251086. Wienecke-Baldacchino A, Nashan D, et al. Interferon-
40. Morris MC, Gilliam EA, Li L. Innate immune gamma-induced activation of Signal Transducer and
programing by endotoxin and its pathological Activator of Transcription 1 (STAT1) up-regulates the
consequences. Frontiers in immunology. 2014;5:680. tumor suppressing microRNA-29 family in melanoma
41. Liu TF, Vachharajani VT, Yoza BK, McCall CE. cells. Cell communication and signaling : CCS.
NAD+-dependent sirtuin 1 and 6 proteins coordinate 2012;10(1):41.
a switch from glucose to fatty acid oxidation during 61. Imaizumi T, Tanaka H, Tajima A, Yokono Y, Matsumiya
the acute inflammatory response. The Journal of T, Yoshida H, et al. IFN-gamma and TNF-alpha
biological chemistry. 2012;287(31):25758-69. synergistically induce microRNA-155 which regulates
42. Docke WD, Randow F, Syrbe U, Krausch D, TAB2/IP-10 expression in human mesangial cells.
Asadullah K, Reinke P, et al. Monocyte deactivation in American journal of nephrology. 2010;32(5):462-8.
septic patients: restoration by IFN-gamma treatment. 62. Tannahill GM, Curtis AM, Adamik J, Palsson-
Nature medicine. 1997;3(6):678-81. McDermott EM, McGettrick AF, Goel G, et al.
43. Leentjens J, Kox M, Koch RM, Preijers F, Joosten Succinate is an inflammatory signal that induces IL-1
LA, van der Hoeven JG, et al. Reversal of through HIF-1alpha. Nature. 2013;496(7444):238-42.
immunoparalysis in humans in vivo: a double-blind, 63. Li P, Zhao Y, Wu X, Xia M, Fang M, Iwasaki Y,
placebo-controlled, randomized pilot study. Am J et al. Interferon gamma (IFN-gamma) disrupts
Respir Crit Care Med. 2012;186(9):838-45. energy expenditure and metabolic homeostasis
44. Zhu L, Zhao Q, Yang T, Ding W, Zhao Y. Cellular by suppressing SIRT1 transcription. Nucleic acids
metabolism and macrophage functional polarization. research. 2012;40(4):1609-20.
International reviews of immunology. 2015;34(1):82-
100.
45. Pantel A, Teixeira A, Haddad E, Wood EG, Steinman
RM, Longhi MP. Direct type I IFN but not MDA5/
TLR3 activation of dendritic cells is required for
maturation and metabolic shift to glycolysis after poly
IC stimulation. PLoS biology. 2014;12(1):e1001759.
46. Brealey D, Brand M, Hargreaves I, Heales S,
Land J, Smolenski R, et al. Association between
mitochondrial dysfunction and severity and outcome
of septic shock. Lancet. 2002;360(9328):219-23.
47. Martin FP, Rezzi S, Philippe D, Tornier L, Messlik
A, Holzlwimmer G, et al. Metabolic assessment of
gradual development of moderate experimental
colitis in IL-10 deficient mice. Journal of proteome
research. 2009;8(5):2376-87.
48. Vezina C, Kudelski A, Sehgal SN. Rapamycin (AY-
22,989), a new antifungal antibiotic. I. Taxonomy
of the producing streptomycete and isolation of
the active principle. The Journal of antibiotics.
1975;28(10):721-6.
49. Weichhart T, Hengstschlager M, Linke M. Regulation
of innate immune cell function by mTOR. Nature
reviews Immunology. 2015;15(10):599-614.
50. Shapiro H, Lutaty A, Ariel A. Macrophages,
meta-inflammation, and immuno-metabolism.
TheScientificWorldJournal. 2011;11:2509-29.
51. Panasyuk G, Espeillac C, Chauvin C, Pradelli LA,
Horie Y, Suzuki A, et al. PPARgamma contributes
to PKM2 and HK2 expression in fatty liver. Nature
communications. 2012;3:672.
52. Vats D, Mukundan L, Odegaard JI, Zhang L, Smith
KL, Morel CR, et al. Oxidative metabolism and PGC-
1beta attenuate macrophage-mediated inflammation.
Cell metabolism. 2006;4(1):13-24.
53. Drosatos K, Khan RS, Trent CM, Jiang H, Son NH,
Blaner WS, et al. Peroxisome proliferator-activated
receptor-gamma activation prevents sepsis-related
cardiac dysfunction and mortality in mice. Circulation

206 |
 Immunometabolism in Immunotolerance

ICU patients

Healthy Fungal sepsis Bacterial sep-

subjects (Candida) sis (E. coli)

(n=42) (n=13) (n=33)

p
Demographics
Age, years (IQR) 35 (30-63) 60 (47-66) 67 (56 -74) 0.065a
Gender, % male 57 62 58 1b
Severity and complications
APACHE IV score, median (IQR) - 110 (89-113) 87 (69-102) 0.35a
Septic shock % - 46 49 1b
Comorbities
Diabetes mellitus % - 0 27 0.044b
COPD % - 8 9 1b
Congestive heart failure % - 8 6 1b
Hypertension % - 15 21 1b
Hematological malignancy % - 0 3 1b
Treatment
Mechanical ventilation % - 85 76 0.70b
Outcome
ICU mortality % - 46 15 0.051b
Hospital mortality % - 54 27 0.17b 10
30 day mortality % - 38 18 0.25b
90 day mortality % - 54 30 0.18b
ICU length of stay, days (IQR) - 22 (8-27) 5 (2-11) 0.0051a
Hospital length of stay, days 0.58a
- 34 (18-61) 47 (18-72)
(IQR)

Table S1 - Characteristics and demographics. Characteristics and demographics of the MARS

intensive care unit (ICU) patient cohort with blood culture positive Escherichia coli (E. coli) or Candida
species and healthy control subjects. Significance in comparisons was demarcated at p < 0.05. COPD,
chronic obstructive pulmonary disease. APACHE, Acute Physiology and Chronic Health Evaluation. a
Wilcoxon rank sum test probability; b Fisher’s exact test probability.

| 207
Chapter 10

Figure S1 - Gene expression profiles. A. Heatmap representation of multiple-comparison adjusted

significant glycolysis and mTOR signaling gene expression analysis of healthy human donor PBMC
samples stimulated for 4h or 24h with (a) C. albicans, and (b) E. coli LPS.

208 |
 Immunometabolism in Immunotolerance

Figure S2 - Endotoxin administration in healthy volunteers. Genome-wide blood gene expression

analysis in healthy volunteer samples before and 4h after intravenous administration of E. coli LPS.
10
(a) Volcano plot representation of gene expression alterations post-LPS (integrating log2 fold changes and
multiple-comparison adjusted p-values). Red denotes over-expressed genes (log2 fold change ≥ 1); blue
denotes under-expression (log2 fold change ≤ -1). Horizontal line depicts multiple comparison adjusted
p=0.05. (b) Ingenuity canonical signaling pathway enrichment of over-expressed (red) and under-
expressed (blue) genes showing over-expression of prototypical pro-inflammatory and anti-inflammatory
pathways concomitant with under-expression of predominantly metabolic signaling pathways. Whole
blood (c) and PBMCs (d) isolated before (pre-LPS) and 4h after in-vivo LPS administration (post-LPS)
were re-stimulated with RPMI medium or LPS. Supernatants were used to measure the abundance of
TNFα and IL-6. *** p < 0.0001, ** p < 0.01.

| 209
Chapter 10

210 |
 Immunometabolism in Immunotolerance

Figure S3 - Transcription factor analysis. (a, b) HIF1A, EPAS1 (HIF2A), NAMPT, PPARA, PPARG and
HIF1AN expression in the human endotoxemia model (c) as well as E. coli and Candida sepsis (d). blue,
under-expression; red, over-expression. (c) Diagrammatic representation of the mTOR signaling pathway
with gene expression log2 fold changes overlaid (green = under-expressed). (d) Overrepresentation
analysis of transcription factor binding site motifs showed the mTOR-dependent HIF1A transcription
factor was predicted as highly active in both E. coli and Candida sepsis. (TF, transcription factor).

Figure S4 - Overview of metabolic states during sepsis. During the acute hyperinflammatory
phase, immunometabolism is upregulated by means of the Warburg effect (upregulated glycolysis and
downregulated oxidative phosphorylation), while during the immune paralysis state all major metabolic
pathways are downregulated; metabolic paralysis.
10

| 211
 Chapter 11

Transcriptional and metabolic

reprogramming induce an inflammatory
phenotype in non-medullary thyroid
carcinoma-induced macrophages

Rob J.W. Arts*, Theo S. Plantinga*, Sander Tuit, Thomas Ulas, Bas Heinhuis,
Marika Tesselaar, Yvette Sloot, Gosse J. Adema, Leo A.B. Joosten, Johannes W.A.
Smit, Mihai G. Netea, Joachim L. Schultze, Romana T. Netea-Maier.

*These authors have contributed equally

Oncoimmunol 2016;12:e1229725
Chapter 11

ABSTRACT

Tumor associated macrophages (TAMs) are key components of the tumor

microenvironment in non-medullary thyroid cancer (TC), the most common
endocrine malignancy. However, little is known regarding the regulation of their
function in TC. Transcriptome analysis in a model of TC-induced macrophages
identified increased inflammatory characteristics and rewiring of cell metabolism
as key functional changes. This functional reprogramming was partly mediated by
TC-derived lactate that induced upregulation of cytokine production through an Akt/
mTOR-dependent increase in aerobic glycolysis. This led to epigenetic modifications
at the level of histone methylation, and subsequently long-term functional changes.
Immunohistochemistry assessment validated the increase in glycolysis enzymes
and lactate receptor in TAMs in tissue samples from patients with TC. In conclusion,
Akt/mTOR-dependent glycolysis mediates TC-induced reprogramming of TAMs and
inflammation, and this may represent a novel therapeutic target in TC.

214 |
 Reprogramming of TAMs

Tumor associated macrophages (TAMs) and cancer cells have an important

mutual relationship: on the one hand the tumor modulates the function of infiltrating
macrophages, and thus contributes to reprogramming of TAMs, while on the other
hand TAMs influence the behavior of cancer cells (1). Theoretically, macrophages
have the potential to play an effective role in elimination of tumor cells; however,
there are also important lines of evidence that TAMs promote cancer cell survival,
proliferation, metastases, angiogenesis and immune suppression (2). The impact
of TAMs on tumor progression very likely depends on their specific reprogramming
within the tumor, a process influenced by factors of the local microenvironment such
as hypoxia, release of local mediators (e.g. cytokines, growth factors), as well as
metabolic products released by either the cancer cells and/or other immune and
stroma cells (1-4). The pathways and mechanisms involved in the reprogramming
of TAMs are incompletely understood and in the present study we aimed to
investigate the phenotypic and functional characteristics of TAMs in a model of
non-medullary thyroid cancer (TC). TC is the most common endocrine malignant
tumor and of all cancer types has the highest rise in incidence (5). Previous studies
have shown that particularly anaplastic and poorly differentiated TCs, which have
a very poor prognosis, are highly infiltrated with TAMs and that this correlates with
prognosis. In these tumors TAMs represent the most prominent component of the
tumor microenvironment (6, 7). Pharmacological depletion of TAMs using CSF-1R
inhibition in a murine model of TC has been reported to reduce tumor development
and progression (8). These data suggest that TAMs have protumorigenic effects in
TC and might represent promising therapeutic targets for tumors that are resistant
to conventional treatment. Nevertheless, little is known about the role of the TAMs in
TC and on the factors driving the functional reprograming the macrophages within
the context of TC. To this end, we used a complementary approach that combines a
discovery-based methodology on transcriptome analysis of human monocytes that
have been co-cultured with TC cells and differentiated into TC-induced macrophages
to reveal essential pathways in specific reprogramming of these macrophages, 11
with immunological, metabolic and genetic approaches to validate the pathways
identified. We show that TC-induced macrophages are characterized by important
immunological and metabolic rewiring that impacts their function and that these
metabolic changes are being recapitulated in the TAMs in tissue samples from
patients with TC. These findings may help the identification of novel therapeutic
approaches for TC and potentially for other malignant processes as well.

MATERIALS AND METHODS

Co-culture model of TC cell lines and human monocytes - The TC cell line in-
vitro experiments were performed using TPC1 (papillary, RET/ PTC rearrangement),

| 215
Chapter 11

BC-PAP (papillary, BRAF V600E mutation), and FTC133 (follicular, PTEN deficient)
cell lines (9). The human glioblastoma cell lines U87 and U251 were kindly provided
by Prof. G.J. Adema and drs P. Gielen, Radboud umc Nijmegen. Peripheral blood
mononuclear cells were isolated by density gradient centrifugation using Ficoll-
plaque (GE Healthcare, Diegem Belgium) from buffy coats (Sanquin bloodbank,
Nijmegen, The Netherlands), or healthy volunteers after informed consent (ethical
approval CMO 2010-104). After adhesion for 1h in the 96-well plates, the non-
adherent cells comprising mainly lymphocytes were discarded, and the adherent
monocytes were incubated further with the tumor cell lines. In selected experiments
such as those assessing cell transcriptome, an additional step of purification using
CD14-labelled magnetic beads was performed in order to obtain a highly purified
monocyte population.
The cancer cell lines were grown in culture medium RPMI-1640 Dutch
modification (Life Technologies, Carlsbad, California, USA) supplemented with
gentamycin 50µg/ml, glutamax 2mM, pyruvate 1mM, and 10% Fetal Calf Serum
(Gibco, Life Technologies). A trans-well system used ThinCertTM cell culture inserts
on a 24-well plate (Greiner Bio-One GmbH, Austria). Cell counts were performed
in a Coulter particle counter (Beckman Coulter Inc.). A total of 1x10^5 TPC1 cells
(or the other TC cell lines, as indicated) in 250µl culture medium were added to the
upper compartment of the trans-well system, while RPMI was added to the lower
compartment. The cells were incubated for 24h at 37°C, 5% CO2. Next, the cells
were washed with PBS and PBMCs were prepared in culture medium: RPMI (Life
Technologies, Carlsbad, California, USA) supplemented with glucose 5mM, pyruvate
1mM, glutamine 2mM, gentamicin 50µg/mL and HEPES 10mM (Life Technologies,
Carlsbad, California, USA). A total of 1x10^6 PBMCs in 500µl were added to the
lower compartment of the trans-well system. PBMCs and cancer cell lines were
co-cultured for 24h at 37°C. In some experiments the mTOR inhibitor rapamycin
(100nM, Bio Connect, Huissen, The Netherlands), glutaminase inhibitor BPTES
(50µM, Sigma-Aldrich Chemie, Zwijndrecht, The Netherlands), G6PD inhibitor
6-aminonicotinamide (100nM, Sigma), CPT-1 inhibitor etomoxir (10µM, Sigma),
ATP synthase inhibitor oligomycin (1µM, Sigma), 500µM 5’-deoxy-5’(methylthio)
adenosine (MTA, sigma), lactate receptor antagonist α-cyano-4-hydrocycinnamioic
acid (1mM, Sigma) or VEGF receptor antagonist Sorafenib (100nM, Bio Connect)
were added to the medium.
After 24h incubation, the cell culture inserts containing RPMI control medium or
TPC1 cells were discarded and the PBMCs were stimulated for 24h with RPMI or
10ng/ml LPS (E. coli strain O55:B5, Sigma Chemical Co, St. Louis, MO), as substitute
for endogenous TLR4 ligand signaling, 10µg/ml Pam3Cys (EMC microcollection) or
10ng/ml IL-1α (Hoffman/Roche). At the end of the incubation period, supernatant

216 |
 Reprogramming of TAMs

was collected and stored at -20oC until further analysis, or cells were collected for
further analysis.
RNA isolation followed by deep sequencing - Total RNA was extracted from
24h TPC1 co-cultured macrophages and 24h RPMI cultured monocyte controls (4
donors) after 4h and 24h of additional incubation in RPMI only, using RNeasy Mini
and Microkits (Qiagen). 50ng of RNA was converted into cDNA libraries according
to the TruSeq RNA library preparation kit v2 and libraries were sequenced on the
HiSeq 1500 system and demultiplexed using CASAVA v1.8 (Illumina). Detail of the
further analysis can be found in the Supplementary data. The detailed data have
been deposited in the GEO database with accession number GSE76445.
Cytokine, chemokine, VEGF and lactate production - IL-6, IL-8 (Sanquin,
Amsterdam, Netherlands), TNFα (R&D, the Netherlands) concentrations in the
culture supernatant were measured by commercial ELISA kits according to the
instruction of the manufacturer. Granulocyte macrophage colony-stimulating factor
(GM-CSF), monocyte chemotactic protein 1 (MCP-1), and vascular endothelial
growth factor (VEGF, all Bio-rad, Veenendaal, the Netherlands) were measured by
Magpix (Luminex Corporation). Lactate was measured by a Lactate Fluorometric
Assay Kit (Biovision, CA, USA).
Metabolic assays using the Seahorse system - TC-induced macrophages were
cultured as described above and after 24h detached with Versene (ThermoFisher
Scientific) from the culture plates. 1x10^5 cells in triplicate were plated onto overnight-
calibrated cartridges in assay medium (RPMI with 0.6mM glutamine, pH adjusted to
7.4. For OCR also 5mM glucose and 1mM pyruvate was added) and incubated
for 1h in a non-CO2 corrected incubator at 37oC. Oxygen consumption rate (OCR)
and extracellular acidification rate (ECAR) were analysed using a cell mito stress
(OCR) or glycolysis stress test (ECAR) kit in a XFp analyser (Seahorse bioscience,
Copenhagen, Denmark) with final concentrations of 1μM oligomycin, 1μM FCCP,
0,5μM Rotenone/Antimycin A, 10mM glucose, and 50mM 2-DG.
Western blot assessments - TC-induced macrophages were cultured as described 11
above and lysed after 24h being relieved from the tumor cells. Total protein amounts
were determined by BCA assay (Thermo Fisher Scientific) and equal amounts of
proteins were loaded on pre-casted 4-15% gels (Biorad, CA, USA). The separated
proteins were transferred to a nitrocellulose membrane (Biorad), which was blocked
in 5% BSA (Sigma). Incubation overnight at 4°C with rabbit polyclonal antibodies
against p-S6K, p-4EBP1, p-mTOR (Cell Signaling, Danvers, MA, USA), and actin
(Sigma) were used to determine the protein expression, which was visualized using
a polyclonal secondary antibody (Dako, Belgium) and SuperSignal West Femto
Substrate (Thermo Fisher Scientific) or ECL (Biorad).
Chromatin immunoprecipitation (ChIP) - Cells were isolated and cultured

| 217
Chapter 11

as described above. After being relieved 24h from the TPC1 cells, TC-induced
macrophages were detached from the plate with 500μl Trypsin per well and fixed
in methanol-free 1% formaldehyde and stored at 4oC until further processing. Fixed
cells were sonicated for 10min in a Bioruptor pico sonicator (Diagenode, Seraing,
Belgium). Immunoprecipitation was performed using antibodies against H3K4me3
and H3K9me3 (Diagenode, Seraing, Belgium). After ChIP, DNA was processed
further for qPCR analysis using the SYBR green method. Samples were analyzed
by a comparative Ct method. Primer sequences can be found in Table S1.
Immunohistochemistry - Glycolytic enzymes third human isoform of
6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase and pyruvate kinase 2
(PFKFB3, PKM2), lactate receptor GPR81 and CD68 protein expression was
evaluated by immunohistochemical staining of formalin-fixed paraffin-embedded
(FFPE) TC tissue sections. To remove the paraffin, tissues were incubated twice
in xylene and successively in 100%, 96% and 70% of alcohol for 5min each step.
Antigens were retrieved with citrate buffer for 2min in the microwave (800 W) and
10min at RT (Citrate buffer: pH=6.0, 16.4ml sodium citrate (0.1 M) with 3.6ml citric
acid (0.1M) in 180ml H2O). The endogenous peroxidase activity was blocked with
3% of H2O2 in methanol for 15min at RT. Furthermore, since tumor-like tissues
contain endogenous biotin, this was blocked in the tissue sections by an avidin/
biotin blocking kit according to the manufacturers’ protocol (Vector Laboratories,
CA, USA). Sections were incubated with 20% goat serum diluted in PBS for 10min
and subsequently with the first antibody (PFKFB3 (ab96699, Abcam, 1:100), PKM2
(3198, Cell Signalling, 1:100), GPR81 (ab188647, Abcam, 1:50), CD68 (KP1, DAKO,
1:8000) all diluted in PBS supplemented with 5% goat/rabbit serum, overnight at 4°C.
After washing with PBS, sections were incubated with a second HRP-conjugated
antibody 1:200 diluted in PBS for 1h at RT. The ABC-HRP complex (ABCkit-HRP
Vector PK-6101), 1:500 diluted in PBS, was applied to the sections for 30 minutes
at RT. The substrate solution was added for 7min at RT: 0.5 ml of DAB in 9.5 ml of
PBS and 10μl of H2O2. Tissues were counterstained with haematoxylin for 30s at RT.
Slides were dehydrated with consecutive incubation in 70%, 96%, 100% of alcohol
and xylene (two times) for 5’ each step. Sections were mounted in Permount.
Statistical analysis - Differences in cytokine, lactate, VEGF production, trimetylation,
and phosphorylation were analyzed using Wilcoxon signed-rank test. All analyses
were performed in Graphpad prism 5 (CA, USA). * p < 0.05, ** p < 0.01. Data are
shown as means ± SEM. Information on additional statistical analyses can be found
in the supplementary experimental procedures.

218 |
 Reprogramming of TAMs

RESULTS
Transcriptome analysis: inflammatory and metabolic rewiring in TC-induced
human macrophages
To enable a detailed analysis of the effect of TC cells on monocyte reprogramming,
we generated genome-wide transcriptome data by RNA sequencing of TC-induced
macrophages and RPMI cultured control monocytes (24h of culture), both of which
were relieved for either 4h or 24h in RPMI after co-culture with the tumor cells (TPC1
cell line). We performed an extensive bioinformatics analysis as outlined in (Figure
1A). A total of 13,047 transcripts were identified as present throughout 4 conditions
represented by 16 samples. Employing a two-way ANOVA model (Table S1), we
identified 372 (4h) and 353 (24h) genes being differentially expressed between
TC-induced macrophages and RPMI controls (Figure S1A). Next we visualized the
degree of variance between TPC1 co-cultured monocytes and control cells at both
time points by performing hierarchical clustering (HC) based on the top 1000 variable
genes (Figure 1B). HC revealed that TPC1 co-cultured monocytes exert significant
transcriptomic changes compared to control monocytes. Moreover, there was also
a clear difference in gene expression between monocytes co-cultured with TPC1 for
4h respectively 24h, suggesting that the observed changes are dynamic. To validate
these findings, we applied co-regulation analysis (CRA) and visualized the gene
network of the top 500 variable genes within the data (Figure 1C). The topology of
the network was defined by two major clusters (C1, C2), with cluster C1 showing
a clear substructure (C1a, C1b). Overlaying differentially regulated genes onto the
network revealed that the cluster C1a represented genes increased in expression
in monocytes co-cultured with TPC1 at the 4h time point, while C1b was associated
with genes elevated at the 24h time point. Additionally, employing Self-Organizing
Map (SOM) clustering to identify and visualize conditions-specific genes within the
network (Figure S1B), we were able to validate the condition-specific sub-networks.
Together, these data support a model suggesting transcriptional programming of
monocytes by TPC1 tumor cells in a dynamic fashion. To investigate the biological 11
relevance of the observed transcriptomic changes in both 4h and 24h TC-induced
macrophages, we applied Gene Set Enrichment Analysis (GSEA) using two well-
established pathway gene sets (10). Computing enrichment for hallmark pathways
(Figure 1D), ‘PI3K/Akt/mTOR’ and ‘fatty acid metabolism’ pathways were enriched
at the 4h time point. In contrast, the TPC1 co-cultured monocytes taken at the 24h
time point showed enrichment of “interferon gamma response” and “angiogenesis”
related pathways. Using reactome pathways to compute enrichment, we detected
even more inflammation-related pathways to be enriched at the 24h time point
(e.g. inflammasome activation, TLR responses, interferon signaling, etc) (Figure
S1C, Table S2). It is known that cellular metabolism of macrophages is crucial for

| 219
Chapter 11

A Monocyte
TPC1 co-cultured monocyte

B
Control monocyte RPMI only
(RPMI cultured)
4h relieved 24h relieved
24h culture
TPC1 co-cultured TPC1 co-cultured Control Control
4 hours relieved 24 hours relieved 4 hours relieved 24 hours relieved

16 RNA-Seq
13047 present genes HC

TPC1 co-cultured monocytes (4h relieved) ANOVA

Control monocytes (4h relieved) model
TPC1 co-cultured monocytes (24h relieved) DE genes
Control monocytes (24h relieved) (FC:≥ 1,5;
unadj. p-value:≤ 0,05)

genes
SOM

CRA Union Hallmark and

Top 500 variable genes Reactome pathway genes
(co-culture vs. naive) Mapping on
CRA network

Transcriptional regulators
expressed in dataset

GSEA:
Hallmark pathways
FC over mean
Reactome pathways
Xue et al. 2014, WGCNA modules
all conditions -2.00 0 2.00
z-score transformed
GOEA:
(TC-induced MΦ (24h relieved)
absolute values
vs. mean all conditions ≥ 1)

C E
4h relieved 24h relieved
DSC2
GNB4

C1b
TFRC
GLCE

PLA2G12A

DUSP3

EPRS GPC1
CTSC
PFKP
BAD
SSR1

Cd86
EXT1

CAB39
FGL2
AGRN

VCAN
MKNK2
CANX
C1a Node color
HSP90B1
G6PD

<-1.5 -1 1 >1.5
FC (vs. mean all conditions) SLC6A6

C2

D F
Hallmark Hallmark TPC1 (24h relieved)
TPC1 vs. control (4h relieved) TPC1 vs. control (24h relieved)

0.001 0.001 Regulation of immune cell proliferation

Interferon gamma
response
MTORC1
signaling

P13K/AKT/MTOR Angiogenesis
Lipid metabolism
signaling
p-value
p-value

0.05 0.05
Fatty acid
0.1 0.1
metabolism
up-regulation

Activation of innate Intracellular transport

highest
1 1 immune response
-2 -1 0 1 2 -2 -1 0 1 2
NES NES

Figure 1 - Transcriptome analysis of TC-induced macrophages. (A) Scheme outlining the experimental
setup (upper scheme) and bioinformatics analysis (lower scheme). (B) HC map of the top 1000 variable
genes between TC-induced macrophages and RPMI controls. (C) Network visualization of gene-centered
CRA (Pearson correlation ≥ 0.7). FC over mean of all conditions is mapped onto the network for TC-

220 |
 Reprogramming of TAMs

inflammatory function, with a shift from oxidative phosphorylation towards mTOR-

dependent aerobic glycolysis playing a central role (11, 12). Therefore, we extracted
the gene sets from PI3K/Akt/mTOR- and glycolysis-related pathways (both hallmark
and reactome) and mapped them onto the CRA network (Figure 1E). Indeed 16 of
23 genes were found in cluster C1 (Figure 1E) and were elevated at the 4h (12/16)
and 24h (10/16) time points, respectively (Table S3). To determine whether potential
transcriptional regulators (TR) of mTOR-dependent aerobic glycolysis might also
be part of the network, we mapped TR information onto the CRA network (Figure
S1D). Surprisingly, 23 TRs were downregulated (cluster C2) in TPC1 co-cultured
monocytes, while only 7 TRs were upregulated. Indeed, among the upregulated
transcription factors we identified hypoxia-inducible factor-1 alpha (HIF-1A, orange
node), which was previously shown to be involved in mTOR-dependent aerobic
glycolysis (11) in cluster C1a. RelA, a NF-kB transactivating subunit that has been
shown to counteract reprogramming to aerobic glycolysis (13) was found to be
downregulated in TPC1 co-cultured monocytes. Moreover, the reactome pathway
“NF-kB is activated and signals survival” was found to be depleted in TPC1 co-
cultured monocytes at the 4h time point (Figure S1C). We next validated the findings
for the 24h time point employing Gene Ontology Enrichment Analysis (GOEA) on
genes elevated in TPC1 co-cultured monocytes (fold change (FC) over mean: ≥ 1,
present in the CRA network). Network visualization of enriched GO-Terms revealed
terms related to ‘immune cell proliferation’ and ‘activation of innate immune response’
(Figure 1F) further supporting reprogramming of monocytes at the later time points
towards immune activation. Taken together, our data analysis supported a model
of transcriptional regulation of genes involved in mTOR-dependent glycolysis early
after exposure to TC cells, while further reprogramming towards an inflammatory
response was seen at the later time point.

TC-induced macrophages are reprogrammed by the secretome of TC cells

Transcriptome analysis suggested a pro-inflammatory profile of TC-induced 11
macrophages. We aimed to validate this finding by functional assessments: human
primary monocytes were co-incubated in a trans-well system with the three types
of TC cell lines (TPC1, FTC133 and BC-PAP) for 24h, followed by restimulation for
induced macrophages (4h, left network; 24h, right network). (D) Volcano plots of normalized enrichment
scores (NES) and enrichment p-values based on GSEA using Hallmark pathway gene sets (MSigDB,
Broad Institute). Data are shown for TPC1 co-cultured macrophages (4h and 24h). Dark (NES ≥ 1; p
value ≤ 0.05) and light (NES ≥ 1; p value > 0.05, ≤ 0.1) red circles show gene sets positively enriched.
Dark and light blue circles show gene sets depleted (NES ≤ -1). (E) Hallmark and reactome pathway
genes (MSigDB, Broad institute) related to PI3K/Akt/mTOR and glycolysis mapped onto the CRA network
(orange nodes). (F) Network visualization of GOEA of genes derived from the “TPC1 co-cultured (24h) vs.
mean all conditions” comparison (FC: ≥ 1; present in CRA network) using BiNGO and EnrichmentMap.
Red nodes represent the enriched GO-terms, node size and color represents corresponding FDR-
adjusted enrichment p-values (p-value: 0.05 ≤).

| 221
Chapter 11

  
 
 
24h culture 24h restimulation  

  
  
 
   
  
  

 
Setup 1: naive





macrophages  

 

24h culture  

 








































Setup 2: tumor cells

24h coculture 24h restimulation


  
 
  
Setup 3: Tumor cell-   


 
 
induced   

  
macrophages 







 
  
Tumor cell  









 


























Monocyte/macrophage





  
 
 
 

  

 

 
  

 

 










 
 
 

  

       
       




   
 







  
 


   


   



















 









  




       


 
  
  
 

 
  









 



   
   










   

































Figure 2 – TC-induced macrophages have a pro-




 


   

inflammatory phenotype. (A) Outline of the culturing


 methods. (B) Monocytes were incubated for 24h with


TC cells in a trans-well system and restimulated with
LPS for 24h. (n=7). (C) TAMs derived from coculture




with TPC1 and two glioblastoma cell lines were

 restimulated with LPS for 24h. (n=4). (D) Medium from
three thyroid cell lines was added to human monocytes
 
for 24h and subsequently stimulated with RPMI or










LPS for 24h. (n=4). (E,F) Lactate and VEGF were










determined in naive macrophage and tumor medium. (n=6). (G) A lactate receptor antagonist was added
to the culture system. (Mean ± SEM, n=5, * p < 0.05, by Wilcoxon signed-rank test). (H) Monocytes were
incubated with 1µM of lactic acid for 24h and restimulated with LPS for 24h. (n=8). (* p < 0.05, ** p < 0.01
by Wilcoxon signed-rank test).

222 |
 Reprogramming of TAMs

24h with either culture medium (RPMI), or Toll-like receptor (TLR) ligands (TLR4
ligand lipopolysaccharide (LPS), TLR2 ligand (Pam3CKS4 (P3C), or IL-1α) (Figure
2A). The production of TNFα and IL-6 by TC-induced macrophages was significantly
increased compared to the control naive macrophages (Figure 2B, S2A). Production
of IL-10 and IL-1β was low and in most conditions below detection limit. Additional
experiments using TPC1-induced macrophages showed also increased IL-8
production, whereas no differences in granulocyte macrophage colony-stimulating
factor (GM-CSF), monocyte chemotactic protein 1 (MCP1) were found (Figure
S2B). Co-culture of human monocytes with two glioblastoma cell lines showed less
strongly upregulated cytokine production upon restimulation, suggesting a degree of
specificity for the effect of the TC cell lines (Figure 2C).
The identification of the pro-inflammatory profile induced by TC cells in monocytes
lead to the hypothesis that soluble factors released by TC cells impact on the
differentiation of these monocytes into macrophages with a specific phenotype. To
reveal whether a soluble factor in the medium produced by the cancer cells was
responsible for the upregulated cytokine production, medium from TC cell line cultures
was added to human monocytes for 24h, after which cells were restimulated with
LPS. In line with previous experiments, this increased production of cytokines from
macrophages as well (Figure 2D). Two factors known to be released by tumor cells
and which have immunologic effects are vascular epithelial growth factor (VEGF)
and lactate, the end-metabolite of glycolysis. Indeed, both VEGF (Figure 2E) and
lactate (Figure 2F) concentrations were significantly increased in TC conditioned
media. In order to determine whether lactate or VEGF could serve as soluble factors
that are necessary for the specific reprogramming of the TC-induced macrophages,
antagonists of the cellular receptors for these molecules were added to the culture
system. Blockade of lactate receptor significantly reduced cytokine release by TC-
induced macrophages, while blockade of the VEGF receptor had no effects on
cytokine release (Figure 2G, S3). These data suggest that TC cell-derived lactate
contributed to the induction of the inflammatory profile of TC-induced macrophages. 11
In line with this, preincubation for 24h with 1µM of lactate also increased cytokine
production upon TLR stimulation (Figure 2H).

TC-induced macrophages display increased glucose metabolism that is ne-

cessary for increased cytokine production
Transcriptome analysis of TC-induced macrophages also revealed that several
metabolic pathways were upregulated at transcriptional level. We, and others have
shown that cellular metabolism of macrophages is crucial for their inflammatory
function, with a shift from oxidative phosphorylation towards mTOR-dependent
aerobic glycolysis (Warburg effect) playing a central role (11, 12). To investigate the

| 223
Chapter 11

activation of glycolysis and oxidative phosphorylation in TC-induced macrophages,

extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) of TC-
induced macrophages (before restimulation by TLR engagement) were measured
by Seahorse technology. Interestingly, maximal ECAR was increased in TC-induced
macrophages and OCR was increased at both basal and maximal level (Figure 3A).
The intracellular concentration of acetyl CoA was increased, which could be used
both to fuel the TCA cycle and for fatty acid synthesis. The glutamate concentration
was decreased, likely caused by the replenishment of the TCA cycle through
glutamine metabolism (Figure S4). These data demonstrate strong activation of
metabolic activity in the TC-induced macrophages.
To assess which of the metabolic pathways is essential in the upregulation of
cytokine production, specific metabolic pathways were inhibited and cytokine
production was assessed. Inhibition of the pentose phosphate pathway
(6-aminonicotinamide, 6-AN), glutamine metabolism (BPTES), β-oxidation of fatty
acids (etomoxir), or the electron transport chain complex V (oligomycin) did not
influence cytokine production. However, exposure to mTOR inhibitor rapamycin
significantly decreased IL-6 production by TC-induced macrophages, demonstrating
a role for mTOR/glycolysis pathway in this process (Figure 3B, S5). This was further
supported by assessing phosphorylation of mTOR and its downstream products
(S6K and 4EBP1) in TC-induced macrophages before restimulation. Indeed, we
observed enhanced activation of this pathway in TC-induced macrophages (Figure
3C).
In order to validate activation of glycolysis in TC-derived TAMs in patients with
TC, formalin-fixed paraffin-embedded (FFPE) tissue sections of six thyroid tumors
were immunohistochemically prepared and TAMs were stained by CD68 staining.
To investigate the extent of glycolysis in these TAMs, expression of the third human
isoform of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase and pyruvate
kinase 2 (PFKFB3, PKM2), and the lactate receptor GRP81 were determined. Both
these key enzymes of glycolysis and the expression of the lactate receptor were
highly upregulated in at least 80% of CD68-positive TC-associated macrophages
present in these tissues. (Figure 3D, S6A). In contrast, virtually no macrophages
could be detected in normal thyroid tissues from the same individuals (Figure S6B).

TC-induced macrophages undergo epigenetic reprogramming regulated by

the mTOR pathway
In the following set of experiments, we wanted to assess whether TC cell-macrophage
co-incubation induced a stable inflammatory phenotype over time. To assess this,
after the initial preincubation with TPC1 cells, the TC-induced macrophages were
left in culture medium for an additional 24h before restimulation (Figure 4A). The

224 |
 Reprogramming of TAMs

  
  
  

   

 
 
  







 
           
   

 
 

 

 

 

 
 
   

      
    
  


 









 

 


 

   


































  
 
  
   

  







 

  


  

 












CD68 (200x) GPR81 (200x)

11

PFKFB3(200x) PKM2 (200x)

Figure 3 – Metabolism of TC-induced macrophages is changed. (A) Extracellular acidification rate

(ECAR) and oxygen consumption rate (OCR) from TC-induced macrophages and naive macrophages
were determined after TC-induced macrophages were relieved for 24h from the TPC1 cells. (n=4) (B)
Inhibitors of mTOR (rapamycin), pentose phosphate pathway (6-AN), glutamine metabolism (BPTES),
fatty acid β oxidation (etomoxir) and complex V ATP synthase (oligomycin) were added to the culture
system and cells were restimulated for 24h with LPS. (n=4). (C) Monocytes were incubated for 24h with
TPC1 cells, after 24h rest cells were lysed and p-mTOR, p-S6K, and p-4EBP1 induction were determined.
(D) Immunohistochemical analysis of PFKFB3, PKM2 and GPR81 in CD68-positive TAMs. Results are
representative of stained FFPE tissue material from six anaplastic TC patients. (* p < 0.05, by Wilcoxon
signed-rank test).

| 225
Chapter 11

restimulation with LPS showed that the cytokine production was still upregulated
in the TC-induced macrophages even if they were relieved from the TPC1 cells,
demonstrating a long-term stable phenotype (Figure 4B). This suggests a putative
epigenetic rewiring of the transcriptional program, as shown in other types of long-
term functional reprogramming of macrophages for example during trained immunity
(11). In order to test this hypothesis, a broad histone methylation inhibitor (MTA)
was added during the first 24h of co-culture. This brought cytokine production back
to baseline (Figure 4C), showing that histone methylation plays an important role in
the specific reprogramming of TC-induced macrophages. H3K4me3 is an important
histone marker of open (accessible) promoters shown to be associated with high
cytokine production (14). To assess whether increased H3K4me3 plays a role in
the long-term inflammatory phenotype of TC-associated macrophages, monocytes
were preincubated for 24h with TPC1 cells, after which the tumor cells were removed
and the macrophages were incubated for an additional 24h in culture medium.
Chromatin immunoprecipitation was performed to determine the H3K4me3 status
of the promoters of IL6 and TNFA in TC-induced macrophages. Indeed, a significant
increase of H3K4me3 was observed in the TC-induced macrophages.
Additionally, when rapamycin was added to the culture medium, the increase
of H3K4me3 was abolished, which corresponded to the observed decrease of IL-6
after mTOR inhibition with rapamycin (Figure 4D). This suggested that the induction
of the mTOR-dependent pathway plays an important role for long-term epigenetic
reprogramming of TC-induced macrophages. H3K9me3 is a histone mark that
induces heterochromatin and therefore decreases DNA accessibility (14), which was
also found to be important in trained immunity (15). A potential role of H3K9me3 was
assessed, but no significant downregulation of H3K9me3 was found after co-culture
with TPC1 tumor cells (Figure 4E).

DISCUSSION
The process through which monocytes infiltrate tumors, differentiate into TAMs, and
influence the immune responses towards the malignant cells is believed to play
a crucial role in carcinogenesis. TC is the most common endocrine malignancy,
and TAMs have been shown to be strongly present in the tumor and impact the
prognosis (6, 7). However, despite this, very little is known about the phenotype of
TAMs in TC and the pathways that influence macrophage differentiation in TC. In the
present study we initiated transcriptome analysis of TC-induced macrophages, and
we demonstrate that soluble factors released by TC (among which lactate) induce
a strong inflammatory phenotype and a rewiring of the cellular metabolism of TC-
induced macrophages. Activation of mTOR-dependent glycolysis induced long-term
epigenetic histone modifications (especially H3K4me3) and upregulated cytokine

226 |
 Reprogramming of TAMs

 24h coculture 24h rest 24h restimulation

Setup 4: Tumor cell-

induced
macrophages with 24h
rest
  
   
 

 

 
  
 







 
  
 

 




 


 



 










































 
 

 


 


 
 




 

 

 














 
  

     

 
 
 

 

 

   

   

11
   
 

 

 


 






 
   
   
Figure 4 – The pro-inflammatory phenotype is epigenetically regulated. (A) Outline of the culturing
methods. (B) Monocytes were coincubated with thyroid tumor cell lines for 24h. After 1 day additional rest
they were restimulated with LPS for 24h. (n=5). (C) MTA, an inhibitor of histone methylation was added to
the culture system and cells were restimulated for 24h with LPS. (n=6). (D,E) Monocytes were incubated
for 24h with TPC1 cells, after 24h rest DNA was isolated to determine H3K4me3 (D) and H3K9me3 (E)
expression at the promoter site of IL6 and TNFA. (n=6, n=5). (* p < 0.05 by Wilcoxon signed-rank test).

| 227
Chapter 11

production. The role of the lactate-glycolysis-inflammation circuit for TC was also

further supported in patients through immunohistological and genetic approaches.
The assessment of the transcriptome of the TC-induced macrophages identified
complex circuits of immunological and metabolic pathways. One of the strongest
sets of cellular functions highly upregulated in the TC-induced macrophages were
those related to inflammation. Pathways related to pattern-recognition receptors,
chemokine synthesis and cytokine-cytokine receptor interaction were upregulated,
suggesting a strong inflammatory phenotype of the cells. This was validated by
experiments demonstrating that macrophages differentiated in the presence of
TC cell lines displayed much stronger inflammatory function upon stimulation. An
inflammatory phenotype has been demonstrated to characterize TAMs in many
tumors (16), and inflammation stimulates carcinogenesis through multiple pathways:
excretion of epidermal growth factor, pro-angiogenic signals such as VEGF and
fibroblast growth factor 2, several pro-inflammatory cytokines and chemokines, and
factors such as matrix-degrading enzymes, metalloproteinases, cysteine cathepsin
proteases and heparanases all contribute to a tumor-promoting environment (17,
18). These data strongly suggest that TAM-derived inflammation has an important
impact on TC development. Indeed, it has been previously shown that the presence
of inflammatory mediators in TC, including cytokines such as IL-1β and TNFα,
negatively influence the expression of sodium iodine symporter, the major protein
responsible for the uptake of radioactive iodide in thyroid cells which represents the
main targeted therapy for patients with TC (19). Also processes that limit inflammation
such as autophagy are defective in TC (20, 21). In addition to TAMs, also the function
of regulatory T-cells has been shown to be dependent on glycolysis, as the induction
of their suppressive function was tightly dependent on mTOR-induced glycolysis
(22). This is especially interesting as more aggressive forms of TC are associated
with increased numbers of regulatory T-cells in peripheral blood (23) and TAMs
are able to induce regulatory T-cells (24, 25). The interaction and balance between
the pro-inflammatory macrophages and inhibitory regulatory T-cells, whose activity
is both dependent on glycolysis, might therefore be an interesting topic for future
research.
In addition to the inflammatory pathways induced by TC in TAMs, a second
important set of biological processes strongly modulated were the metabolic
pathways, with strong upregulation of the mTOR signaling pathway, carbohydrate
digestion, but also fatty acid and pyrimidine biosynthesis. Changes in cellular
metabolism, and especially a shift towards aerobic glycolysis through mTOR-
dependent mechanisms, have been recently demonstrated to be crucial for the
activation of macrophages (11, 12). Moreover, inflammatory (M(IFNγ), formely M1)
macrophage metabolism is associated with an increased glucose consumption

228 |
 Reprogramming of TAMs

Lactate
Other tumor-derived
factors

Lactate TNFα IL-6

Tumor cell survival and prolifera2on
Figure 5 – Soluble tumor-derived signals change the phenotype of the tumor-associated
macrophage, by induction of the mTOR pathway and glycolysis, and epigenetic changes.

and lactate production, whereas the more anti-inflammatory (M(IL4), formally M2) 11
macrophages depend preferentially on oxidative phosphorylation. On the other
hand, M(IL-4) macrophages typically express more arginase, which is necessary
in amino acid metabolism (26, 27) and M(IL-4) macrophages also show more fatty
acid uptake and β-oxidation compared to M(IFNγ) macrophages (28). Interestingly,
the transcriptome and functional phenotype of TC-induced macrophages did not
display a clear M(IFNγ) or M(IL-4) phenotype, with both pathway characteristics of
M(IFNγ) (inflammation, glycolysis) and M(IL-4) (oxidative phosphorylation) being
upregulated.
Interestingly, when we compared our results to the transcriptome of a panel of
29 different macrophage profiles as reported by Xue et al. (29), the transcriptional

| 229
Chapter 11

program of 4h TC-induced macrophages was defined by gene modules associated

with macrophage stimulation by fatty acids (linoleic, oleic, lauric acid), LPS or a
combination of TNFα, prostaglandin E2 and Pam2Cys (TPP). The transcriptional
program of 24h TC-induced macrophages was mainly described by IL-4 defined gene
modules in combination with an inflammatory gene module linked to stimulation with
palmitic acid (PA) (Figure S1E). Therefore, this mixed gene signature in TC-induced
macrophages cannot be considered as an archetypical M2 macrophage. We thus
propose that the functional program induced by TC in TAMs is distinct and combines
elements from both M(IL-4) macrophages, and inflammatory characteristics. In
addition to IL-4, another important anti-inflammatory cytokine is IL-37, which could
be especially relevant due to its capacity to inhibit the Akt/mTOR pathway (30, 31).
While no IL-37 expression could be found in the TC-induced macrophages, future
studies should investigate it in in-vivo samples from TC patients.
One of the most relevant findings of metabolic pathways activated in TC-
induced macrophages is mTOR-dependent glycolysis. Indeed, we demonstrate an
essential role for the Akt/mTOR pathway for the inflammatory phenotype of the TC-
induced macrophages and this could represent an important therapeutic target. In
TAMs induced by other tumors it has been shown that lactic acid produced by the
cancer cells is essential for TAM reprogramming, by induction of the transcription
factor HIF-1α (3), and a similar dependency on lactate release was observed for
the cytokines released in our system. As HIF-1α activation is highly dependent on
mTOR activation, our observation that HIF-1α is one of the main TFs in TC-induced
macrophages fits with this picture. Interestingly, inhibiting mTOR with rapamycin
abolished IL-6 upregulation induced by TC cells, while TNFα production was not
affected. In addition, mTOR inhibition was accompanied by downregulation of the
histone marks associated with open chromatin and increased transcription.
This role of the mTOR pathway provides a link between cellular metabolism and
epigenetic programming of gene transcription. The field of metabolo-epigenomics
is an emerging field within immunology (32), with important roles demonstrated
for various metabolites (especially of glycolysis and TCA cycle) in modulating
epigenetic processes. For examples, acetyl-CoA influences histone acetylation by
functioning as a substrate for histone acetylation, succinate and fumarate inhibit
histone demethylases, and NAD+ induces histone deacetylation through activation
of sirtuins (32-34). Recently, the rate of glycolysis was directly associated with the
acetylation of specific histone sites, which appeared to be mostly dependent on
acetyl-CoA levels (35). We show an upregulation of glycolysis, and an increased
intracellular concentration of acetyl Co-A in TC-induced macrophages. Moreover,
glycolysis has been shown to be a source (together with folic acid and methionine)
for S-adenosylmethionine (SAM), which serves as a methyl donor for histone and

230 |
 Reprogramming of TAMs

DNA methylation (33). This is especially interesting because of increased TCA cycle
metabolism and oxidative phosphorylation in TC-induced macrophages. All in all,
these data strongly suggest that the metabolic rewiring induced in macrophages
by TC-derived compounds (such as lactate) induces epigenetic reprogramming
(as demonstrated by enhanced H3K4me3), which in turn results in increased gene
transcription of inflammatory mediators (see scheme Figure 5). We hypothesize that
this enhanced inflammation will in turn influence tumor progression and outcome.
In addition to glycolysis, other metabolic pathways were also modulated in TC-induced
macrophages. Interestingly, inhibition of glutamine metabolism that can contribute to
replenishment of the TCA cycle did not reduce cytokine production in TAMs, but
showed a tendency toward increased cytokine production. This is an interesting
observation, which has not been further investigated, but should be addressed in
future research. In addition, fatty acid synthesis was very strongly increased in TC-
induced macrophages: although an effect on inflammation and cytokine production
was not observed, this may very well impact other aspects of tumor and macrophage
biology such as cell survival and proliferation.
Our observation that reprogramming of tumor stroma cells (in our case TAMs) is
associated with changes in metabolism is reminiscent of a process termed “reverse
Warburg effect” (36, 37). In this process it has been suggested that cancer cells
reprogram metabolism of tumor stroma cells toward aerobic glycolysis (Warburg
effect), and this will result in fuel for mitochondrial metabolism (e.g. lactate and
ketones), which is beneficial for tumor growth and survival. Using oxidative
phosphorylation instead of glycolysis reduces the speed of cell aging and is therefore
beneficial for tumor cell survival, growth and metastasis (37). Whether these changes
are a result of local reprogramming of myeloid cells in the tumor microenvironment
or whether soluble factors excreted by the tumor (stroma) already reprogram
circulating monocytes, or even the myeloid precursors in the bone marrow, remains
unanswered and should be investigated in future studies.
In conclusion, we show that TC-induced macrophages display broad changes in 11
cellular metabolism and have an increased inflammatory profile. Reprogramming of
the TC-induced macrophages is dependent on activation of the Akt/mTOR pathway,
which is also essential for reshaping the epigenetic landscape.

Digital versions of Tables S1-3 can be obtained by sending a request to the author.

REFERENCES
1. Mantovani A, Allavena P, Sica A, Balkwill F. Cancer- 2. Noy R, Pollard JW. Tumor-associated macrophages:
related inflammation. Nature. 2008;454(7203):436- from mechanisms to therapy. Immunity.
44. 2014;41(1):49-61.

| 231
Chapter 11
3. Colegio OR, Chu NQ, Szabo AL, Chu T, Rhebergen
AM, Jairam V, et al. Functional polarization of tumour-
associated macrophages by tumour-derived lactic
acid. Nature. 2014;513(7519):559-63.
4. Sica A, Mantovani A. Macrophage plasticity and
polarization: in vivo veritas. The Journal of clinical
investigation. 2012;122(3):787-95.
5. Davies L, Welch HG. Current thyroid cancer trends
in the United States. JAMA otolaryngology-- head &
neck surgery. 2014;140(4):317-22.
6. Ryder M, Ghossein RA, Ricarte-Filho JC, Knauf JA,
Fagin JA. Increased density of tumor-associated
macrophages is associated with decreased survival
in advanced thyroid cancer. Endocrine-related
cancer. 2008;15(4):1069-74.
7. Caillou B, Talbot M, Weyemi U, Pioche-Durieu C,
Al Ghuzlan A, Bidart JM, et al. Tumor-associated
macrophages (TAMs) form an interconnected cellular
supportive network in anaplastic thyroid carcinoma.
PloS one. 2011;6(7):e22567.
8. Ryder M, Gild M, Hohl TM, Pamer E, Knauf J,
Ghossein R, et al. Genetic and pharmacological
targeting of CSF-1/CSF-1R inhibits tumor-associated
macrophages and impairs BRAF-induced thyroid
cancer progression. PloS one. 2013;8(1):e54302.
9. Schweppe RE, Klopper JP, Korch C, Pugazhenthi
U, Benezra M, Knauf JA, et al. Deoxyribonucleic
acid profiling analysis of 40 human thyroid cancer
cell lines reveals cross-contamination resulting
in cell line redundancy and misidentification. The
Journal of clinical endocrinology and metabolism.
2008;93(11):4331-41.
10. Liberzon A. A description of the Molecular Signatures
Database (MSigDB) Web site. Methods in molecular
biology. 2014;1150:153-60.
11. Cheng SC, Quintin J, Cramer RA, Shepardson KM,
Saeed S, Kumar V, et al. mTOR- and HIF-1alpha-
mediated aerobic glycolysis as metabolic basis for
trained immunity. Science. 2014;345(6204):1250684.
12. Tannahill GM, Curtis AM, Adamik J, Palsson-
McDermott EM, McGettrick AF, Goel G, et
al. Succinate is an inflammatory signal that
induces IL-1beta through HIF-1alpha. Nature.
2013;496(7444):238-42.
13. Mauro C, Leow SC, Anso E, Rocha S, Thotakura
AK, Tornatore L, et al. NF-kappaB controls
energy homeostasis and metabolic adaptation by
upregulating mitochondrial respiration. Nature cell
biology. 2011;13(10):1272-9.
14. Kimura H. Histone modifications for human
epigenome analysis. Journal of human genetics.
2013;58(7):439-45.
15. Arts RJ, Blok BA, van Crevel R, Joosten LA, Aaby P,
Benn CS, et al. Vitamin A induces inhibitory histone
methylation modifications and down-regulates
trained immunity in human monocytes. Journal of
leukocyte biology. 2015;98(1):129-36.
16. Biswas SK, Allavena P, Mantovani A. Tumor-
associated macrophages: functional diversity, clinical
significance, and open questions. Seminars in
immunopathology. 2013;35(5):585-600.
17. Qian BZ, Pollard JW. Macrophage diversity
enhances tumor progression and metastasis. Cell.
2010;141(1):39-51.
18. Murdoch C, Muthana M, Coffelt SB, Lewis CE. The
role of myeloid cells in the promotion of tumour
angiogenesis. Nature reviews Cancer. 2008;8(8):618-
31.
19. Ajjan RA, Watson PF, Findlay C, Metcalfe RA, Crisp M,
Ludgate M, et al. The sodium iodide symporter gene
and its regulation by cytokines found in autoimmunity.
The Journal of endocrinology. 1998;158(3):351-8.
20. Huijbers A, Plantinga TS, Joosten LA, Aben KK,
Gudmundsson J, den Heijer M, et al. The effect of the
ATG16L1 Thr300Ala polymorphism on susceptibility
and outcome of patients with epithelial cell-derived
thyroid carcinoma. Endocrine-related cancer.
2012;19(3):L15-8.
21. Plantinga TS, Costantini I, Heinhuis B, Huijbers
A, Semango G, Kusters B, et al. A promoter
polymorphism in human interleukin-32 modulates
its expression and influences the risk and the
outcome of epithelial cell-derived thyroid carcinoma.
Carcinogenesis. 2013;34(7):1529-35.
22. De Rosa V, Galgani M, Porcellini A, Colamatteo
A, Santopaolo M, Zuchegna C, et al. Glycolysis
controls the induction of human regulatory T cells by
modulating the expression of FOXP3 exon 2 splicing
variants. Nature immunology. 2015;16(11):1174-84.
23. Liu Y, Yun X, Gao M, Yu Y, Li X. Analysis of regulatory
T cells frequency in peripheral blood and tumor
tissues in papillary thyroid carcinoma with and without
232 |
Hashimoto’s thyroiditis. Clinical & translational
oncology : official publication of the Federation of
Spanish Oncology Societies and of the National
Cancer Institute of Mexico. 2015;17(4):274-80.
24. Bettelli E, Carrier Y, Gao W, Korn T, Strom TB,
Oukka M, et al. Reciprocal developmental pathways
for the generation of pathogenic effector TH17 and
regulatory T cells. Nature. 2006;441(7090):235-8.
25. Savage ND, de Boer T, Walburg KV, Joosten
SA, van Meijgaarden K, Geluk A, et al. Human
anti-inflammatory macrophages induce Foxp3+
GITR+ CD25+ regulatory T cells, which suppress
via membrane-bound TGFbeta-1. Journal of
immunology. 2008;181(3):2220-6.
26. Hu X, Liu G, Hou Y, Shi J, Zhu L, Jin D, et al.
Induction of M2-like macrophages in recipient NOD-
scid mice by allogeneic donor CD4(+)CD25(+)
regulatory T cells. Cellular & molecular immunology.
2012;9(6):464-72.
27. Van Dyken SJ, Locksley RM. Interleukin-4- and
interleukin-13-mediated alternatively activated
macrophages: roles in homeostasis and disease.
Annual review of immunology. 2013;31:317-43.
28. Odegaard JI, Chawla A. Alternative macrophage
activation and metabolism. Annual review of
pathology. 2011;6:275-97.
29. Xue J, Schmidt SV, Sander J, Draffehn A, Krebs
W, Quester I, et al. Transcriptome-based network
analysis reveals a spectrum model of human
macrophage activation. Immunity. 2014;40(2):274-
88.
30. Nold-Petry CA, Lo CY, Rudloff I, Elgass KD, Li
S, Gantier MP, et al. IL-37 requires the receptors
IL-18Ralpha and IL-1R8 (SIGIRR) to carry out
its multifaceted anti-inflammatory program upon
innate signal transduction. Nature immunology.
2015;16(4):354-65.
31. Dinarello CA, Nold-Petry C, Nold M, Fujita M, Li S,
Kim S, et al. Suppression of innate inflammation
and immunity by interleukin-37. European journal of
immunology. 2016;46(5):1067-81.
32. Kaelin WG, Jr., McKnight SL. Influence of metabolism
on epigenetics and disease. Cell. 2013;153(1):56-69.
33. Johnson C, Warmoes MO, Shen X, Locasale JW.
Epigenetics and cancer metabolism. Cancer letters.
2015;356(2 Pt A):309-14.
34. Lu C, Ward PS, Kapoor GS, Rohle D, Turcan
S, Abdel-Wahab O, et al. IDH mutation impairs
histone demethylation and results in a block to cell
differentiation. Nature. 2012;483(7390):474-8.
35. Cluntun AA, Huang H, Dai L, Liu X, Zhao Y,
Locasale JW. The rate of glycolysis quantitatively
mediates specific histone acetylation sites. Cancer &
metabolism. 2015;3:10.
36. Pavlides S, Whitaker-Menezes D, Castello-Cros R,
Flomenberg N, Witkiewicz AK, Frank PG, et al. The
reverse Warburg effect: aerobic glycolysis in cancer
associated fibroblasts and the tumor stroma. Cell
cycle. 2009;8(23):3984-4001.
37. Ertel A, Tsirigos A, Whitaker-Menezes D, Birbe RC,
Pavlides S, Martinez-Outschoorn UE, et al. Is cancer
a metabolic rebellion against host aging? In the quest
for immortality, tumor cells try to save themselves
by boosting mitochondrial metabolism. Cell cycle.
2012;11(2):253-63.
 Reprogramming of TAMs

Supplementary experimental procedures

Preprocessing of sequenced data

All reads were aligned against the human hg19 reference genome by TopHat2
v2.0.11 (1) using default parameters. The data was imported into Partek Genomics
Suite v6.6 (PGS) to deduct gene and transcript information before performing
normalization using statistical software R (v3.0.2) and the DESeq2 package (http://
dx.doi.org/10.1101/002832). Normalized read counts were floored to a value of at
least 1 after correcting for donor introduced variance. Subsequent to flooring, the
dataset was trimmed by defining a gene as expressed if the maximum value over all
group means was higher than 10.

Identification of differentially expressed genes

To calculate the top variable genes (TPC1 vs. RPMI) and differentially expressed
(DE) genes within the dataset between TC-induced macrophages and RPMI controls
(4h and 24h) a two-way Analysis Of Variance (ANOVA) was performed using PGS.
Genes were defined to be DE when having a fold change (FC) of ≥ 1.5 and an
unadjusted p-value of ≤ 0.05. Based on the ANOVA model, Hierarchical clustering
(HC) was performed on the top 1000 variable genes within the dataset (TPC1 vs.
RPMI) using default settings in PGS to observe the transcriptome similarity between
the samples on a more detailed level.

Gene set enrichment analysis

Gene Set Enrichment Analysis (GSEA) was performed by PGS using 10,000
permutations utilizing the hallmark and reactome pathway gene-sets (http://software.
broadinstitute.org/gsea/msigdb/index.jsp) to find enriched pathways in TPC1 co-
cultured macrophages (4h and 24h, compared to RPMI controls). To identify to which
polarization state the TC-induced macrophages relate the most, GSEA was also
performed utilizing 49 gene sets reflecting a continuum of macrophages activation- 11
states (2). All GSEA results were visualized by volcano plots.

Generation of a co-regulation network based on the DE genes among condi-

tions
In order to identify similarities between gene expression throughout all conditions
(n=16), we employed co-regulation analysis (CRA) based on Pearson correlation
coefficients (≥ 0.70) by using BioLayout Express3D (3) on the top 500 variable genes
within the dataset (TPC1 vs. RPMI). For visualization purposes, the obtained network
was imported in Cytoscape (http://www.cytoscape.org/). To identify subnetworks
specific for the conditions within the dataset, the FC over mean of all conditions

| 233
Chapter 11

was computed for each condition and subsequently mapped onto the CRA network.
As validation to this approach, using the mean expression values, Self-Organizing
Map (SOM) clustering (map height: 10 by 10) was performed in PGS to identify
condition specificity of genes. To validate GSEA results, all PI3K/Akt/mTOR- and
glycolysis-related gene lists were extracted from hallmark and reactome pathway
gene sets (http://software.broadinstitute.org/gsea/msigdb/index.jsp). These genes
were subsequently mapped onto the CRA network to identify condition specificity for
these pathways. Transcriptional regulators within the dataset were identified using a
TF list (4) and subsequently mapped onto the CRA network.

Gene ontology enrichment analysis and GO network visualization

To link condition-specific genes to prior knowledge, we applied Gene Ontology
Enrichment Analysis (GOEA) on a gene set specific (FC condition vs. mean all
conditions: ≥ 1; present in CRA network) for the TPC1 co-cultured macrophages (24h).
Subsequently, to visualize the data we employed the BiNGO (5), EnrichmentMap
(6), and Word Clouding (7) plug-ins in Cytoscape.

Forward Reverse

MYO (positive control

AGCATGGTGCCACTGTGCT GGCTTAATCTCTGCCTCATGAT
H3K4me3)

H2B (negative control

TGTACTTGGTGACGGCCTTA CATTACAACAAGCGCTCGAC
H3K4me3)

TNFA GTGCTTGTTCCTCAGCCTCT ATCACTCCAAAGTGCAGCAG

IL6 AGGGAGAGCCAGAACACAGA GAGTTTCCTCTGACTCCATCG

ZFN274_3UTR
(positive control AAGCACTTTGACAACCGTGA GGAGGAATTTTGTGGAGCAA
H3K9me3)

GAPDH (negative
CACCGTCAAGGCTGAGAACG ATACCCAAGGGAGCCACACC
control H3K9me3)

Table S1 - Primer sequences for ChIP experiments

Supplementary References
1. Kim D, Pertea G, Trapnell C, Pimentel H, Kelley
R, Salzberg SL. TopHat2: accurate alignment of 5.
transcriptomes in the presence of insertions, deletions
and gene fusions. Genome biology. 2013;14:R36.
2. Xue J, Schmidt SV, Sander J, Draffehn A, Krebs
W, Quester I, De Nardo D, Gohel TD, Emde M, 6.
Schmidleithner L, et al. Transcriptome-based
network analysis reveals a spectrum model of human
macrophage activation. Immunity. 2014;40:274-88.
3. Theocharidis A, van Dongen S, Enright AJ, Freeman 7.
TC. Network visualization and analysis of gene
expression data using BioLayout Express(3D).
Nature protocols. 2009;4:1535-50.
4. Fulton DL, Sundararajan S, Badis G, Hughes TR,
Wasserman WW, Roach JC, Sladek R. TFCat: the
curated catalog of mouse and human transcription
factors. Genome biology. 2009;10:R29.
Maere S, Heymans K, Kuiper M. BiNGO: a Cytoscape
plugin to assess overrepresentation of gene ontology
categories in biological networks. Bioinformatics.
2005;21:3448-9.
Merico D, Isserlin R, Stueker O, Emili A, Bader GD.
Enrichment map: a network-based method for gene-
set enrichment visualization and interpretation. PloS
one. 2010;5:e13984.
Oesper L, Merico D, Isserlin R, Bader GD.
WordCloud: a Cytoscape plugin to create a visual
semantic summary of networks. Source code for
biology and medicine. 2011;6:7.

234 |
 Reprogramming of TAMs

$ %
&E

&RQWUROPRQRF\WHV  &RQWUROPRQRF\WHV

KRXUVUHOLHYHG
  KRXUVUHOLHYHG

 
   


73&FRFXOWXUHG   73&FRFXOWXUHG
KRXUVUHOLHYHG
 KRXUVUHOLHYHG

&D
73& KUHOLHYHG
530, KUHOLHYHG
73& KUHOLHYHG

& 530, KUHOLHYHG

& '
5HDFWRPH 5HDFWRPH (65
73&YVFRQWURO KUHOLHYHG 73&YVFRQWURO KUHOLHYHG

 
1)N%LVDFWLYDWHG &'.
DQGVLJQDOVVXUYLYDO

15,3
1/53LQIODPPDVRPH
,QIODPPDVRPHV
7ROOUHFHSWRUFDVFDGHV
,QQDWHLPPXQHV\VWHP +,)$
SYDOXH
SYDOXH

,QWHUIHURQJDPPDVLJQDOLQJ
0+&,,DQWLJHQSUHVHQWDWLRQ
 

  6S

5(/$

5%3-
5E

 
         
1(6 1(6

;XHHWDOVWLPXOLVSHFLILFPRGXOHV ;XHHWDOVWLPXOLVSHFLILFPRGXOHV
73&YVFRQWURO KUHOLHYHG 73&YVFRQWURO KUHOLHYHG

,/
/L$
  3$
2$
,/
,/
/$
,/
V/36
 733 
SYDOXH

SYDOXH

 


    

    
11
1(6 1(6

Figure S1. Transcriptome analysis of TC-induced macrophages. (A) Scheme outlining DE gene
numbers derived from various comparisons. Arrow indicates direction of differential expression
(upregulated, red; downregulated, blue; FC ≥ 1.5, unadjusted p-value ≤ 0.05). (B) For each gene within
the dataset, condition specificity is computed applying SOM clustering and subsequently mapped onto
the CRA network. (C) Volcano plots of normalized enrichment scores (NES) and enrichment p-values
based on GSEA using reactome pathway gene sets (MSigDB, Broad Institute). Data are shown for TPC1
co-cultured macrophages (4h and 24h). Dark (NES ≥ 1; p value ≤ 0.05) and light (NES ≥ 1; p value >
0.05, ≤ 0.1) red circles show gene sets positively enriched. Dark and light blue circles show gene sets
depleted (NES ≤ -1). (D) Transcriptional regulators are mapped onto the CRA network (yellow and orange
node(s)). (E) Volcano plots of normalized enrichment scores (NES) and enrichment p-values based on
GSEA using stimuli-specific gene sets (2). Data are shown for TPC1 co-cultured macrophages (4h and
24h). Red circles (NES ≥ 1; p value ≤ 0.05) show gene sets positively enriched. Blue circles show gene
sets depleted (NES ≤ -1).

| 235
Chapter 11

Figure S2. TC-induced macrophages have a pro-inflammatory phenotype. (A) Monocytes were
incubated for 24h with thyroid cancer cell lines in a trans-well system and restimuled with RPMI, P3C
or IL-1α for 24h. (B) In the LPS restimulated TC-induced macrophages, also IL-8, MCP-1 and GM-CSF
concentrations were measured in the culture medium.

236 |
 Reprogramming of TAMs

Figure S3. A VEGF antagonist does not reduce the pro-inflammatory

phenotype. A VEGF receptor antagonist was added to the culture system
during coculture with TPC1 tumor cells. After 24h coculture, macropaghes
were restimulated with LPS and TNFα and IL-6 production was determined
in the supernatants.

Figure S4. Intracellular Acetyl CoA and glutamate. Monocytes were

incubated for 24h with TPC1 thyroid cancer cells in a trans-well system. After
being relieved from the TPC1 cells for 24h, macrophages were lysed and
intracellular concentrations of Acetyl CoA and glutamate were determined.

11

Figure S5. Inhibition of metabolic

pathways, TNFα results. Monocytes were
incubated for 24h with TPC1 thyroid cancer
cells in a trans-well system with or without
inhibitors of mTOR (rapamycin), the pentose
phosphate pathway (6-AN), glutamine
metabolism (BPTES), β-oxidation of fatty
acids (etomoxir), or the electron transport
chain complex V (oligomycin). After being
relieved from the TPC1 cells and inhibitors for
24h, were restimulated with LPS and TNFα
production was determined.

| 237
Chapter 11

A CD68 (400x) PFKFB3 (400x)

Figure S6. Metabolism of
TC-induced macrophages is
changed.
(A) Immunohistochemical
analysis of PFKFB3, PKM2 and
GPR81 and their colocalization
with CD68 positive TAMs in
differentiated TC. Results
are representative of stained
FFPE tissue material derived
CD68 (400x) GPR81 (400x) from five patients. (B)
Immunohistochemical analysis
CD68 positive macrophages in
healthy thyroid tissue. Hardly any
positively stained cells can be
found. 200x magnification.

CD68 (400x) PFKFB3 (400x)

238 |
Reprogramming of TAMs

11

| 239
 Chapter 12

Immunometabolic circuits in trained

immunity

Rob J.W. Arts, Leo A.B. Joosten, Mihai G. Netea.

Semin Immunol, 2016;5:425-30

Chapter 12

ABSTRACT

The classical view that only adaptive immunity can build immunological memory has
recently been challenged. Both in organisms lacking adaptive immunity as well as in
mammals, the innate immune system can adapt to mount an increased resistance
to reinfection, a de facto innate immune memory, termed trained immunity. Recent
studies have revealed that rewiring of cellular metabolism induced by different
immunological signals is a crucial step for determining the epigenetic changes
underlying trained immunity. Processes such as a shift of glucose metabolism from
oxidative phosphorylation to aerobic glycolysis, increased glutamine metabolism
and cholesterol synthesis, play a crucial role in these processes. The discovery of
trained immunity opens the door for the design of novel generations of vaccines, for
new therapeutic strategies for the treatment of immune deficiency states, and for
modulation of exaggerated inflammation in autoinflammatory diseases.

242 |
 Immunometabolic Circuits in Trained Immunity

Classically, the immune system can be divided into innate and adaptive immunity,
with monocytes, macrophages, neutrophils, and NK-cells as the main cellular
effectors of innate immune responses, while T- and B-lymphocytes mediate adaptive
immunity. Until recently it was assumed only the adaptive immune system possesses
the capacity to mount a memory response and therefore improve the immunological
reaction to a second infection. However, an increasing amount of evidence
accumulates, suggesting that also the innate immune system possesses adaptive
characteristics. In plants and non-vertebrates, both lacking an adaptive immune
system, it has already been know for several decades that a memory response
could be build that would protect from a secondary infection (1, 2). Interestingly, this
improved secondary response is not always strictly specific, as infection with one
pathogen can sometimes also protect from infections with non-related pathogens
(3). This process has been shown to be epigenetically regulated (4). In retrospect,
this (non-specific) memory, mediated by the innate immune system, was also seen
in mice strains with known deficiencies in adaptive immune responses (3, 5).
More recently, this same process of innate immune memory was also been shown
to occur in human monocytes and macrophages. β-glucan, a major component of the
C. albicans cell wall, was shown to ex vivo enhance cytokine production to a second
unrelated stimulus, a process that was also epigenetically regulated (6, 7). Also in
mice, an in-vivo challenge with β-glucan protected from subsequent C. albicans or S.
aureus infection (6, 8), and infection with cytomegalovirus induced improved effector
function of NK-cells after the infection (9). In humans, vaccination with Bacillus
Calmette-Guérin (BCG) showed non-specific protection from all-cause mortality,
mainly a result of reduced mortality from infections, in low-weight birth children in
West-Africa (10, 11). In a vaccination study in healthy adult volunteers, BCG markedly
increased ex-vivo cytokine responses by inducing epigenetic reprogramming in
myeloid cells (12). These studies demonstrate that the innate immune system can
adapt after a previous challenge through functional and epigenetic reprogramming,
a process that has been termed trained immunity or innate immune memory (13, 14).
On the one hand, trained immunity is likely an important host defense mechanism
contributing to the maturation of the innate immune system of infants and mediating
protection after certain infections or vaccinations. On the other hand, when induced 12
inappropriately by endogenous stimuli, trained immunity may play a role in the
pathogenesis of autoinflammatory and/or autoimmune diseases (14, 15). Therefore,
better understanding of the molecular mechanisms of trained immunity is crucial for
developing new ways of immunotherapy and targeting inflammatory disorders (14).
In the last years an increasing amount of evidence has been accumulated in
support of the concept that cellular metabolism is correlated with the functional
state of immune cells (16). Some of the first observations reported that different

| 243
Chapter 12

subsets of lymphocytes had distinctly different cellular metabolic states. Activated

T-lymphocytes have high rates of both glycolysis and oxidative phosphorylation
(OxPhos) and metabolize glucose to lactate (17, 18), whereas memory T-lymphocytes
are more dependent on lipid synthesis via mitochondrial citrate production. These
lipids can be used to produce triacyglycerides (TAGs) which are being degraded by
β-oxidation to fuel OxPhos via acetyl-CoA production (19). In contrast, regulatory
T-cells fuel β-oxidation and OxPhos through exogenously derived fatty acids (20).
This shows that the phenotype of lymphocytes highly correlates with the source of
energy that they use (21, 22). Subsequent studies showed that different phenotypes
of macrophages retrieve energy from very distinct metabolic pathways: the more
inflammatory (M(IFNγ) or formerly M1) macrophages depend largely on glycolysis
and show impaired OxPhos and disruption of the tricarboxylic acid (TCA) cycle (23,
24), while in the more anti-inflammatory (M(IL-4) or formerly M2) macrophages the
TCA cycle is intact as they rely on OxPhos (25, 26) and furthermore show increased
β-oxidation as a result of fatty acid uptake (27).
In this review we will focus on the metabolic pathways induced by innate immune
training. We will discuss glycolysis, TCA cycle, glutamine, and cholesterol metabolism
and discuss their (potential) effect on epigenetics and how these clues could be used
as therapeutic targets.

METABOLIC PATHWAYS IN TRAINED IMMUNITY

Glycolysis
A metabolic switch from oxidative phosphorylation to glycolysis resulting in more
lactate production has been described in the highly metabolically active cancer
cells already in the beginning of the last century by Otto Warburg, thus called the
‘Warburg effect’ (28). Glycolysis is often increased during immune cell activation:
activated T-cells show increased rates of glycolysis (17, 18) and pro-inflammatory
macrophages increase glucose metabolism resulting in increased lactate production
(24). This switch is assumed to be important as glycolysis, although being less
efficient in generating adenosine triphosphate (ATP), can be upregulated multiple
folds and therefore results in a faster production of ATP compared to OxPhos (28).
A similar switch is seen in β-glucan trained monocytes (29) (Figure 1).
Transcriptional and epigenetic (H3K4me3 and H3K27ac) analysis of β-glucan
induced trained immunity in monocytes revealed that genes in the mTOR signaling
pathway and several metabolic pathways, especially glycolysis, were highly induced
(7, 29). When human monocytes are stimulated in vitro with β-glucan for 24h and
let to rest for 6 subsequent days, the amounts of glucose consumption and lactate
production increased over time. In contrast, oxygen consumption 6 days after
β-glucan training is significantly decreased compared to control macrophages (29).

244 |
 Immunometabolic Circuits in Trained Immunity

These effects of β-glucan-induced training were mediated by activation of the Akt/

mTOR/HIF-1α pathway. Inhibiting this pathway at several levels, or making use of
myeloid cell specific Hif-1α knockout mice, abrogated induction of trained immunity
both at cytokine and epigenetic level (29) (Figure 1).
Induction of glycolysis results in higher ratios of NAD+/NADH ratio, which was
also the case in β-glucan trained monocytes/macrophages (29). In LPS stimulated
monocytes the vast increase in NAD+/NADH ratio has been shown to activate
sirtuin 1 and 6, supporting a switch from a pro-inflammatory state with high rates
of glycolysis to a more anti-inflammatory state with increased fatty acid oxidation
(30). Interestingly, in β-glucan trained monocytes, sirtuin 1 expression appeared to
be decreased and activation of sirtuin 1 by resveratrol inhibited training (29). This
suggests that decreased expression of sirtuin 1 might play a role in the significant
increase of H3K27ac induced by monocyte training by β-glucan. However, apart from
the classical role as histone deacetylases, sirtuins were also shown to deacetylate
nonhistone structutes, such as NF-κB or HIF-1α (31), and this should be taken into
consideration too. Moreover, lactate, the end product of anaerobic glycolysis, is also
able to inhibit histone deacetylase (HDAC) activity and therefore cause increased
gene accessibility (32).
In addition to its direct role in energy production, induction of glycolysis might also
play a role in posttranslational modification of effector molecules. Glyceraldehyde
3-phosphate dehydrogenase (gapdh), one of the enzymes in glycolysis can bind

Glucose Glucose
A B

Lactate Pyruvate Lactate Pyruvate

OxPhos OxPhos
Hif1α
TCA TCA

mTOR

12
Non-trained macrophage Trained macrophage
Figure 1 - Glucose metabolism in trained immunity. Induction of trained immunity by β-glucan
causes activation of the mTOR pathway, by signalling via the dectin-1 receptor, which results in HIF-1α
activity. HIF-1α is a central regulating transcription factor of for example glycolysis-related genes. This,
therefore, results in an upregulation of glycolysis. Pyruvate, the end product of glycolysis, can be used to
either fuel the TCA cycle to produce NADH or FADH2, metabolic components that could be used in the
electron transport chain for oxidative phosphorylation (OxPhos). However, in β-glucan trained monocytes
pyruvate is converted into lactate, a reaction, although less efficient than OxPhos, that results in more ATP
production, as it can be upregulated to a great extent.

| 245
Chapter 12

the 3’ UTR of ifng RNA and therefore decreasing ifnγ production. In activated T-cells
gapdh is used in glycolysis and therefore more ifnγ can be produced. Also decreasing
gapdh expression by RNA interference increased ifnγ production (33). A similar
mechanism has been reported in murine and human monocytes and macrophages
in relation to TNFA mRNA induction. GADPH can posttranscriptionally repress TNFA
mRNA in monocytes in low glycolysis state, e.g. immunotolerant monocytes as seen
in sepsis (34) (Figure 2). Whether reversal of such effects plays a role in trained
immunity remains to be elucidated.

Tricarboxylic acid cycle

A crucial pathway of energy metabolism in the cell is represented by the TCA cycle,
leading to oxidation of various substrates, including pyruvate coming from glycolysis.
After induction of trained immunity by β-glucan, trained macrophages display a
decreased basal and maximum oxygen consumption, suggestive for a decrease
in use of OxPhos (29). However, although OxPhos is decreased, the TCA cycle is
not completely shut down, with concentrations of several metabolites in the TCA
cycle such as citrate, succinate and fumarate being increased compared to non-
trained macrophages. Increased citrate concentrations might serve as a source
for fatty acid synthesis, as citrate was shown to inhibit glycolysis and TCA cycle
metabolism, whereas gluconeogenesis and lipid and sterol synthesis were induced
(35-41). Citrate can either be produced from glycolysis via pyruvate, or it can be
derived from other metabolites, such as glutamine, which can be converted into
α-ketoglutarate and enter the TCA cycle (35, 42). The latter pathway is especially
important in conditions where the mTORC1 pathway is active which results in HIF-
1α induction (e.g. trained immunity) (43), as HIF-1α inhibits pyruvate dehydrogenase
(PDH) and therefore carbon incorporation of glycolysis into the TCA cycle (43, 44)
(Figure 2). When citrate is being used as a source for lipid or sterol synthesis, it first
should be transported from the mitochondrion into the cytosol by the citrate carrier
(CIC) where it can be converted into acetyl-CoA by ATP citrate lyase (45) (Figure 2).
Acetyl-CoA is a acetyl donor for histone acetylation (a histone mark that facilitates
transcription) (46). Moreover, it has been shown that acetyl-CoA derived from both
glycolysis and glutamine induces histone acetylation of genes of glycolytic enzymes,
such as hexokinase 2, phosphofructokinase, and lactate dehydrogenase (LDH)
(47), therefore promoting glycolysis. Inhibition of, or mutations in, CIC limit histone
acetylation, showing the importance of citrate in histone acetylation (48).
Succinate and fumarate concentrations are also higher in β-glucan trained
monocytes and macrophages and both have been shown to play an important role
in inflammation (49). Accumulation of succinate and fumarate has been shown to
have a stabilizing effect on HIF-1α (by inhibiting Prolyl hydroxylases), and thus

246 |
 Immunometabolic Circuits in Trained Immunity

Glucose
Hexokinase

NAD Cholesterol
GAPDH
NADH NADP

NADPH
NAD NADH PKM
Acetyl-CoA
Lactate LDH
Pyruvate
NADPH Malate
NADP NAD
PDH Citrate
NADH
Acetyl-CoA CIC
Citrate
Malate
Oxaloacetic
acid
Aspartate TCA cycle
Malate
Malate
aspartate Fumarate α-ketoglutarate
shuttle
Succinate
GABA Glutamate
Enzymatic reaction(s)
Reduction/oxidation Mitochondrium
Cytoplasm
Mitochondrial cytosol Glutamine Glutamate
shuttle
Figure 2 - Overview of the complex metabolic pathways that could play a role in trained immunity.
Induction of glycolysis resulting in lactate production is one of the central hall marks in trained immunity
metabolism. However, also glutamine metabolism, which fuels the TCA cycle is essential, just as
accumulation of certain TCA cycle metabolites, such as fumarate. Aspartate consumption from the medium
is also increased in trained monocytes and macrophages. Lastly, the cholesterol synthesis pathway
appears to be an essential metabolic pathway as well, as at transcription level it is greatly induced,
and inhibiting this pathway by statins inhibits the induction of trained immunity. Several metabolites
that accumulate in trained monocytes and macrophages could play a role in the induction of epigenetic
modulators, such as succinate and fumarate for antagonizing histone or DNA demethylation and acetyl-
CoA as an essential substrate for acetylating processes. Further research to determine the exact role of
these pathways in trained immunity and also their effects on epigenetics is warranted.

lead to an increase in glycolysis and IL-1β transcription (23, 50, 51). Apart from the 12
effect on HIF-1α, succinate also signals through the succinate receptor, which in
dendritic cells results in intracellular calcium mobilization and synergism with Toll-
like receptor 3 (TLR3) and TLR7 and promote their activity (52, 53). Succinate also
results in succinylation of several proteins, e.g. GAPDH, malate dehydrogenase,
LDH and the glutamate carrier 1. However, how this posttranslational modification
affects the activity of these proteins remains to be elucidated (23). Lastly, succinate
and fumarate can act as an antagonist of histone and DNA demethylases. Lysine

| 247
Chapter 12

demethylases (KDMs) of the JmjC family need α-ketoglutarate as a cofactor for

the demethylation process (54) and succinate and fumarate are known to serve as
antagonizing factors (54, 55). For fumarate it has also been shown that it can inhibit
activity of KDM5 demethylases (12, 56).
2-hydroxyglutarate concentrations are also higher in trained monocytes, and
this also has antagonizing effects on α-ketoglutarate-dependent demethylases (57).
Hence, 2-hydroxyglutarate could also serve as an additional factor in modulating
epigenetic marks induced by β-glucan.

FUTURE DIRECTIONS TO STUDY TRAINED IMMUNITY

Glutamine metabolism
The metabolite glutamine has been shown to be an essential source of succinate
and fumarate by glutamine anaplerosis and the GABA shunt (23), and also for citrate
via the reverse TCA cycle route (35). It should therefore also be determined whether
glutamine metabolism is an important component of trained immunity as well (Figure
2). In addition, other effects of glutamine metabolism may influence cell activation
during trained immunity. Firstly, glutamate could be used for ATP production, as well
as NADPH by conversion of cytosolic malate to pyruvate. Therefore, mitochondrial
malate needs to be transported into the cytosol by the malate shuttle. In addition,
cytosolic pyruvate could also be used to maintain the NADH redox balance by
conversion to lactate. Secondly, glutamate could be used to produce acetyl CoA,
which acts as a substrate for histone acetyltransferases (58); notably, H3K27Ac is
an important histone mark accompanying active promoters in trained monocytes
(7). Thirdly, in a glioblastoma cell line, glutamine has been shown to contribute to
the production of cholesterol and fatty acids, two pathways that were significantly
upregulated in trained monocytes (7, 59). Glutamine enters the TCA cycle via
α-ketoglutarate or succinate and is metabolized to citrate (or goes in the reverse
direction (60)) that can be converted into cytosolic acetyl CoA, which can be used
as a direct fuel for cholesterol and fatty acid synthesis. Fourthly, glutamine could be
used to produce malate, which can be used for fueling the malate-aspartate shuttle.
In this way the reducing equivalents of mitochondrial NADH can be transported
to the cytoplasm for NADPH production, where it might serve as a cofactor in the
cholesterol synthesis pathway, which is highly induced in β-glucan-induced trained
immunity (Figure 2). Finally, inhibition of glutamine uptake in breast cancer cell
lines has been strongly correlated with reduction of H3K4me3 of essential genes,
modulated by reduced expression of the methyltransferases SETD1 and ASH2L
(61).

248 |
 Immunometabolic Circuits in Trained Immunity

Aspartate metabolism
When consumption of amino acids from the medium of non-trained and β-glucan-
trained human macrophages was compared, consumption of aspartate was shown
to be highly induced in trained macrophages. Metabolism of aspartic acid serves
several roles, as it is part of the urea cycle, gluconeogenesis, and the malate-
aspartate shuttle, it is important for inosine formation in purine metabolism, and
is a precursor for several amino acids, including methionine (62). Aspartate could
therefore contribute in several ways to the induction of trained immunity. Firstly,
aspartate might act by upregulating the malate-aspartate shuttle, which would
result in a transition of the reducing equivalents of mitochondrial NADH to NADPH
production in the cytoplasm, where it might serve as an essential metabolite for
upregulated cholesterol synthesis (Figure 2). Secondly, aspartate might serve as fuel
for purine production, which is upregulated in β-glucan-trained cells via the penthose
phosphate pathway (PPP) (63). Thirdly, aspartate can be used as a source, via
transamination of oxaloacetic acid, which together with acetyl-CoA forms citrate
(35) (Figure 2). Finally, aspartate might serve for the production of essential amino
acids such as methionine, which also serves, just as other metabolic pathways,
such as folate and choline metabolism, as an essential cofactor for DNA and histone
methyltransferases (64, 65).

Cholesterol synthesis
Analysis of transcriptome data of β-glucan trained macrophages revealed that
also the cholesterol synthesis pathway was also highly induced (7, 59). How the
cholesterol synthesis pathway contributes to the phenotype of trained immunity is
still to be elucidated. However, a plausible hypothesis for this effect is that cholesterol
remodels the cell membrane of trained cells, which could mediate increased
signal transduction upon restimulation, for example by disrupting cholesterol and
sphingolipid raft formation (66).

FUTURE DIRECTIONS TO TARGET DISEASE

Immunometabolism is a field that has gained more interest the last several years,
and has been shown to be involved in immune activation in several diseases such 12
as infections (67, 68), autoinflammatory disorders and cardiovascular diseases
(69). Moreover, in post-sepsis immunoparalysis, we have shown that the cellular
metabolism of monocytes had broad defects and that reversing these defects
could at least partially restore the immunological function of these cells (8, 70).
Therefore, modulation of cellular metabolism has great potential as a therapeutic
in immune-mediated diseases. In autoinflammatory diseases, atherosclerosis or
insulin resistance and diabetes in which monocytes and macrophages are thought

| 249
Chapter 12

to be skewed towards a pro-inflammatory profile, inhibition of certain metabolic

pathways may represent a valid approach to target disease activity (14, 69, 71-74).
Moreover, the role played by cellular metabolic pathways for the induction of trained
immunity may also represent a novel therapeutic approach in immunodeficiencies.
Induction of metabolic pathways important for trained immunity should be attempted
to restore immune function during sepsis-induced immunoparalysis. In addition,
these approaches could also be used to improve the immune responsiveness in
vulnerable groups such as elderly and infants that have decreased immune function
and are more prone to infectious diseases (75, 76).
In conclusion, boosting or inhibiting the innate immune system has several
potential beneficial effects in different kinds of medical settings and modulating
cellular metabolism of immune cells is a promising new approach to reach this goal.

REFERENCES
1. Kurtz J. Specific memory within innate immune
systems. Trends Immunol. 2005;26(4):186-92.
2. Kurtz J, Franz K. Innate defence: evidence for memory
in invertebrate immunity. Nature. 2003;425(6953):37-
8.
3. Quintin J, Cheng SC, van der Meer JW, Netea
MG. Innate immune memory: towards a better
understanding of host defense mechanisms. Curr
Opin Immunol. 2014;29:1-7.
4. Fu ZQ, Dong X. Systemic acquired resistance:
turning local infection into global defense. Annual
review of plant biology. 2013;64:839-63.
5. Bistoni F, Vecchiarelli A, Cenci E, Puccetti P, Marconi
P, Cassone A. Evidence for macrophage-mediated
protection against lethal Candida albicans infection.
Infect Immun. 1986;51(2):668-74.
6. Quintin J, Saeed S, Martens JH, Giamarellos-
Bourboulis EJ, Ifrim DC, Logie C, et al. Candida
albicans infection affords protection against
reinfection via functional reprogramming of
monocytes. Cell host & microbe. 2012;12(2):223-32.
7. Saeed S, Quintin J, Kerstens HH, Rao NA,
Aghajanirefah A, Matarese F, et al. Epigenetic
programming of monocyte-to-macrophage
differentiation and trained innate immunity. Science.
2014;345(6204):1251086.
8. Cheng SC, Scicluna BP, Arts RJ, Gresnigt MS,
Lachmandas E, Giamarellos-Bourboulis EJ, et
al. Broad defects in the energy metabolism of
leukocytes underlie immunoparalysis in sepsis.
Nature immunology. 2016;17(4):406-13.
9. Marcus A, Raulet DH. Evidence for natural killer cell
memory. Curr Biol. 2013;23(17):R817-20.
10. Biering-Sorensen S, Aaby P, Napirna BM, Roth A,
Ravn H, Rodrigues A, et al. Small randomized trial
among low-birth-weight children receiving bacillus
Calmette-Guerin vaccination at first health center
contact. The Pediatric infectious disease journal.
2012;31(3):306-8.
11. Aaby P, Roth A, Ravn H, Napirna BM, Rodrigues A,
Lisse IM, et al. Randomized trial of BCG vaccination
at birth to low-birth-weight children: beneficial
nonspecific effects in the neonatal period? The
Journal of infectious diseases. 2011;204(2):245-52.
12. Kleinnijenhuis J, Quintin J, Preijers F, Joosten LA,
Ifrim DC, Saeed S, et al. Bacille Calmette-Guerin
induces NOD2-dependent nonspecific protection
from reinfection via epigenetic reprogramming of
monocytes. Proceedings of the National Academy
of Sciences of the United States of America.
2012;109(43):17537-42.
13. Netea MG, Quintin J, van der Meer JW. Trained
immunity: a memory for innate host defense. Cell
host & microbe. 2011;9(5):355-61.
14. Netea MG, Joosten LA, Latz E, Mills KH, Natoli G,
Stunnenberg HG, et al. Trained immunity: A program
of innate immune memory in health and disease.
Science. 2016;352(6284):aaf1098.
15. Bekkering S, Joosten LA, van der Meer JW, Netea
MG, Riksen NP. Trained innate immunity and
atherosclerosis. Curr Opin Lipidol. 2013;24(6):487-
92.
16. Ganeshan K, Chawla A. Metabolic regulation
of immune responses. Annu Rev Immunol.
2014;32:609-34.
17. Wang R, Dillon CP, Shi LZ, Milasta S, Carter
R, Finkelstein D, et al. The transcription factor
Myc controls metabolic reprogramming upon T
lymphocyte activation. Immunity. 2011;35(6):871-82.
18. Donnelly RP, Finlay DK. Glucose, glycolysis and
lymphocyte responses. Molecular immunology. 2015.
19. van der Windt GJ, O’Sullivan D, Everts B, Huang SC,
Buck MD, Curtis JD, et al. CD8 memory T cells have
a bioenergetic advantage that underlies their rapid
recall ability. Proceedings of the National Academy
of Sciences of the United States of America.
2013;110(35):14336-41.
20. Michalek RD, Gerriets VA, Jacobs SR, Macintyre AN,
MacIver NJ, Mason EF, et al. Cutting edge: distinct
glycolytic and lipid oxidative metabolic programs
are essential for effector and regulatory CD4+ T cell
subsets. Journal of immunology. 2011;186(6):3299-
303.
21. Loftus RM, Finlay DK. Immunometabolism; cellular
metabolism turns immune regulator. The Journal of
biological chemistry. 2015.
22. Gerriets VA, Rathmell JC. Metabolic pathways in
T cell fate and function. Trends in immunology.
2012;33(4):168-73.
23. Tannahill GM, Curtis AM, Adamik J, Palsson-
McDermott EM, McGettrick AF, Goel G, et
al. Succinate is an inflammatory signal that
induces IL-1beta through HIF-1alpha. Nature.
2013;496(7444):238-42.
24. Jha AK, Huang SC, Sergushichev A, Lampropoulou
V, Ivanova Y, Loginicheva E, et al. Network integration
of parallel metabolic and transcriptional data reveals
metabolic modules that regulate macrophage
polarization. Immunity. 2015;42(3):419-30.
25. Hu X, Liu G, Hou Y, Shi J, Zhu L, Jin D, et al.
Induction of M2-like macrophages in recipient NOD-
scid mice by allogeneic donor CD4(+)CD25(+)
regulatory T cells. Cellular & molecular immunology.
2012;9(6):464-72.
26. Van Dyken SJ, Locksley RM. Interleukin-4- and
interleukin-13-mediated alternatively activated
macrophages: roles in homeostasis and disease.
Annual review of immunology. 2013;31:317-43.
27. Odegaard JI, Chawla A. Alternative macrophage
activation and metabolism. Annual review of
pathology. 2011;6:275-97.
28. Warburg O, Wind F, Negelein E. The Metabolism
of Tumors in the Body. The Journal of general
physiology. 1927;8(6):519-30.

250 |
 Immunometabolic Circuits in Trained Immunity
29. Cheng SC, Quintin J, Cramer RA, Shepardson KM,
Saeed S, Kumar V, et al. mTOR- and HIF-1alpha-
mediated aerobic glycolysis as metabolic basis for
trained immunity. Science. 2014;345(6204):1250684.
30. Liu TF, Vachharajani VT, Yoza BK, McCall CE.
NAD+-dependent sirtuin 1 and 6 proteins coordinate
a switch from glucose to fatty acid oxidation during
the acute inflammatory response. J Biol Chem.
2012;287(31):25758-69.
31. Preyat N, Leo O. Sirtuin deacylases: a molecular
link between metabolism and immunity. Journal of
leukocyte biology. 2013;93(5):669-80.
32. Latham T, Mackay L, Sproul D, Karim M, Culley J,
Harrison DJ, et al. Lactate, a product of glycolytic
metabolism, inhibits histone deacetylase activity and
promotes changes in gene expression. Nucleic Acids
Res. 2012;40(11):4794-803.
33. Chang CH, Curtis JD, Maggi LB, Jr., Faubert B,
Villarino AV, O’Sullivan D, et al. Posttranscriptional
control of T cell effector function by aerobic glycolysis.
Cell. 2013;153(6):1239-51.
34. Millet P, Vachharajani V, McPhail L, Yoza B,
McCall CE. GAPDH Binding to TNF-alpha mRNA
Contributes to Posttranscriptional Repression in
Monocytes: A Novel Mechanism of Communication
between Inflammation and Metabolism. Journal of
immunology. 2016;196(6):2541-51.
35. Iacobazzi V, Infantino V. Citrate--new functions for an
old metabolite. Biol Chem. 2014;395(4):387-99.
36. Taylor WM, Halperin ML. Regulation of pyruvate
dehydrogenase in muscle. Inhibition by citrate. J Biol
Chem. 1973;248(17):6080-3.
37. Hillar M, Lott V, Lennox B. Correlation of the effects of
citric acid cycle metabolites on succinate oxidation by
rat liver mitochondria and submitochondrial particles.
J Bioenerg. 1975;7(1):1-16.
38. Paumen MB, Ishida Y, Muramatsu M, Yamamoto M,
Honjo T. Inhibition of carnitine palmitoyltransferase
I augments sphingolipid synthesis and palmitate-
induced apoptosis. J Biol Chem. 1997;272(6):3324-
9.
39. Yalcin A, Clem BF, Simmons A, Lane A, Nelson K,
Clem AL, et al. Nuclear targeting of 6-phosphofructo-
2-kinase (PFKFB3) increases proliferation
via cyclin-dependent kinases. J Biol Chem.
2009;284(36):24223-32.
40. Yalcin A, Telang S, Clem B, Chesney J. Regulation
of glucose metabolism by 6-phosphofructo-2-kinase/
fructose-2,6-bisphosphatases in cancer. Exp Mol
Pathol. 2009;86(3):174-9.
41. Chesney J. 6-phosphofructo-2-kinase/fructose-2,6-
bisphosphatase and tumor cell glycolysis. Curr Opin
Clin Nutr Metab Care. 2006;9(5):535-9.
42. DeBerardinis RJ, Cheng T. Q’s next: the diverse
functions of glutamine in metabolism, cell biology and
cancer. Oncogene. 2010;29(3):313-24.
43. Israel M, Schwartz L. The metabolic advantage of
tumor cells. Mol Cancer. 2011;10:70.
44. Lum JJ, Bui T, Gruber M, Gordan JD, DeBerardinis
RJ, Covello KL, et al. The transcription factor HIF-
1alpha plays a critical role in the growth factor-
dependent regulation of both aerobic and anaerobic
glycolysis. Genes Dev. 2007;21(9):1037-49.
45. Bisaccia F, De Palma A, Palmieri F. Identification
and purification of the tricarboxylate carrier from
rat liver mitochondria. Biochim Biophys Acta.
1989;977(2):171-6.
46. Gut P, Verdin E. The nexus of chromatin
regulation and intermediary metabolism. Nature.
2013;502(7472):489-98.
47. Wellen KE, Hatzivassiliou G, Sachdeva UM, Bui TV,
Cross JR, Thompson CB. ATP-citrate lyase links
cellular metabolism to histone acetylation. Science.
48.
2009;324(5930):1076-80.
Morciano P, Carrisi C, Capobianco L, Mannini L,
Burgio G, Cestra G, et al. A conserved role for the
mitochondrial citrate transporter Sea/SLC25A1 in
the maintenance of chromosome integrity. Hum Mol
Genet. 2009;18(21):4180-8.
49. Mills E, O’Neill LA. Succinate: a metabolic signal in
inflammation. Trends Cell Biol. 2014;24(5):313-20.
50. Koivunen P, Tiainen P, Hyvarinen J, Williams KE,
Sormunen R, Klaus SJ, et al. An endoplasmic
reticulum transmembrane prolyl 4-hydroxylase is
induced by hypoxia and acts on hypoxia-inducible
factor alpha. J Biol Chem. 2007;282(42):30544-52.
51. Serra-Perez A, Planas AM, Nunez-O’Mara A, Berra
E, Garcia-Villoria J, Ribes A, et al. Extended ischemia
prevents HIF1alpha degradation at reoxygenation by
impairing prolyl-hydroxylation: role of Krebs cycle
metabolites. J Biol Chem. 2010;285(24):18217-24.
52. Rubic T, Lametschwandtner G, Jost S, Hinteregger
S, Kund J, Carballido-Perrig N, et al. Triggering
the succinate receptor GPR91 on dendritic cells
enhances immunity. Nat Immunol. 2008;9(11):1261-
9.
53. He W, Miao FJ, Lin DC, Schwandner RT, Wang Z,
Gao J, et al. Citric acid cycle intermediates as ligands
for orphan G-protein-coupled receptors. Nature.
2004;429(6988):188-93.
54. Lu C, Ward PS, Kapoor GS, Rohle D, Turcan
S, Abdel-Wahab O, et al. IDH mutation impairs
histone demethylation and results in a block to cell
differentiation. Nature. 2012;483(7390):474-8.
55. Xiao M, Yang H, Xu W, Ma S, Lin H, Zhu H, et al.
Inhibition of alpha-KG-dependent histone and
DNA demethylases by fumarate and succinate
that are accumulated in mutations of FH and
SDH tumor suppressors. Genes & development.
2012;26(12):1326-38.
56. Arts RJ, Blok BA, Aaby P, Joosten LA, de Jong D,
van der Meer JW, et al. Long-term in vitro and in
vivo effects of gamma-irradiated BCG on innate
and adaptive immunity. Journal of leukocyte biology.
2015;98(6):995-1001.
57. Yang H, Ye D, Guan KL, Xiong Y. IDH1 and IDH2
mutations in tumorigenesis: mechanistic insights and
clinical perspectives. Clinical cancer research : an
official journal of the American Association for Cancer
Research. 2012;18(20):5562-71.
58. Choudhary C, Weinert BT, Nishida Y, Verdin E, Mann
M. The growing landscape of lysine acetylation
links metabolism and cell signalling. Nature reviews
Molecular cell biology. 2014;15(8):536-50.
59. Emanuelli B, Vienberg SG, Smyth G, Cheng C,
Stanford KI, Arumugam M, et al. Interplay between
FGF21 and insulin action in the liver regulates
metabolism. The Journal of clinical investigation.
2014;124(2):515-27.
60. Metallo CM, Gameiro PA, Bell EL, Mattaini KR, Yang
J, Hiller K, et al. Reductive glutamine metabolism by
IDH1 mediates lipogenesis under hypoxia. Nature.
2012;481(7381):380-4.
61. Simpson NE, Tryndyak VP, Pogribna M, Beland FA,
Pogribny IP. Modifying metabolically sensitive histone
marks by inhibiting glutamine metabolism affects
gene expression and alters cancer cell phenotype.
Epigenetics. 2012;7(12):1413-20.
62. Baynes JW, Dominiczak MH. Medical biochemistry.
2nd ed. Philadelphia: Elsevier Mosby; 2005.
63. DeBerardinis RJ, Mancuso A, Daikhin E, Nissim
I, Yudkoff M, Wehrli S, et al. Beyond aerobic
glycolysis: transformed cells can engage in glutamine
metabolism that exceeds the requirement for protein
and nucleotide synthesis. Proceedings of the
National Academy of Sciences of the United States
of America. 2007;104(49):19345-50.
64. Donohoe DR, Bultman SJ. Metaboloepigenetics:
interrelationships between energy metabolism and
epigenetic control of gene expression. Journal of
cellular physiology. 2012;227(9):3169-77.
65. Obeid R. The metabolic burden of methyl
donor deficiency with focus on the betaine
homocysteine methyltransferase pathway. Nutrients.
2013;5(9):3481-95.
66. Hillyard DZ, Jardine AG, McDonald KJ, Cameron AJ.
Fluvastatin inhibits raft dependent Fcgamma receptor
signalling in human monocytes. Atherosclerosis.
2004;172(2):219-28.
67. Palmer CS, Cherry CL, Sada-Ovalle I, Singh A,
Crowe SM. Glucose Metabolism in T Cells and
Monocytes: New Perspectives in HIV Pathogenesis.
EBioMedicine. 2016;6:31-41.
68. Shi L, Eugenin EA, Subbian S. Immunometabolism in
Tuberculosis. Frontiers in immunology. 2016;7:150.
69. Christ A, Bekkering S, Latz E, Riksen NP. Long-
term activation of the innate immune system in
atherosclerosis. Semin Immunol. 2016.
12
70. Arts RJ, Gresnigt MS, Joosten LA, Netea MG.
Cellular metabolism of myeloid cells in sepsis.
Journal of leukocyte biology. 2016.
71. Crisan TO, Netea MG, Joosten LA. Innate immune
memory: Implications for host responses to damage-
associated molecular patterns. Eur J Immunol.
2016;46(4):817-28.
72. Brasacchio D, Okabe J, Tikellis C, Balcerczyk A,
George P, Baker EK, et al. Hyperglycemia induces
a dynamic cooperativity of histone methylase and
demethylase enzymes associated with gene-
activating epigenetic marks that coexist on the lysine
tail. Diabetes. 2009;58(5):1229-36.
73. Anderson EK, Gutierrez DA, Hasty AH. Adipose
tissue recruitment of leukocytes. Curr Opin Lipidol.
2010;21(3):172-7.
| 251
Chapter 12

74. El-Osta A, Brasacchio D, Yao D, Pocai A, Jones PL,

Roeder RG, et al. Transient high glucose causes
persistent epigenetic changes and altered gene
expression during subsequent normoglycemia. J Exp
Med. 2008;205(10):2409-17.
75. Kollmann TR, Levy O, Montgomery RR, Goriely S.
Innate immune function by Toll-like receptors: distinct
responses in newborns and the elderly. Immunity.
2012;37(5):771-83.
76. Targonski PV, Jacobson RM, Poland GA.
Immunosenescence: role and measurement in
influenza vaccine response among the elderly.
Vaccine. 2007;25(16):3066-9.

252 |
Immunometabolic Circuits in Trained Immunity

12

| 253
 Chapter 13

Summary and Discussion

Chapter 13

Trained innate immunity, a de facto memory of the innate immune system, has gained
attention over the last years as an important immunological process. Especially as
its implications appear to reach further than generally was thought on first hand.
In the present thesis I addressed two main topics. In the first part of this thesis
the non-specific effects of the BCG vaccine were determined and discussed. Here
I show the underlying molecular mechanisms for the induction of trained immunity
by BCG, just as its immunomodulatory potential, which could have important
implications for management of infectious diseases, immunodeficiency disorders
and vaccination strategies. We furthermore advocate that this is not just true for
BCG but holds for other vaccines and potentially vitamine A supplementation too. In
the second part of this thesis I focus on the metabolic changes that occur through
the induction of trained immunity. Metabolic changes are well known to correlate
with cellular function in other cell types. We now show that this is also true for trained
and tolerant monocytes and macrophages. This gives an important insight in new
potential treatment strategies for immunological disorders.
This final chapter addresses the main findings of this thesis, puts them in context
with other literature, describes the potential implications of these findings, and finally
points out future research challenges.

BCG and trained immunity

The hypothesis that BCG is able to induce non-specific protective effects started
with the observation that vaccination of neonates in developing countries with a
high infectious disease burden resulted in lower mortality from other infectious
diseases than tuberculosis (1). This shows a non-specific adaptation (memory) of
the immune system. This non-specific memory could hypothetically be the result
of two mechanisms: (a) trained immunity that concerns the innate host defenses,
or (b) cross-reactivity of T-lymphocytes, a process termed ‘heterologous immunity’
that is mostly attributed to T-cell cross reactivity (2). Heterologous immunity has
been especially well described in viral infections, but in mice it has also been shown
that vaccination with BCG can protect against infection with vaccinia virus through
a mechanism dependent on T-cell receptor signaling and IFNγ production of CD4
cells (3). Furthermore, via a different mechanism, CD4 and CD8 memory cells could
be activated in an antigen-independent manner, and they can therefore boost both
Th1 and Th17 responses upon secondary non-related infections (4-9). Also, BCG
vaccination has been shown to enhance the antibody titer and T-cell responses to
other vaccines such as hepatitis B, polio and pneumococcal conjugate vaccination
(10, 11).
Next to the non-specific effects on the adaptive immune system, the effect of BCG
on the innate immune system has been studied in several models. A mouse study

256 |
 Discussion

showed that BCG/PPD-activated macrophages were able to produce more H2O2

and were better capable in killing Candida albicans (12). In an experimental model
in hamsters, BCG vaccination increased the lytic activity of peritoneal macrophages
against herpes simplex infected cells (13). Also severe combine immunodeficiency
(SCID) mice that lack functional lymphocytes showed an increased survival from
Candida sepsis and less fungal outgrowth after BCG vaccination, with spleen
monocytes producing more TNFα upon ex-vivo restimulation (14). BCG vaccinated
B-cell deficient mice were as effectively protected from Schistosoma mansoni
infection as the wild type controls (15). Administration of muramyldipeptide (MDP),
which is a component of mycobacterial cells walls, resulted in protection against
infection with vaccinia virus and herpes simplex virus in mice, and this effect was
mediated by peritoneal macrophages and was independent of IFNγ (16).
Important non-specific beneficial effects of BCG were also observed in humans.
BCG vaccination was shown to induce potentiation of the activity of NK-cells (17,
18), just as in mice where the protective effect of BCG vaccination on disseminated
candidiasis was partially dependent on NK-cells (17). Compared to cord blood
monocytes from unvaccinated neonates, cells from vaccinated infants showed
increased expression of granulysin and perforin upon stimulation (19). The ration
between M1 versus M2 macrophages is modulated and appeared to correlate with
the risk of cancer recurrence after intravesical BCG therapy, which supports an
important role of innate immune cells for the non-specific effects of BCG in bladder
cancer (20). Also an increase in antimicrobial peptide production in infants vaccinated
with OPV and BCG was observed in stool samples (21).
In a first human proof-of-principle vaccination trial, these non-specific effects
could at least partially be attributed to the innate immune system, by showing that
BCG vaccination led to higher production of innate cytokines up to three months
after vaccination when PBMCs were stimulated with BCG-related and non-related
ligands. This was accompanied by an increase of the activation markers CD11b,
TLR4 and CD14 on monocytes. The increased cytokine production was a result of
higher mRNA expression, which was accompanied by epigenetic modulation, in this
case increased H3K4me3 at IL6 and TNFA promoters of monocytes (14).
Given the promising results of this trial, more studies on the non-specific effects
of the BCG vaccine were performed. In a trial in Guinea Bissau with 467 low birth-
weight newborns, ex-vivo cytokine production was upregulated upon stimulation
with several TLR agonists (22), showing that trained immunity can also be elicited 13
in newborns. Furthermore, the boosting effect of BCG on other vaccines was
determined in a trial were it was shown that BCG is able to enhance antibody
induction of influenza strains (23).
Interestingly, BCG revaccination of two-year-old children in Guinea Bissau resulted

| 257
Chapter 13

in lower TNFα and higher IL-10 responses to LPS, PHA and PPD (24). This effect
might be dependent on T-regulatory cells induction by the second BCG vaccination,
as it was shown that mice that were presensitized with mycobacteria developed
more Treg induction and higher IL-10 response upon subsequent vaccination with
BCG (25).
The studies presented in the first part of this thesis were designed to contribute
to better understand these non-specific effects of BCG vaccination.
Chapter 2 and 3 directly aim for a clinically relevant application of trained
immunity induced by BCG. BCG vaccination would be very suitable in situations
in which patients suffer from immunodeficiencies and could be boosted by BCG.
Examples that could be thought of are immunoparalysis after sepsis, HIV infection,
or inherited immunodeficiencies. However, the presence of an immunodeficiency
is a contraindication for BCG administration, as the microorganism may cause
disseminated disease. Hence, we assessed the potential of a γ-irradiated BCG
vaccine (γBCG, which thus contains inactivated, but intact M. bovis) to induce
trained immunity. In the in-vitro culture system γBCG was able to induce trained
immunity, both at the level of increased cytokine responses upon restimulation,
as on the epigenetic level. This gave the incentive to continue with two trials to
further elucidate the potential induction of trained immunity by γBCG in vivo. In a
first trial, presented in chapter 2, fifteen healthy volunteers were vaccinated with
γBCG. 2 Weeks and 3 months later, blood was drawn and PBMCs were ex vivo
stimulated with several stimuli to assess the induction of non-specific memory.
However, in contrast to the in-vitro experiments, vaccination with γBCG increased
only heterologous T-cell responses, but did not enhance the production of monocyte-
derived pro-inflammatory cytokines. In a second trial that was performed at the same
time, healthy volunteers were vaccinated with γBCG or placebo and five days later
the subjects were hospitalized and received an intravenous injection of LPS. Main
outcome measures were clinical parameters and in-vivo cytokine production: also
in this trial no differences were found between the placebo and γBCG vaccinated
group.
Hence, from these two studies it can be concluded that γBCG is not capable of
inducing trained immunity in vivo and it is unlikely that it can be used as immunotherapy
in immunodeficient patients. Several considerations have to be taken into account
while interpreting these results. One question that remains unanswered is whether
γBCG could induce trained immunity in immunocompromised patients. It could be
hypothesized that the effect of γBCG is smaller compared to BCG (that replicates
at the site of vaccination) and is therefore not capable of inducing an enhanced
function of myeloid cells in healthy volunteers, but it might still be able to do so in
immunocompromised subjects (e.g. post-sepsis immunotolerant patients). Also the

258 |
 Discussion

idea of repeated γBCG vaccinations to improve γBCG stimulation, which happens

with normal BCG by replication of the bacterium at the site of vaccination, could be
a way to induce better innate immune training.
In Chapter 4 I addressed a clinically important question for the effectiveness of
BCG vaccination. WHO recommends high-dose vitamin A supplementation (VAS)
in countries at risk of vitamin A deficiency (26). However, some studies have noted
interactions between VAS and routine vaccinations, just as potential effects of VAS
itself (27, 28). We therefore assessed the long-term effects of vitamin A in our in-
vitro system and showed that incubation of monocytes with vitamin A resulted in
an immunotolerant phenotype. Moreover, addition of vitamin A to BCG training of
monocytes decreased the induction of trained immunity in vitro. We furthermore
found that this effect of vitamin A is the result of increased H3K9me3 (a repressive
histone mark) at the promoters of pro-inflammatory genes. Interestingly, also BCG-
induced trained immunity is regulated by H3K9me3, which is decreased at the
promoter sites of pro-inflammatory cytokines after stimulation with BCG. Hence, this
gives us an important novel insight in the effects of vitamin A on the innate immune
system, an effect that also should be tested in vivo.
These in-vitro studies give us very interesting and necessary insights in the
molecular mechanism of BCG-induced trained immunity, but they are not easy to
extrapolate for the in-vivo effects of BCG on infection. Therefore, we designed a
trial to directly assess the impact of BCG vaccination, on the training of the innate
immune system and clinical outcome measures. In Chapter 5 I made use of
a surrogate model of infection; vaccination of healthy individuals with the yellow
fever vaccine, as vaccination with this live-attenuated vaccine results in viraemia.
Volunteers were randomized to receive either placebo or BCG. After 4 weeks they
all received yellow fever vaccination. Indeed, volunteers that received the BCG
vaccine showed lower viraemia and even more importantly, the amount of viraemia
was negatively correlated with the induction of trained immunity for IL-1β production
to non-related stimuli. In other words, when monocytes of a healthy volunteer after
BCG vaccination produced more IL-1β when they were stimulated with a non-related
pathogen/ligand, this volunteers showed lower amounts of circulating yellow fever
virus. Hence, induction of trained immunity by BCG correlated with lower viraemia.
This is a very important finding, as this is the first trial to show that the lower mortality
numbers observed after BCG vaccination can indeed be linked to the enhanced
function of the innate immune system that we have seen in our previous trials. 13
Lastly, in Chapter 6 I reviewed the literature for potential non-specific effects
of other vaccines and whether they could be due to reprogramming the innate
immune system. We concluded that it is likely that many of the non-specific effects
of vaccines are at least partially mediated by reprogramming of the innate immune

| 259
Chapter 13

system. This conclusion has several implications that warrant further research into
the effects of vaccination on the innate immune system. A few points have therefore
to be taken into account. In the first place, by taking into account the non-specific
effects of vaccines, there is an incentive for a more rational design of vaccination
policies, by delivering vaccines in an order that gives the maximum beneficial effects
(29). Furthermore, if currently used vaccines with strong beneficial non-specific
effects but moderate specific protective effects, such as BCG, are to be replaced by
newer vaccines that have a greater specific protective effect, these new vaccines
should also be evaluated for their non-specific effects. The old vaccine should not
be withdrawn and substituted by a new vaccine without evaluation of the effect of
this change on overall mortality. At the same time, we should be aware of the non-
specific effects of vaccines that have been phased out of vaccination policies due to
the eradication of their target disease, such as vaccinia (worldwide), BCG (developed
world), or perhaps in the future will be phased out, such as polio vaccine and measles
vaccine: they could still have beneficial effects without protecting against their target
diseases. Lastly, the study of the beneficial non-specific effects of vaccines might
lead to the development of new strategies to use them in target patient groups at
increased risk for infections, such as newborns, patients with inherited or acquired
immunodeficiencies, immunosenescence in the elderly, immunotherapy in cancer, or
other situations where boosting of the innate immune system could be helpful.

The network of immunometabolic pathways in trained immunity

Over the last years, more and more evidence has become available that supports
the concept that cellular metabolism is correlated with the functional state of
immune cells (30). The field started with experiments showing that different subsets
of lymphocytes use different cellular metabolic pathways to retrieve their energy
from. Activated T-lymphocytes depend on high rates of glycolysis and oxidative
phosphorylation (OxPhos) and metabolize glucose to lactate (31, 32). Memory
T-lymphocytes depend more on lipid synthesis via mitochondrial citrate production.
These lipids can be used to produce triacyglycerides that are being degraded by
β-oxidation to fuel OxPhos via acetyl-CoA production (33). Furthermore, regulatory
T-cells fuel β-oxidation and OxPhos through exogenously derived fatty acids (34).
This, hence, shows that the phenotype of lymphocytes correlates with the source of
energy that they use (35, 36). Subsequent studies showed that different macrophage
functional states are associated with very distinct metabolic pathways as well, with
the more inflammatory (M(IFNγ) or formerly M1) macrophages depending largely
on glycolysis and showing impaired OxPhos and disruption of the tricarboxylic
acid (TCA) cycle (37, 38), and the more anti-inflammatory (M(IL-4) or formerly
M2) macrophages relying on OxPhos (39, 40) with an intact TCA cycle and also

260 |
 Discussion

increased β-oxidation as a result of fatty acid uptake (41). Furthermore, it is not only
glucose metabolism, but also other metabolic pathways that play important roles in
reprogramming and polarizing cells (42-44).
Based on these considerations it is very likely that metabolic changes also
occur in trained monocytes and macrophages, as there is a clear change in cellular
phenotype. In a first study, genome-wide changes in histone modifications have
shown to underlie trained immunity in monocytes, but the molecular mechanisms
linking the immunological signals induced by microbial stimuli or vaccines to the
epigenetic changes have not been deciphered. Changes in cellular metabolism,
with a shift from OxPhos to aerobic glycolysis (Warburg effect) were shown to be
crucial for the induction of β-glucan-induced trained immunity (45). Interestingly,
increasing amounts of evidence links cellular metabolism to the regulation of gene
transcription, as several metabolites from glycolysis and the TCA cycle have been
shown to act as cofactors for epigenetic writers and erasers such as DNA and
histone methyltransferases and demethylases, and histone acetyltransferases and
deacetylases (42, 43). Based on this growing body of evidence, we hypothesized that
changes in cellular metabolism in trained immunity not only reflect enhanced energetic
needs, but also connect with immune pathways and epigenetic reprogramming,
through the accumulation of specific metabolites modulating epigenetic processes
that impact the functional program of the cell.

In the second part of this thesis I focussed on the metabolic pathways induced by
innate immune training, such as glycolysis, TCA cycle, glutamine, and cholesterol
metabolism and discussed their effects on epigenetics and how these interactions
could be used as therapeutic targets.
In Chapter 7 I assessed whether changes in cellular glucose metabolism
accompany the induction of trained immunity by BCG, using both an in-vitro system,
as well as the in-vivo human vaccination model. Here we showed that in BCG-
induced trained immunity glycolysis is upregulated in monocytes, which is regulated
by the Akt/mTOR axis. Interestingly, there appeared to be a strong link between
the metabolic and epigenetic changes. When the shift in glucose metabolism was
inhibited, the induction of trained immunity by BCG was reduced. Also, the metabolic
changes were epigenetically regulated, as shown by histone changes at the promoter
sites of metabolic genes. These observations show that metabolic and epigenetic
changes induced in trained immunity by BCG are dependent on each other. 13
In Chapter 8 we show that apart from the glycolysis pathway, also other
metabolic pathways are essential for the induction of trained immunity. Here we
show that glutamine metabolism is essential and that fumarate is a central regulatory
metabolite. Fumarate, a TCA cycle intermediate, accumulated in β-glucan-trained

| 261
Chapter 13

macrophages and this accumulation was essential for the induction of β-glucan-
induced trained immunity. Interestingly, when monocytes were trained with fumarate
alone, trained immunity was induced as well and this was accompanied by genome-
wide epigenetic changes. This shows that fumarate could account for at least a
part of the epigenetic changes induced in trained immunity. α-Ketoglutarate (another
TCA cycle intermediate) is a known cofactor for histone lysine demethylases (KDM),
whereas metabolites that have a comparable molecular structure to α-ketoglutarate,
such as fumarate, are natural antagonists (46). In line with this, fumarate-induced
trained immunity inhibited KDM5 activity, just as was seen in β-glucan trained
macrophages.
In Chapter 9 I addressed the role of the cholesterol synthesis pathway for the
induction of trained immunity. Inhibition of the cholesterol synthesis pathway inhibits
the induction of trained immunity, and the first reactions of the pathway appear
most important for this effect. We demonstrated that accumulation of mevalonate
is one of the central mechanisms in the induction of trained immunity. Incubating
monocytes with mevalonate also resulted in a trained phenotype of these cells,
which was reflected by epigenetic changes that partially overlapped the epigenetic
changes induced in β-glucan trained macrophages. As clinical validation we used
monocytes from hyper IgD syndrome (HIDS) patients that due to a germline mutation
accumulate mevalonate. Their monocytes show a pro-inflammatory phenotype and at
expression level these monocytes showed several trained immunity characteristics,
which strengthens the hypothesis that mevalonate accumulation could play a role in
disease development.
If metabolic changes play a major role in the induction of trained immunity, it is a
plausible hypothesis that metabolism could also be involved in the development of
innate immune tolerance: the opposite state from trained immunity, when monocytes
are less pro-inflammatory and where cytokine responses are downregulated. In
Chapter 10 I assessed the metabolic changes that occur in tolerance in vitro and in
vivo during the course of sepsis and we show that during immunotolerance all major
metabolic pathways are downregulated, resulting in ‘immunometabolic paralysis’.
Interestingly, when tolerant monocytes of sepsis patients were treated with IFNγ,
the metabolic paralytic state could be partially abrogated, which also resulted in
increased cytokine production. This, hence, shows that restoring the metabolic
state of a cell could also restore its functional effects. This observation creates new
therapeutic options, and opens the way for metabolic modulators to enhance or
suppress metabolic pathways in certain diseases. Recently, we have for example
also shown that the epigenetic changes induced in immunotolerant monocytes can
be reversed by treating these cells with β-glucan (47).
To further extent trained immunity in other (disease) models, I investigated

262 |
 Discussion

the immunological and metabolic phenotype of tumor-associated macrophages

(TAMs) in a model of thyroid cancer in Chapter 11. Functional analysis of thyroid
cancer-induced TAMs show a pro-inflammatory phenotype, with increased cytokine
production upon stimulation. Transcriptional analysis of these TAMs also shows
major reprogramming at the level of metabolism. mTOR-induced glycolysis is
upregulated in TAMs, and is shown to be essential for the epigenetic reprogramming
that results in the pro-inflammatory phenotype of these cells. Inhibition of glycolysis
(and therefore the epigenetic reprogramming) of TAMs could therefore be envisaged
as a new therapeutic approach in thyroid cancer.
Finally, in Chapter 12 I summarize the findings of the chapters in this second
part of this thesis and give an overview of how glycolysis, glutaminolysis, cholesterol
metabolism and fumarate accumulation contribute to the induction of trained
immunity and the related pro-inflammatory phenotype.
In conclusion, boosting or inhibiting the innate immune system has several
potential beneficial effects in different medical settings and modulating cellular
metabolism of immune cells is a promising new approach to reach this goal.

FUTURE PERSPECTIVES
Immunometabolism is a field that has gained much interest the last several years,
and has been shown to be involved in immune activation in several diseases
such as infections, autoinflammatory disorders, and cardiovascular diseases (48-
50). Moreover, in post-sepsis immunoparalysis, we have shown that the cellular
metabolism of monocytes has broad defects and that reversing these defects
could at least partially restore the immunological function of these cells (44, 47,
51). Therefore, modulation of cellular metabolism has great potential as a therapy
in immune-mediated diseases. In autoinflammatory diseases, atherosclerosis or
insulin resistance and diabetes in which monocytes and macrophages are thought to
be skewed towards a pro-inflammatory profile, apart from modulating the epigenetic
changes induced, inhibition of certain metabolic pathways may represent a valid
approach to target disease activity (52). Moreover, the role played by cellular
metabolic pathways for the induction of trained immunity may also represent a
novel therapeutic approach in immunodeficiencies. Induction of metabolic pathways
important for trained immunity should be attempted to restore immune function
during sepsis-induced immunoparalysis. In addition, these approaches could also
be used to improve the immune responsiveness in vulnerable groups such as the 13
elderly and infants that have decreased immune function and that are more prone
to infections (53, 54).
However, apart from modulating immunometabolism, inducing trained immunity
itself could be a potential therapeutic target as well. It has for example already been

| 263
Chapter 13

shown that vaccination with BCG might reduce the risk of developing lymphoma
(55) or melanoma (56, 57) and BCG is used as immunostimulant in bladder cancer
treatment and experimentally as adjuvant in tumor vaccination models (58).
Furthermore, there are the observations in high-infectious disease burden countries
where BCG protects from other infectious diseases (1). It could therefore be argued
to reintroduce BCG in developed countries, because of its beneficial non-specific
effects. However, a recent trial in Denmark in over 4000 babies randomized to
receive either BCG or not, showed no differences on hospitalization. This could
of course be due to the low infectious disease burden and the relatively high
frequency of hospitalization due to other causes (59, 60), but it also shows that
reintroduction in Denmark does not have overall benefits. However, application in
determined high(er) risk groups could therefore be of use, as for example shown
in an Indonesian study where repeated BCG vaccination in elderly subjects (60-75
years) reduced upper respiratory tract infections (61). It has for example been shown
that topical therapy with BCG is very potent in the treatment of common and genital
warts (62-64). Also in a case report of diffuse cutaneous leishmaniasis, leishmania-
BCG combined vaccination initiated healing of all lesions (18), and in a randomized
controlled trial in localized cutaneous leishmaniasis it was shown to be as effective as
chemotherapy (65). Hence, in situations where the immune system cannot eliminate
chronic infection, induction of trained immunity, and therefore enhancing the immune
response, could be a potential treatment.
Apart from infectious diseases, induction of trained immunity could also be of use
in cancer treatment. Induction of trained immunity has for example been suggested
as a therapy in haematological malignancies (66), with a small study showing
beneficial effects of BCG on remission duration and survival after treatment of acute
myelogenous leukemia (67).
Another interesting hypothesis is the combination of checkpoint inhibitors in
cancer therapy and trained immunity. A combination of systemic anti-CTLA-4 and
intravesical BCG has been suggested in bladder cancer (68), but this could be
applicable to other tumors as well. Checkpoint inhibitors (e.g. anti-CTLA-4, or PD-1 or
PD-1L inhibitors) are antibodies that block inhibitory checkpoints and thereby restore
the immune defense against cancer cells. Hypothetically, if the blockade of inhibitory
checkpoints would be combined with the induction of trained immunity of the innate
immune system, this would results in an even more effective immune response
against the cancer. Moreover, BCG vaccination has been shown to enhance NK-cell
function, which could contribute to a more effective immune response as well (17).
However these hypotheses should be put into the context of chapter 11 were
we show that tumor-associated macrophages in thyroid cancer dysplay a trained
phenotype, and were actually the inhibition of trained immunity would be of benefit.

264 |
 Discussion

There are still several questions that remain to be answered regarding trained
immunity. A first question that needs to be addressed is how BCG vaccination can
result in the long-term effects on the innate immune system. Monocytes stay only
for a few days in the peripheral blood, whereas the pro-inflammatory ‘trained’ profile
of monocytes remains for at least 3 months in peripheral blood (14). This results
in the assumption that the progenitor cells of the myeloid lineage in bone marrow
are reprogrammed as well. Therefore, to test this hypothesis a trial with analysis
of bone marrow before and after BCG vaccination should be performed. Myeloid
precursors should be assessed for their functional profile, as well as epigenetic,
transcriptional, and metabolic analysis to determine their trained phenotype. Apart
from more knowledge on the mechanism how trained immunity preserves its effect,
such a study may contribute to development of additional therapeutic applications.
When BCG vaccination indeed results in trained bone marrow, this could be applied
in bone marrow transplantations, where a graft versus tumor effect is essential.
A second question that needs to be addressed in future studies is the differential
effect of BCG in separate volunteers in the vaccination studies. In some volunteers
trained immunity is clearly induced with higher cytokine responses to non-related
pathogens, whereas in others there is hardly an induction. Mutations or variations
in the NOD2 receptor, autophagy (ATG2b), or glycolysis enzymes (14, 69, 70) have
been shown to be of influence, but this does not explain all observed variance.
Hence, to determine important pathways and molecular mechanisms in trained
immunity a cohort study should be performed with sufficient power to perform genetic
variants analysis in BCG-vaccinated individuals. This will lead to genetic variations
that influence the induction of trained immunity by BCG; subsequently these should
be tested in functional experiments. Also this study could lead to direct clinical
applications. If certain genetic variants are determined, these should be tested in
bladder cancer patients that are being treated with BCG installations, just as was
done for the ATG2b variant (69).
Finally, the induction of trained immunity in vivo should be optimized. Now the
only way to induce trained immunity in humans is BCG vaccination. This comes
with disadvantages, as the respons differs greatly between subjects, proper
administration of the vaccine needs experience, and repeated administrations are
not always possible due to severe local reactions. In the recent years intravenous
administration of β-glucan has been developed as a potential novel cancer treatment
(71). It is likely that such administarion of β-glucan is more effective and can be 13
better regulated to induce trained immunity. Also with MDP (the causative componant
of BCG) a comparable approach could be attempted. And specific direction to the
myeloid cell line or bone marrow could even more increase effectiveness.

| 265
Chapter 13

In conclusion, in this thesis I have shown that BCG and β-glucan can induce trained
immunity in human monocytes and macrophages, resulting in a pro-inflammatory
phenotype. Trained immunity can have an impact on infections in humans, as shown
by the reduction of yellow fever vaccine viraemia. This process is epigenetically
mediated. Furthermore, changes in cellular metabolism are essential for the induction
of trained immunity, with glycolysis, glutaminolysis and cholesterol synthesis as
important pathways involved. Interestingly, this is not only true for the induction of
trained immunity by BCG or β-glucan, but also for tumor-associated macrophages
that show a pro-inflammatory phenotype. Also in immune tolerant monocytes from
sepsis patients a clear modulation in metabolism is seen. Overall, this demonstrates
that immune-metabolic pathways regulate the induction of innate immune memory.

REFERENCES
1. Aaby P, Kollmann TR, Benn CS. Nonspecific effects
of neonatal and infant vaccination: public-health,
immunological and conceptual challenges. Nature
immunology. 2014;15(10):895-9.
2. Gil A, Kenney LL, Mishra R, Watkin LB, Aslan N,
Selin LK. Vaccination and heterologous immunity:
educating the immune system. Transactions of the
Royal Society of Tropical Medicine and Hygiene.
2015;109(1):62-9.
3. Mathurin KS, Martens GW, Kornfeld H, Welsh RM.
CD4 T-cell-mediated heterologous immunity between
mycobacteria and poxviruses. Journal of virology.
2009;83(8):3528-39.
4. Lertmemongkolchai G, Cai G, Hunter CA, Bancroft
GJ. Bystander activation of CD8+ T cells contributes
to the rapid production of IFN-gamma in response to
bacterial pathogens. J Immunol. 2001;166(2):1097-
105.
5. Berg RE, Cordes CJ, Forman J. Contribution of CD8+
T cells to innate immunity: IFN-gamma secretion
induced by IL-12 and IL-18. European journal of
immunology. 2002;32(10):2807-16.
6. Berg RE, Crossley E, Murray S, Forman J. Memory
CD8+ T cells provide innate immune protection
against Listeria monocytogenes in the absence
of cognate antigen. The Journal of experimental
medicine. 2003;198(10):1583-93.
7. Hashiguchi T, Oyamada A, Sakuraba K, Shimoda
K, Nakayama KI, Iwamoto Y, et al. Tyk2-dependent
bystander activation of conventional and
nonconventional Th1 cell subsets contributes to
innate host defense against Listeria monocytogenes
infection. J Immunol. 2014;192(10):4739-47.
8. Hu J, August A. Naive and innate memory
phenotype CD4+ T cells have different requirements
for active Itk for their development. J Immunol.
2008;180(10):6544-52.
9. Sanger C, Busche A, Bentien G, Spallek R, Jonas
F, Bohle A, et al. Immunodominant PstS1 antigen
of mycobacterium tuberculosis is a potent biological
response modifier for the treatment of bladder
cancer. BMC cancer. 2004;4:86.
10. Ota MOC VJ, Schlegel-Haueter SE, Fielding K,
Sanneh M, Kidd M, Newport MJ, Aaby P, Whittle
H, Lambert PH, McAdam KPWJ, Siegrist CA,
Marchant A. Influence of Mycobacterium bovis
Bacillus Calmette-Guerin on Antibody and Cytokine
Responses to Human Neonatal Vaccination. The
Journal of Immunology. 2002(168).
11. Ritz N, Mui M, Balloch A, Curtis N. Non-specific
effect of Bacille Calmette-Guerin vaccine on the
immune response to routine immunisations. Vaccine.
2013;31(30):3098-103.
12. van ‘t Wout JW, Poell R, van Furth R. The role of
BCG/PPD-activated macrophages in resistance
against systemic candidiasis in mice. Scandinavian
journal of immunology. 1992;36(5):713-9.
13. Yang H TW. Nonspecific cytotoxicity of vaccinia-
induced peritoneal exudates in hamsters is mediated
by Thy1.2 homologue-positive cells distinct from
NK cells and macrophages. Journal of Immunology.
1983;131(5):2545-50.
14. Kleinnijenhuis J, Quintin J, Preijers F, Joosten LA,
Ifrim DC, Saeed S, et al. Bacille Calmette-Guerin
induces NOD2-dependent nonspecific protection
from reinfection via epigenetic reprogramming of
monocytes. Proceedings of the National Academy
of Sciences of the United States of America.
2012;109(43):17537-42.
15. Maddison SE, Chandler FW, McDougal JS,
Slemenda SB, Kagan IG. Schistosoma mansoni
infection in intact and B cell deficient mice: the effect
of pretreatment with BCG in these experimental
models. The American journal of tropical medicine
and hygiene. 1978;27(5):966-75.
16. Ikeda S, Negishi T, Nishimura C. Enhancement
of non-specific resistance to viral infection by
muramyldipeptide and its analogs. Antiviral research.
1985;5(4):207-15.
17. Kleinnijenhuis J, Quintin J, Preijers F, Joosten LA,
Jacobs C, Xavier RJ, et al. BCG-induced trained
immunity in NK cells: Role for non-specific protection
to infection. Clin Immunol. 2014;155(2):213-9.
18. Pereira LI, Dorta ML, Pereira AJ, Bastos RP,
Oliveira MA, Pinto SA, et al. Increase of NK cells
and proinflammatory monocytes are associated
with the clinical improvement of diffuse cutaneous
leishmaniasis after immunochemotherapy with
BCG/Leishmania antigens. The American journal of
tropical medicine and hygiene. 2009;81(3):378-83.
19. Semple PL, Watkins M, Davids V, Krensky AM,
Hanekom WA, Kaplan G, et al. Induction of granulysin
and perforin cytolytic mediator expression in 10-week-
old infants vaccinated with BCG at birth. Clinical &
developmental immunology. 2011;2011:438463.
20. Suriano F, Santini D, Perrone G, Amato M, Vincenzi
B, Tonini G, et al. Tumor associated macrophages
polarization dictates the efficacy of BCG instillation
in non-muscle invasive urothelial bladder cancer.
Journal of experimental & clinical cancer research :
CR. 2013;32:87.
21. Alam MJ, Rashid MM, Kabir Y, Raqib R, Ahmad SM.
On birth single dose live attenuated OPV and BCG
vaccination induces gut cathelicidin LL37 responses
at 6 week of age: a natural experiment. Vaccine.
2015;33(1):18-21.
22. Jensen KJ, Larsen N, Biering-Sorensen S, Andersen
A, Eriksen HB, Monteiro I, et al. Heterologous
Immunological Effects of Early BCG Vaccination
in Low-Birth-Weight Infants in Guinea-Bissau:
A Randomized-controlled Trial. The Journal of
infectious diseases. 2014.
23. Leentjens J, Kox M, Stokman R, Gerretsen J,
Diavatopoulos DA, van Crevel R, et al. BCG

266 |

Vaccination Enhances the Immunogenicity of
Subsequent Influenza Vaccination in Healthy
Volunteers: A Randomized, Placebo-Controlled
Pilot Study. The Journal of infectious diseases.
2015;212(12):1930-8.
24. Andersen A, Roth A, Jensen KJ, Erikstrup C, Lisse
IM, Whittle H, et al. The immunological effect of
revaccination with Bacille Calmette-Guerin vaccine
at 19 months of age. Vaccine. 2013;31(17):2137-44.
25. Ho P, Wei X, Seah GT. Regulatory T cells induced
by Mycobacterium chelonae sensitization influence
murine responses to bacille Calmette-Guerin. Journal
of leukocyte biology. 2010;88(6):1073-80.
26. Mayo-Wilson E, Imdad A, Herzer K, Yakoob MY,
Bhutta ZA. Vitamin A supplements for preventing
mortality, illness, and blindness in children aged
under 5: systematic review and meta-analysis. Bmj.
2011;343:d5094.
27. Benn CS, Aaby P, Nielsen J, Binka FN, Ross DA.
Does vitamin A supplementation interact with routine
vaccinations? An analysis of the Ghana Vitamin
A Supplementation Trial. The American journal of
clinical nutrition. 2009;90(3):629-39.
28. Benn CS, Rodrigues A, Yazdanbakhsh M, Fisker
AB, Ravn H, Whittle H, et al. The effect of high-dose
vitamin A supplementation administered with BCG
vaccine at birth may be modified by subsequent DTP
vaccination. Vaccine. 2009;27(21):2891-8.
29. Shann F. Nonspecific effects of vaccines and the
reduction of mortality in children. Clinical therapeutics.
2013;35(2):109-14.
30. Ganeshan K, Chawla A. Metabolic regulation
of immune responses. Annu Rev Immunol.
2014;32:609-34.
31. Wang R, Dillon CP, Shi LZ, Milasta S, Carter
R, Finkelstein D, et al. The transcription factor
Myc controls metabolic reprogramming upon T
lymphocyte activation. Immunity. 2011;35(6):871-82.
32. Donnelly RP, Finlay DK. Glucose, glycolysis and
lymphocyte responses. Molecular immunology. 2015.
33. van der Windt GJ, O’Sullivan D, Everts B, Huang SC,
Buck MD, Curtis JD, et al. CD8 memory T cells have
a bioenergetic advantage that underlies their rapid
recall ability. Proceedings of the National Academy
of Sciences of the United States of America.
2013;110(35):14336-41.
34. Michalek RD, Gerriets VA, Jacobs SR, Macintyre AN,
MacIver NJ, Mason EF, et al. Cutting edge: distinct
glycolytic and lipid oxidative metabolic programs
are essential for effector and regulatory CD4+ T cell
subsets. Journal of immunology. 2011;186(6):3299-
303.
35. Loftus RM, Finlay DK. Immunometabolism; cellular
metabolism turns immune regulator. The Journal of
biological chemistry. 2015.
36. Gerriets VA, Rathmell JC. Metabolic pathways in
T cell fate and function. Trends in immunology.
2012;33(4):168-73.
37. Tannahill GM, Curtis AM, Adamik J, Palsson-
McDermott EM, McGettrick AF, Goel G, et
al. Succinate is an inflammatory signal that
induces IL-1beta through HIF-1alpha. Nature.
2013;496(7444):238-42.
38. Jha AK, Huang SC, Sergushichev A, Lampropoulou
V, Ivanova Y, Loginicheva E, et al. Network integration
of parallel metabolic and transcriptional data reveals
metabolic modules that regulate macrophage
polarization. Immunity. 2015;42(3):419-30.
39. Hu X, Liu G, Hou Y, Shi J, Zhu L, Jin D, et al.
Induction of M2-like macrophages in recipient NOD-
scid mice by allogeneic donor CD4(+)CD25(+)
regulatory T cells. Cellular & molecular immunology.
2012;9(6):464-72.
40. Van Dyken SJ, Locksley RM. Interleukin-4- and
interleukin-13-mediated alternatively activated
macrophages: roles in homeostasis and disease.
Annual review of immunology. 2013;31:317-43.
41. Odegaard JI, Chawla A. Alternative macrophage
activation and metabolism. Annual review of
pathology. 2011;6:275-97.
42. Donohoe DR, Bultman SJ. Metaboloepigenetics:
interrelationships between energy metabolism and
epigenetic control of gene expression. Journal of
cellular physiology. 2012;227(9):3169-77.
43. Hirschey MD, DeBerardinis RJ, Diehl AM, Drew JE,
Frezza C, Green MF, et al. Dysregulated metabolism
contributes to oncogenesis. Seminars in cancer
biology. 2015.
44. Cheng SC, Scicluna BP, Arts RJ, Gresnigt MS,
Lachmandas E, Giamarellos-Bourboulis EJ, et
al. Broad defects in the energy metabolism of
leukocytes underlie immunoparalysis in sepsis.
Discussion
Nature immunology. 2016;17(4):406-13.
45. Cheng SC, Quintin J, Cramer RA, Shepardson KM,
Saeed S, Kumar V, et al. mTOR- and HIF-1alpha-
mediated aerobic glycolysis as metabolic basis for
trained immunity. Science. 2014;345(6204):1250684.
46. Lu C, Ward PS, Kapoor GS, Rohle D, Turcan
S, Abdel-Wahab O, et al. IDH mutation impairs
histone demethylation and results in a block to cell
differentiation. Nature. 2012;483(7390):474-8.
47. Novakovic B, Habibi E, Wang SY, Arts RJ, Davar
R, Megchelenbrink W, et al. beta-Glucan Reverses
the Epigenetic State of LPS-Induced Immunological
Tolerance. Cell. 2016;167(5):1354-68 e14.
48. Palmer CS, Cherry CL, Sada-Ovalle I, Singh A,
Crowe SM. Glucose Metabolism in T Cells and
Monocytes: New Perspectives in HIV Pathogenesis.
EBioMedicine. 2016;6:31-41.
49. Shi L, Eugenin EA, Subbian S. Immunometabolism in
Tuberculosis. Front Immunol. 2016;7:150.
50. Christ A, Bekkering S, Latz E, Riksen NP. Long-
term activation of the innate immune system in
atherosclerosis. Semin Immunol. 2016.
51. Arts RJ, Gresnigt MS, Joosten LA, Netea MG.
Cellular metabolism of myeloid cells in sepsis.
Journal of leukocyte biology. 2016.
52. Netea MG, Joosten LA, Latz E, Mills KH, Natoli G,
Stunnenberg HG, et al. Trained immunity: A program
of innate immune memory in health and disease.
Science. 2016;352(6284):aaf1098.
53. Kollmann TR, Levy O, Montgomery RR, Goriely S.
Innate immune function by Toll-like receptors: distinct
responses in newborns and the elderly. Immunity.
2012;37(5):771-83.
54. Targonski PV, Jacobson RM, Poland GA.
Immunosenescence: role and measurement in
influenza vaccine response among the elderly.
Vaccine. 2007;25(16):3066-9.
55. Villumsen M, Sorup S, Jess T, Ravn H, Relander T,
Baker JL, et al. Risk of lymphoma and leukaemia
after bacille Calmette-Guerin and smallpox
vaccination: a Danish case-cohort study. Vaccine.
2009;27(49):6950-8.
56. Pfahlberg A, Kolmel KF, Grange JM, Mastrangelo G,
Krone B, Botev IN, et al. Inverse association between
melanoma and previous vaccinations against
tuberculosis and smallpox: results of the FEBIM
study. J Invest Dermatol. 2002;119(3):570-5.
57. Krone B, Kolmel KF, Grange JM. The biography of
the immune system and the control of cancer: from
St Peregrine to contemporary vaccination strategies.
BMC Cancer. 2014;14:595.
58. Mosolits S, Nilsson B, Mellstedt H. Towards
therapeutic vaccines for colorectal carcinoma:
a review of clinical trials. Expert Rev Vaccines.
2005;4(3):329-50.
59. Kjaergaard J, Birk NM, Nissen TN, Thostesen LM,
Pihl GT, Benn CS, et al. Nonspecific effect of BCG
vaccination at birth on early childhood infections: a
randomized, clinical multicenter trial. Pediatr Res.
2016;80(5):681-5.
60. Stensballe LG, Sorup S, Aaby P, Benn CS, Greisen
G, Jeppesen DL, et al. BCG vaccination at birth and
early childhood hospitalisation: a randomised clinical
multicentre trial. Arch Dis Child. 2016.
61. Wardhana, Datau EA, Sultana A, Mandang VV,
Jim E. The efficacy of Bacillus Calmette-Guerin
vaccinations for the prevention of acute upper
respiratory tract infection in the elderly. Acta Med
Indones. 2011;43(3):185-90.
62. Salem A, Nofal A, Hosny D. Treatment of common
and plane warts in children with topical viable
Bacillus Calmette-Guerin. Pediatric dermatology.
2013;30(1):60-3.
63. Metawea B, El-Nashar AR, Kamel I, Kassem W,
Shamloul R. Application of viable bacille Calmette-
Guerin topically as a potential therapeutic modality in
condylomata acuminata: a placebo-controlled study.
Urology. 2005;65(2):247-50.
64. Nofal A, Yosef A, Salah E. Treatment of recalcitrant
warts with Bacillus Calmette-Guerin: a promising new
65.
approach. Dermatologic therapy. 2013;26(6):481-5.
Convit J, Castellanos PL, Rondon A, Pinardi ME,
Ulrich M, Castes M, et al. Immunotherapy versus
13
chemotherapy in localised cutaneous leishmaniasis.
Lancet. 1987;1(8530):401-5.
66. Stevens WB, Netea MG, Kater AP, van der Velden
WJ. ‘Trained immunity’: consequences for lymphoid
malignancies. Haematologica. 2016;101(12):1460-8.
67. Omura GA, Vogler WR, Lefante J, Silberman H,
Knospe W, Gordon D, et al. Treatment of acute
myelogenous leukemia: influence of three induction
regimens and maintenance with chemotherapy or
| 267
Chapter 13
BCG immunotherapy. Cancer. 1982;49(8):1530-6. 70.
68. Fahmy O, Khairul-Asri MG, Stenzl A, Gakis G.
Systemic anti-CTLA-4 and intravesical Bacille-
Calmette-Guerin therapy in non-muscle invasive
bladder cancer: Is there a rationale of synergism? 71.
Med Hypotheses. 2016;92:57-8.
69. Buffen K, Oosting M, Quintin J, Ng A, Kleinnijenhuis
J, Kumar V, et al. Autophagy controls BCG-induced
trained immunity and the response to intravesical
BCG therapy for bladder cancer. PLoS Pathog.
2014;10(10):e1004485.
268 |
Arts RJ, Carvalho A, La Rocca C, Palma C,
Rodrigues F, Silvestre R, et al. Immunometabolic
Pathways in BCG-Induced Trained Immunity. Cell
Rep. 2016;17(10):2562-71.
Halstenson C, Shamp T, Gargano M, Walsh
R, Patchen M. Two randomized, double-blind,
placebo-controlled, dose-escalation phase 1 studies
evaluating BTH1677, a 1,3-1,6 beta glucan pathogen
associated molecular pattern, in healthy volunteer
subjects. Invest New Drugs. 2016;34(2):202-15.
Discussion

13

| 269
 Chapter 14

Nederlandse samenvatting
Chapter 14

Trained immunity, ofwel het geheugen van het aangeboren immuunsysteem, is

het onderwerp van dit proefschrift. Voorheen werd gedacht dat de cellen van het
aangeboren immuunsysteem (wij onderzochten specifiek monocyten en macrofagen)
geen geheugen hebben en niet sterker kunnen worden. De afgelopen jaren is echter
duidelijk geworden dat dit niet waar is en dat deze cellen wel degelijk effectiever
kunnen worden middels een mechanisme dat we trained immunity hebben gedoopt.
Trained immunity heeft de laatste jaren steeds meer aandacht gekregen. Dit heeft
er met name mee te maken dat de toepassingen en gevolgen verder reiken dan in
eerste instantie werd verwacht.
In mijn proefschrift bespreek ik twee onderwerpen. In het eerste deel beschrijf
ik de niet-specifieke effecten van het BCG-vaccin. Het BCG-vaccin is gemaakt om
tegen tuberculose te beschermen, maar gebleken is dat het naast dit specifieke
effect, ook voordelige niet-specifieke effecten heeft. BCG beschermt ook tegen
andere infectieziekten die niet aan tuberculose verwant zijn, een effect dat deels
toegeschreven kan worden aan trained immunity. In dit deel van het proefschrift
beschrijf ik de onderliggende moleculaire mechanismen voor BCG-geïnduceerde
trained immunity en onderzoek ik of we het beïnvloeden van het aangeboren
immuunsysteem ook toe kunnen passen bij patiënten met een immuunstoornis, bij
de behandeling van infectieziekten, of voor het verbeteren van vaccinaties. In het
tweede deel van mijn proefschrift focus ik vooral op de metabole veranderingen
die in de cellen optreden tijdens het induceren van trained immunity. Het is bekend
dat metabole veranderingen (op welke manier de cel aan zijn energie komt)
samenhangen met de functie van een cel. Hier laat ik zien dat dat ook geldt voor
getrainde macrofagen. Dit geeft een belangrijk inzicht voor potentiële nieuwe
behandelingsstrategieën voor immunologische ziekten.

BCG en trained immunity

De hypothese dat BCG ook niet-specifieke beschermende effecten heeft, kwam
voort uit de observatie dat vaccinatie van baby’s in ontwikkelingslanden met een
hoge infectieziektedruk resulteerde in lagere sterfte door andere infectieziekten
dan tuberculose. Dit laat zien dat er dus een niet-specifiek geheugen binnen het
immuunsysteem bestaat. Dit niet-specifieke geheugen kan hypothetisch gezien
het gevolg zijn van twee mechanismen. Enerzijds trained immunity die plaatsvindt
binnen het aangeboren immuunsysteem, of anderzijds heterologe immuniteit
die een gevolg is van kruisreactiviteit van T-lymfocyten, dus via het verworven
immuunsysteem. In dit proefschrift zal ik met name ingaan op de effecten op het
aangeboren immuunsysteem, dus trained immunity.
In een eerste vaccinatietrial met gezonde vrijwilligers werd aangetoond dat
BCG-vaccinatie leidt tot een hogere cytokineproductie (signaalstoffen) wanneer

272 |
 Nederlandse Samenvatting

witte bloedcellen van deze vrijwilligers in het laboratorium werden gestimuleerd met
verschillende ziekteverwekkers. Daarnaast werd er aangetoond dat er epigenetische
veranderingen plaatsvonden in cellen van het aangeboren immuunsysteem; dit zijn
veranderingen in de manier waarop het DNA verpakt is. Hierdoor worden delen van
het DNA beter of juist slechter bereikbaar, maar wordt de DNA-sequentie zelf niet
aangepast. Dit was een belangrijke bevinding die aantoonde hoe de niet-specifieke
effecten van BCG zouden kunnen werken.
Op deze bevindingen heb ik voortgebouwd in dit eerste deel van mijn proefschrift.
In hoofdstuk 2 en 3 bekijk ik of we deze effecten van BCG-vaccinatie toe kunnen
passen bij patiënten met een immuunstoornis. Bij patiënten met een verzwakt
immuunsysteem zou het nuttig kunnen zijn om het aangeboren immuunsysteem
te trainen middels een BCG-vaccinatie en het daardoor effectiever te maken. Het
probleem is echter dat het BCG-vaccin levende bacteriën bevat en daarom niet
aan patiënten met een verzwakt immuunsysteem toegediend kan worden, daar dit
in een gevaarlijke infectie zou kunnen resulteren. Derhalve hebben we het BCG-
vaccin bestraald, zodat alle bacteriën dood waren. Dit bestraalde vaccin hebben we
vervolgens getest op de potentie om trained immunity te induceren. In hoofdstuk
2 deden we dit allereerst in het laboratorium en lieten we zien dat monocyten en
macrofagen inderdaad getraind konden worden met het bestraalde vaccin en dat dat
tot dezelfde epigenetische veranderingen leidde. Vervolgens hebben we gezonde
proefpersonen met dit vaccin gevaccineerd om te onderzoeken of hetzelfde in de
mens gebeurde. Helaas bleek dat niet het geval te zijn. Tegelijkertijd werd er een
tweede trial verricht waarin gezonde proefpersonen met het bestraalde vaccin werden
gevaccineerd en een week later een experimentele bloedvergiftiging ondergingen
op de intensive care. Ook in deze trial werd aangetoond dat vaccinatie met dit vaccin
geen effect had op de reactie van het aangeboren immuunsysteem. Daarmee is
dus aangetoond dat voor het beïnvloeden van het aangeboren immuunsysteem het
levende BCG-vaccin nodig is.
In hoofdstuk 4 bekijk ik een andere klinisch belangrijke vraag naar de effectiviteit
van het BCG-vaccin. De Wereld Gezondheidsorganisatie (WHO) adviseert een hoge
dosis vitamine A-supplementen in landen waar het risico op een vitamine A-tekort
hoog is. Er zijn echter studies die laten zien dat deze supplementen ook een effect
hebben op de niet-specifieke effecten van vaccins en dat het supplement mogelijk
zelf ook niet-specifieke effecten heeft. In dit hoofdstuk laat ik zien dat als ik in het
laboratorium monocyten blootstel aan vitamine A de effectiviteit van deze cellen
langdurig afneemt. Als ze bijvoorbeeld een week later worden gestimuleerd, maken
ze veel minder cytokines. Dit is het gevolg van epigenetische veranderingen die
door vitamine A worden veroorzaakt. Naast dit effect van vitamine A zelf, laat ik zien 14
dat vitamine A de training van BCG remt en dat daardoor het positieve effect van

| 273
Chapter 14

BCG wordt tenietgedaan. Dit geeft ons dus belangrijke informatie over de potentiële
langdurige effecten van vitamine A; iets dat ook getest zou moeten worden in
kinderen die vitamine A-suppletie krijgen.
De studies in de vorige hoofdstukken geven ons interessante en belangrijke
inzichten in het moleculaire mechanisme van BCG-geïnduceerde trained immunity,
maar ze laten nog geen direct bewijs zien dat de training van het aangeboren
immuunsysteem gelinkt kan worden aan de lagere sterfte door andere infectieziekten,
zoals wordt gezien in de observationele studies. Daarom hebben we een trial met
gezonde proefpersonen opgezet om deze hypothese te testen. In hoofdstuk 5
maken we gebruik van het gelekoortsvaccin, omdat dit na vaccinatie een kleine
infectie geeft met dit virus en daarom als een model voor een virale infectieziekte
beschouwd kan worden. In dit hoofdstuk laat ik zien dat het immuunsysteem van
gezonde vrijwilligers die met BCG zijn gevaccineerd inderdaad beter reageert op
het gelekoortvirus en dat deze proefpersonen een kleinere hoeveelheid virus in hun
bloed hebben. Daarnaast laat ik zien dat hoe beter het aangeboren immuunsysteem
getraind is door BCG, hoe lager de hoeveelheid gelekoortsvirus in het bloed.
Daarmee laten we dus zien dat er een directe link is tussen trained immunity en hoe
het lichaam op een infectieziekte reageert.
In hoofdstuk 6 geef ik tot slot een overzicht van alle vaccins en hun potentiële
niet-specifieke effecten. Voor de meeste vaccins zijn er aanwijzingen dat zij meer
teweegbrengen dan enkel bescherming tegen de ziekte waarvoor zij toegediend
worden. Voor een aantal vaccins bestaat er ook bewijs dat deze extra bescherming
ten minste partieel door het aangeboren immuunsysteem veroorzaakt zou kunnen
worden. Een belangrijke conclusie die in dit hoofdstuk wordt getrokken, is dat er te
weinig onderzoek gedaan wordt naar de niet-specifieke effecten van vaccins en via
welke mechanismen zij werken. Aangezien deze niet-specifieke effecten belangrijke
gevolgen teweeg kunnen brengen, zowel positief als negatief, is meer kennis
essentieel. Daarbij dient opgemerkt te worden dat ook bij het ontwikkelen van nieuwe
vaccins, of het vervangen of verwijderen van vaccins uit het vaccinatieschema
rekening gehouden dient te worden met de niet-specifieke effecten.

Immunometabolisme in trained immunity

De laatste jaren is steeds meer duidelijk geworden dat immunometabolisme (hoe komt
een witte bloedcel aan zijn energie en welke voedingsstoffen gebruikt hij hiervoor)
essentieel is voor de functie van een witte bloedcel. Bij cellen van het verworven
immuunsysteem, bijvoorbeeld T-lymfocyten, is de laatste jaren duidelijk geworden
dat geactiveerde cellen veel glucose gebruiken en lactaat (melkzuur) produceren,
en veel meer zuurstof nodig hebben dan rustende cellen. Geheugen T-cellen
daarentegen gebruiken juist meer vetzuren om aan hun energie te komen. Ook

274 |
 Nederlandse Samenvatting

voor macrofagen is onlangs aangetoond dat inflammatoire macrofagen veel glucose

consumeren en veel lactaat produceren, terwijl anti-inflammatoire macrofagen dit
veel minder doen en juist zuurstof gebruiken om de kleinere hoeveelheid glucose die
zij opnemen efficiënter te verwerken.
Al met al is het dus erg waarschijnlijk dat veranderingen in metabolisme van
monocyten en macrofagen een rol zouden kunnen spelen in de inductie van trained
immunity. Deze informatie is belangrijk, omdat het remmen of juist stimuleren van
bepaalde metabole veranderingen trained immunity zou kunnen remmen of juist zou
kunnen stimuleren. Op deze manier zouden we dus in bepaalde ziekteprocessen
kunnen interveniëren.
In hoofdstuk 7 bekijk ik daartoe allereerst de rol van het glucose- en
glutaminemetabolisme in BCG-geïnduceerde trained immunity. Ik laat zien dat
BCG-getrainde macrofagen inderdaad meer glucose gebruiken en meer lactaat
produceren. Dit geldt zowel voor getrainde macrofagen in het laboratorium, als voor
monocyten van BCG-gevaccineerde gezonde vrijwilligers. Deze veranderingen
in het metabolisme van de getrainde cellen zijn het gevolg van epigenetische
veranderingen. Daarnaast laat ik zien dat de epigenetische veranderingen die door
BCG geïnduceerd worden afhankelijk zijn van de metabole veranderingen. Dit toont
aan dat er een complexe interactie is tussen de epigenetische en de metabole
veranderingen.
In hoofdstuk 8 maak ik gebruik van β-glucan; dit is een component van de Candida
albicans (een schimmel) celwand die ook trained immunity induceert. Voor β-glucan-
geïnduceerde trained immunity is reeds eerder aangetoond dat het glucoseverbruik
toeneemt en dat er meer lactaat geproduceerd wordt. In dit hoofdstuk laat ik zien
dat ook het metabolisme van glutamine en cholesterol belangrijk zijn. Daarnaast
vindt er accumulatie van fumaraat (een metaboliet uit de citroenzuurcyclus) plaats.
Opmerkenswaardig: als monocyten aan fumaraat worden blootgesteld, wordt er
ook trained immunity geïnduceerd. Bovendien overlapt het epigenetische profiel dat
door fumaraat wordt geïnduceerd met het profiel van β-glucan (alhoewel β-glucan
meer veranderingen teweegbrengt). Dit toont aan dat fumaraataccumulatie voor een
deel een rol speelt in de inductie van trained immunity door β-glucan.
In hoofdstuk 9 wordt ingegaan op de tweede metabole verandering die in
het vorige hoofdstuk wordt beschreven, het cholesterolmetabolisme. Ik laat zien
dat een toename van cholesterolmetabolisme essentieel is voor de inductie van
trained immunity door β-glucan. Ook in dit hoofdstuk gaan we op zoek naar een
metaboliet uit het cholesterolmetabolisme dat een centrale rol speelt in de inductie
van trained immunity. Dit blijkt mevalonaat te zijn. Stimulatie van monocyten met
enkel mevalonaat induceert ook een trained immunity-fenotype met epigenetische 14
veranderingen, die opnieuw deels overlappen met die in β-glucan-geïnduceerde

| 275
Chapter 14

trained immunity. In dit hoofdstuk maken we ook een belangrijke stap naar de kliniek.
Bij patiënten met het hyper IgD-syndroom (HIDS) zou namelijk trained immunity
een verklaring kunnen zijn voor hun ziektebeeld. HIDS is een aandoening waarbij
er door een genetische mutatie accumulatie van mevalonaat in cellen plaatsvindt.
Deze toename van mevalonaat zou daardoor trained immunity kunnen induceren
hetgeen ervoor kan zorgen dat de monocyten van deze patiënten te heftig reageren
op prikkels. Analyse van monocyten van HIDS-patiënten laat inderdaad zien dat
er overeenkomsten zijn met getrainde monocyten in het laboratorium. Dit biedt
perspectieven voor nieuwe behandelmethoden.
In hoofdstuk 10 gaan we in op immunotolerantie. Dit is een functionele
status van monocyten die als de tegenovergestelde status van trained immunity
beschouwd kan worden. Immunotolerante monocyten zijn namelijk minder effectief
en immunotolerantie gaat gepaard met een hogere mortaliteit door infectieziekten.
Dit geldt bijvoorbeeld voor patiënten na een bloedvergiftiging. Bovendien wordt
immunotolerantie net als trained immunity gemedieerd door epigenetische
veranderingen. Om die reden hadden wij de hypothese dat metabole veranderingen
ook een rol zouden kunnen spelen in immunotolerantie. In dit hoofdstuk analyseren
we daarom monocyten en macrofagen die in het laboratorium immunotolerant zijn
gemaakt, en we analyseren ook monocyten van patiënten met een bloedvergiftiging.
We laten zien dat cellen in de immunotolerante status een te traag werkend
metabolisme hebben, waarbij geen enkele van de metabolieten die potentieel voor
energie kan zorgen gebruikt wordt. Wij denken dat hierdoor de cel niet goed kan
functioneren. Het activeren van het cellulair metabolisme zou daarom een goede
therapeutische ingreep kunnen zijn. Wij hebben derhalve gepoogd met IFNγ het
glucosemetabolisme weer te activeren. Dit lukte zowel in het laboratorium als in
patiënten, waarbij ook de mogelijkheid van deze cellen om cytokines te produceren
toenam. Dit geeft dus aan dat modulatie van metabolisme inderdaad als therapie
gebruikt zou kunnen worden.
In hoofdstuk 11 maken we een stap naar een ander ziektebeeld,
namelijk schildklierkanker. Ik bekijk welke veranderingen macrofagen in
schildklierkankerweefsel ondergaan. We laten in dit hoofdstuk zien dat deze
macrofagen, ook wel tumor-geassocieerde macrofagen (TAMs) genoemd, een
trained immunity-profiel aannemen. Zij produceren namelijk meer cytokines, er
is een toename in glucosemetabolisme, zij produceren meer lactaat en dit alles
wordt gemedieerd door epigenetische veranderingen. Aangezien meer TAMs in
het tumorweefsel geassocieerd is met een slechtere prognose, zou remming van
trained immunity (bijvoorbeeld door remming van het glucosemetabolisme) een
interessante nieuwe therapeutische methode kunnen zijn.
In hoofdstuk 12 vat ik tot slot de metabole veranderingen die een rol spelen in

276 |
 Nederlandse Samenvatting

trained immunity samen en geeft ik een overzicht van hoe glucose, glutamine en
cholesterol metabolisme een rol spelen in de inductie van trained immunity.
Concluderend, ik heb laten zien dat immunometabolisme een rol speelt in trained
immunity en daarmee dus belangrijk zou kunnen zijn in verschillende ziektebeelden
als infectieziekten, auto-inflammatoire aandoeningen, cardiovasculaire ziekten, of
kanker. Daarnaast heb ik laten zien dat ook in immunotolerantie, na bijvoorbeeld
een bloedvergiftiging, het cellulair metabolisme een belangrijk falend mechanisme
is. Dat maakt modulatie van het immunometabolisme en het moduleren van trained
immunity een potentieel belangrijke nieuwe therapie om in deze ziektebeelden te
interveniëren.

14

| 277
 Chapter 15

Epilogue

Acknowledgements, List of publications, Curriculum vitae

Chapter 15

Acknowledgements
Het is nog steeds niet zo goed te bevatten, maar het is daadwerkelijk zo ver: mijn
promotietraject is ten einde gekomen. Het was een prachtige tijd waarin ik veel
heb geleerd, leuke ervaringen heb opgedaan en geweldige mensen heb mogen
ontmoeten. Al met al een tijd die me nog lang bij zal blijven. Graag wil ik iedereen
bedanken die hieraan heeft bijgedragen.

Allereerst wil ik mijn promotores bedanken. Prof.dr. Netea, beste Mihai, ik ben heel
erg blij dat ik je tijdens mijn bachelor ben tegengekomen en dat je mij in de loop der
jaren zoveel kansen hebt geboden. Het is geweldig om met je samen te werken.
Het is ongelofelijk hoe snel je hypotheses weet te genereren en uit een brij van data
de meest relevante informatie weet te onttrekken. Je hebt me enorm geïnspireerd.
Prof.dr. Van Crevel, beste Reinout, discussies met jou waren altijd interessant. Je
weet tot de kern van het probleem door te dringen door het stellen van de juiste
vragen en je weet als geen ander mijn gedachten de juiste richting in te duwen als ik
afdwaal. Het bespreken van data met jou wierp altijd zijn vruchten af. Fietsen met jou
daarentegen heb ik na een keer niet meer aangedurfd. Prof.dr. Joosten, beste Leo,
bij jou kun je altijd binnenlopen met een vraag of een probleem. Je bent bereid om
mee te denken en draagt goede oplossingen aan. Voor een gezellig gesprek staat je
deur ook altijd open. Dank daarvoor.
Het dagelijks werk in het lab was nooit zo leuk geweest zonder alle geweldige
collega’s! Het was altijd een plezier om het lab op te lopen. James, I would like to start
with thanking you. I am still grateful for your crash course lab techniques that thought
me everything I had to know before starting my PhD. Bas, BCG-mattie van het eerste
uur, dank je voor de goede discussies en de vele leuke reizen die we samen gemaakt
hebben. Siroon, onze gesprekken in de DNA-ruimte waren altijd verhelderend, in
meerdere opzichten. Charlotte, Simone en Jelmer, het was geweldig om nog even
met jullie te hebben mogen samenwerken. Keep the BCG-spirit alive! Anneke, Cor,
Helga, Heidi, Ineke, Kiki, Liesbeth en Trees dank voor al jullie hulp en tips in het lab,
en eveneens voor alle goede filmsuggesties. Ajeng, Anca, Andreea, Anna G, Anne
A, Anne J, Arjan, Bas H, Berenice, Charlotte, Daniella, Dayanira, Duby, Ekta, Erik,
Evelien, Floor, Hanne, Hedwig, Hinta, Inge, Intan, Jaap, Jacqueline, Janna, Jessica
DS, Jessica Q, Johanneke, Jona, Jorge, Kathrin E, Kathrin T, Kathrin R, Katharina,
Khutso, Laszlo, Lily, Lisa, Maartje, Marije, Marika, Mariska, Mark G, Mark S, Marlies,
Martin, Megan, Michelle, Richard, Rinke, Rob, Ruud, Sam, Sanne, Tania, Thalijn,
Theo, Thijs, Valerie, Vera, Vesla, Viola, Wouter, and Yvette thanks a lot for the great
time that we had together, both inside and outside the lab!
Beste Romana, Jan en Theo, dank voor jullie hulp bij het TAMs paper en voor

280 |
 Epilogue

de mogelijkheden die jullie mij geboden hebben. Prof. van der Meer, dank voor de
goede inzichten en aanvullingen bij de link tussen HIDS en trained immunity; ik denk
dat we hier een geweldige stap voorwaarts hebben gemaakt. Frank, dank je voor
je enthousiasme, inzichten en je goede tips, zowel op wetenschappelijk vlak als
daarbuiten. Niels, het was geweldig hoe de mevalonaatdata samenkwamen. Dank
je voor alle hulp bij het samenstellen van het manuscript. Dear Charles, thanks for
the great conversations and your scientific guidance.
Dorien, Esther, Guus, Matthijs, Jelle G, Jelle Z, Jenneke, Linda, Peter, Rebecca,
lieve vrienden van de IC, wat was het geweldig om met jullie samen te werken!
Het denken in kansen en mogelijkheden in plaats van het zien van moeilijkheden
en beperkingen is een verademing. Dank voor jullie enthousiasme en de prettige
samenwerking die we bij vele projecten hebben gehad.
Floor, Geert, Hanneke, Ilse, Judith, Lindsey, Loes, Machteld, Michiel, Ramon,
Saskia, lieve Da Vinci’s, bedankt voor de goeie gesprekken, de wijze lessen en
de geweldig tijd die we samen hebben doorgebracht. Ellen, dankzij jouw netwerk,
je ideeën en je mensenkennis is het programma zo geslaagd. Bedankt voor alle
handvatten die je ons hebt weten te bieden.

I would also like to thank all our collaborators.

First of all to start with Boris. Without you this thesis would have had far fewer
nice colorful figures. I couldn’t have wished for a better epigenetics oracle. You
always came up with the right analysis approach and found a great way of displaying
our data. Thanks a lot for all your help! En ook Henk, bedankt voor je hulp en altijd
kritische blik. Onze samenwerking laat zien hoe basale wetenschap en kliniek elkaar
kunnen vinden, hoe ze elkaar horen aan te vullen, en wat voor prachtige vruchten dit
af kan werpen.
Agostinho, Fernando, Ricardo, Luís, Inês, Ana, and Cristina, thanks for your
observations on the first metabolism paper and your great help with the following
metabolism papers! Without your help the majority of the second part of this thesis
wouldn’t have been there. Dear Giuseppe, Carla, and Claudia, also your help has
been indispensible here.
Brendon and Tom, with our paper we have made an important new step in
understanding sepsis and its complications. Your knowledge and the amount of data
that you have gathered is incredible. Working together with you was a privilege.
Jori en Peter, bedankt voor de benodigde flexibiliteit bij de experimenten die we
samen hebben uitgevoerd. Ook al konden de experimenten niet gepland worden
en leidde dit soms tot last minute beslissingen, de data mogen er zijn en waren
essentieel voor ons paper.
Sander, Thomas, and Joachim, the amount of data that you have generated for

| 281 15
Chapter 15

our TAMs paper is incredible, but the way how you made these data easy to interpret
is even more impressive.
Dear Christine and Peter, meetings with you are always so inspiring. Especially
during the Optimmunize meetings you can see the power of collaborations and
bringing people with different background together. Ane, Annemette, Andreas,
Kristina, Kristoffer, Marianne, Olga, Sanne, Stine, and Thomas, thanks for the great
times in Copenhagen, Bissau, and Accra, you are the best! And Fred and Kristian,
thanks for showing us around in Bissau. Thanks to the two of you the experience
became ever more awesome.

Frank, Joris en Yvonne, lieve broertjes en zusje wat fijn dat jullie er altijd zijn. Pap en
mam, dank je voor jullie onvoorwaardelijke steun. Dankzij jullie ben ik geworden wie
ik nu ben. Ik hou van jullie.

282 |
Epilogue

| 283 15
Chapter 15

List of publications
Papers
Munoz MA, Jurczyluk J, Mehr S, Chai RC, Arts RJW, Sheu A, et al. Defective
protein prenylation is a diagnostic biomarker of mevalonate kinase deficiency. J
Allergy Clin Immunol. 2017;S0091-6749(17)30513-4.
Arts RJ, Gresnigt MS, Joosten LA, Netea MG. Cellular metabolism of myeloid
cells in sepsis. J Leukoc Biol. 2017;101(1):151-64.
Arts RJ*, Plantinga TS*, Tuit S, Ulas T, Heinhuis B, Tesselaar M, et al.
Transcriptional and metabolic reprogramming induce an inflammatory phenotype
in non-medullary thyroid carcinoma-induced macrophages. Oncoimmunology.
2016;5(12):e1229725.
Arts RJ, Carvalho A, La Rocca C, Palma C, Rodrigues F, Silvestre R, et
al. Immunometabolic Pathways in BCG-induced trained immunity. Cell Rep.
2016;17(10):2562-71.
Arts RJ, Novakovic B, Ter Horst R, Carvalho A, Bekkering S, Lachmandas E,
et al. Glutaminolysis and fumarate accumulation integrate ommunometabolic and
epigenetic programs in trained immunity. Cell Metab. 2016;24(6):807-19.
Novakovic B, Habibi E, Wang SY, Arts RJ, Davar R, Megchelenbrink W, et al.
beta-Glucan reverses the epigenetic state of LPS-induced immunological tolerance.
Cell. 2016;167(5):1354-68 e14.
Abrignani S, Adam D, de Almeida M, Altucci L, Amin V, Amit I, Antonarakis
SE, Aparicio S, Arima T, Arrigoni L, Arts R, et al. The international human
epigenome consortium: a blueprint for scientific collaboration and discorvery. Cell.
2016;167(5):1145-9.
Arts RJ, Joosten LA, Netea MG. Immunometabolic circuits in trained immunity.
Semin Immunol. 2016;28(5):425-30.
Cheng SC*, Scicluna BP*, Arts RJ*, Gresnigt MS, Lachmandas E, Giamarellos-
Bourboulis EJ, et al. Broad defects in the energy metabolism of leukocytes underlie
immunoparalysis in sepsis. Nature immunology. 2016;17(4):406-13.
Blok BA*, Arts RJ*, van Crevel R, Benn CS, Netea MG. Trained innate immunity
as underlying mechanism for the long-term, nonspecific effects of vaccines. J Leukoc
Biol. 2015;98(3):347-56.
Benn CS, Aaby P, Arts RJ, Jensen KJ, Netea MG, Fisker AB. An enigma: why
vitamin A supplementation does not always reduce mortality even though vitamin A
deficiency is associated with increased mortality. Int J Epidemiol. 2015;44(3):906-18.
Arts RJ*, Blok BA*, Aaby P, Joosten LA, de Jong D, van der Meer JW, et al. Long-
term in vitro and in vivo effects of gamma-irradiated BCG on innate and adaptive
immunity. J Leukoc Biol. 2015;98(6):995-1001.

284 |
 Epilogue

Arts RJ, Blok BA, van Crevel R, Joosten LA, Aaby P, Benn CS, et al. Vitamin
A induces inhibitory histone methylation modifications and down-regulates trained
immunity in human monocytes. J Leukoc Biol. 2015;98(1):129-36.
Hamers LA, Kox M, Arts RJ, Blok B, Leentjens J, Netea MG, et al. Gamma-
irradiated bacille Calmette-Guerin vaccination does not modulate the innate immune
response during experimental human endotoxemia in adult males. J Immunol Res.
2015;2015:261864.
Cheng SC, Quintin J, Cramer RA, Shepardson KM, Saeed S, Kumar V,
Giamarellos-Bourboulis EJ, Martens JH, Rao NA, Aghajanirefah A, Manjeri GR, Li Y,
Ifrim DC, Arts RJ, et al. mTOR- and HIF-1alpha-mediated aerobic glycolysis as
metabolic basis for trained immunity. Science. 2014;345(6204):1250684.
Arts RJ, Joosten LA, van der Meer JW, Netea MG. TREM-1: intracellular
signaling pathways and interaction with pattern recognition receptors. J Leukoc Biol.
2013;93(2):209-15.
Arts R, Bosscha K, Ranschaert E, Vogelaar J. Small bowel leiomyosarcoma: a
case report and literature review. Turk J Gastroenterol. 2012;23(4):381-4.
Arts RJ, Joosten LA, Dinarello CA, Kullberg BJ, van der Meer JW, Netea MG.
TREM-1 interaction with the LPS/TLR4 receptor complex. Eur Cytokine Netw.
2011;22(1):11-4.

*These authors have contributed equally

Book Chapter
Arts RJ, Netea MG. Adaptive Characteristics of Innate Immune Responses in
Macrophages. Microbiol Spectr. 2016;4(4).

| 285 15
Chapter 15

Curriculum Vitae

Rob Johannes Wilhelmus Arts was born in Venray, 22 July 1988, and was raised
in Overloon. After graduating from VWO at Scholengemeenschap Stevensbeek
in 2006, he chose to study medicine at the Radboud University Nijmegen. He
finished his bachelor in 2009 and master in 2013, both cum laude. During these
years he was a mathematics teacher, and later on trainer of new teachers, at the
Eindexamencursussen at the University of Leiden. During his bachelor he followed
several courses in physics, mathematics, theology, German, and Spanish and started
to do his first research under the supervision of Prof. Van Engelen en Prof. Heerschap
in the field of facioscapulohumeral muscular dystrophia (FSHD). However, at the
end of his bachelor he met Prof. Netea, and he changed his interest to immunology.
Together with Prof. Netea he wrote two papers on the role of triggering receptor
expressed on myeloid cells 1 (TREM1), after which they decided to apply for a PhD
scholar ship from the Radboud university medical center, which he got awarded.
From September 2013 on he was a PhD student in the lab of Mihai Netea and got the
opportunity to present his work at several conferences and meetings, among others
in Ghana, Guinea-Bissau, Durham (North Carolina, USA), and Zacatecas (Mexico).
He took also part in the Radboud Da Vinci Challenge talent track. Furthermore, he
was secretary of the Jonge Democraten Arnhem-Nijmegen, the liberal democrats
youth party, and has been playing the French horn in the symphonic orchestra Flos
Campi. After having obtained his PhD degree, Rob will start his internal medicine
training at the Canisius Wilhelmina Hospital in Nijmegen in September 2017.

286 |
Epilogue

| 287 15