TRANSLATIONAL AND CLINICAL RESEARCH

Interferon Gamma Inhibits Adipogenesis In Vitro and Prevents

Marrow Fat Infiltration in Oophorectomized Mice
CHRISTOPHER VIDAL,a SANDRA BERMEO,a WEI LI,a DAO HUANG,b RICHARD KREMER,b GUSTAVO DUQUEa
a
Ageing Bone Research Program, Sydney Medical School Nepean, The University of Sydney, Penrith, NSW,
Australia; bCalcium Research Laboratory, Department of Medicine, McGill University, Montreal, Quebec, Canada

Key Words. Adipogenesis • Mesenchymal stem cells • Interferon gamma • Osteoporosis • Aging • Osteoimmunology

ABSTRACT
Interferon gamma (IFNc) has been reported to induce osteo-
blastogenesis from mesenchymal stem cells (MSCs) both in
vitro and in vivo. With ageing, adipocytes outnumber osteo-
blasts within the bone microenvironment leading to a
decrease in bone formation. Since both osteoblasts and adi-
pocytes are of mesenchymal origin, we hypothesized that
IFNc treatment might negatively affect adipogenesis while
stimulating osteoblastogenesis in human MSC. To test this
hypothesis, human MSCs were induced to differentiate into
adipocytes in the presence or absence of osteogenic doses of
IFNc (1, 10, and 100 ng/ml). IFNc-treated MSC showed a
decrease in adipocyte differentiation and lipid deposition
when compared with vehicle-treated controls. Additionally,
adipogenic markers were significantly decreased by IFNc
Disclosure of potential conflicts of interest is found at the end of this article.
treatment at the same doses that have been reported to have
a strong osteogenic effect in vitro. Furthermore, DNA bind-
ing of peroxisome proliferator-activated receptor gamma
was significantly lower in IFNc-treated differentiating MSC.
Subsequently, ovariectomized C57BL6 mice were treated
with osteogenic doses of IFNc three times a week for 6
weeks. In distal femur, treated mice showed significantly
higher hematopoiesis concomitant with lower levels of fat
volume/total volume, adipocyte number, and expression of
adipogenic markers when compared with the vehicle-treated
mice. Together, these findings demonstrate that, at osteogenic
doses, IFNc also acts as an inhibitor of adipogenesis in vitro
and prevents marrow fat infiltration while favors hematopoi-
esis in ovariectomized mice. STEM CELLS 2012;30:1042–1048

cuing oophorectomized (OVX) mice from osteoporosis [9]. In

INTRODUCTION
The maintenance of bone mass and the prevention of fractures
relies on two synchronized (coupled) events, resorption by
osteoclasts and bone formation by osteoblasts, a process
known as bone turnover [1]. The cellular components of the
bone marrow milieu (hematopoietic, immune, bone, and adi-
pose) play an important role in the regulation of bone turn-
over [2] either through their own activity or through cell-to-
cell interactions. The particular relationship between the
immune and musculoskeletal systems has been described as
osteoimmunology [3, 4]. The study of this interaction has
demonstrated that both, cytokines (tumor necrosis factor
alpha, interleukin-6 [IL-6], etc.) [3] and adipokines (leptin,
adiponectin, etc.) [5–7], play an important role in the regula-
tion of bone turnover and could be responsible for the
changes seen in age-related bone loss and osteoporosis.
One of those cytokines, interferon gamma (IFNc), was
recently reported to promote osteoblastogenesis and bone for-
mation both in vitro [8] and in vivo [9]. The anabolic effect
of IFNc is mediated by increasing both osteoblastogenesis and
osteoclastogenesis [10] with a predominant stimulatory effect
on the osteoblast lineage, thus increasing bone mass and res-
addition, IFNc significantly increases the expression of osteo-
genic markers in differentiating mesenchymal stem cell
(MSC) into osteoblasts in vitro, including runt-related tran-
scription factor 2 and osteopontin [8].
Overall, the effects of IFNc on bone remain complex [11]
with some investigators reporting contrasting findings about
its effect on osteoclastogenesis [10] and bone resorption [3,
12–15]. High doses of IFNc have been used as treatment in
patients with osteopetrosis [16] to induce bone resorption and
reduce bone mass. Other studies report that IFNc directly
inhibits osteoclast differentiation [9, 13] and induce osteoclast
apoptosis [17]. In addition, the effect of IFNc on osteoclast
differentiation and function could be affected, among
others, by estrogen deficiency, inflammation, and bacterial
toxins [12, 18].
In contrast, the anabolic effect of low doses of IFNc on
bone is quite consistent [8, 9], thus suggesting that IFNc
could become a useful therapeutic approach to age-related
bone loss in the near future. However, to understand the
potential therapeutic effect of IFNc on osteoporosis and age-
related bone loss, it is essential to assess its effect on other
cellular components of the bone marrow milieu and specifi-
cally on marrow fat. High levels of fat infiltration are the

Author contributions: C.V., R.K., and G.D.: concept design, in vivo and in vitro experiments, data collection and analysis, and
preparation of the manuscript; S.B., W.L., and D.H.: in vivo and in vitro experiments, data collection and analysis, and preparation of
the manuscript.
Correspondence: Gustavo Duque, Ph.D., M.D., F.R.A.C.P., Sydney Medical School Nepean, Level 5, South Block, Nepean Hospital,
Penrith, NSW 2750, Australia. Telephone: þ61-2-47344278; Fax: þ61-2-47341817; e-mail: gustavo.duque@sydney.edu.au Received
November 16, 2011; accepted for publication January 26, 2012; first published online in STEM CELLS EXPRESS February 13, 2012.
V
C AlphaMed Press 1066-5099/2012/$30.00/0 doi: 10.1002/stem.1063

STEM CELLS 2012;30:1042–1048 www.StemCells.com

Vidal, Bermeo, Li et al.
result of increased adipogenesis that occurs in aging bone
along with a decrease in the number of osteoblasts due to a
clonal switch in differentiating MSC [19–21]. It would be
then expected that the anabolic effect of IFNc on bone would
be associated with a reduction in marrow adipogenesis. In
fact, other molecules that have an anabolic effect on bone
such as alendronate [22], vitamin D [23], and parathyroid hor-
mone [24] have been reported to increase osteoblast differen-
tiation while decreasing adipogenesis. Therefore, considering
that IFNc has been just recently reported as a bone anabolic,
in this study we assessed the effect of osteogenic dose of
IFNc on adipogenesis both in vitro and in vivo.
MATERIALS AND METHODS
Cell Differentiation and Treatment
For adipogenic differentiation of MSC, human MSCs (PT-125
Lonza, Basel, Switzerland, http://www.lonza.com) [25] were
seeded at a density of 5
105 cells per square centimeter in 56
cm2 Petri dishes containing basal medium (MSCGM BulletKit
PT-3001, Lonza, Basel, Switzerland). These primary cells are
commercially available and are obtained from bone marrow of
healthy young donors (age 24–30-year old) [25]. This model has
been used in our previous studies [8, 23] and is preferred over
cells from older donors due to their excellent differentiation
potential. After reaching 60% confluence, cells were transferred
to six-well plates and stimulated to differentiate into adipocytes
alternating between adipogenic induction media (AIM), contain-
ing 0.1 lM dexamethasone, 10 lg/ml insulin, 0.2 mM indometha-
cin, 0.5 mM 3-isobutyl-1-methylxanthine, 10% fetal bovine se-
rum, 0.05 U/ml penicillin, 0.05 lg/ml streptomycin, and
adipogenic maintenance medium ([10 lg/ml insulin, 10% fetal
bovine serum, 0.05 U/ml penicillin, and 0.05 lg/ml streptomy-
cin]) every 3 days for 2 weeks, until obtaining an adipogenic phe-
notype as previously described [25]. During differentiation, cells
were treated with either vehicle or IFNc (Sigma-Aldrich, Co., St.
Louis, MO, http://www.sigmaaldrich.com) at three different doses
(1, 10, and 100 ng/ml), as previously described [8].
Oil Red O Staining
Oil red O (ORO) staining was used to assess adipocyte differen-
tiation as an indicator of intracellular lipid accumulation. On day
15, culture medium was removed from tissue culture well and
cells were rinsed with phosphate buffered saline (PBS) once, fol-
lowed by fixation using 10% formaldehyde in PBS for at least 1
hour. The fixative was then aspirated and cells were washed with
60% isopropanol before being allowed to dry completely. Cells
were stained for 10 minutes at room temperature with a diluted
solution of ORO (66.6%) prepared from a 0.5% (w/v) ORO dis-
solved in isopropanol. Cells were then washed four times with
running tap water to remove excess stain. Photomicrographs were
taken using an IX50 Olympus inverted microscope (Olympus,
Tokyo, Japan, http://www.olympus-global.com/en/) and a Digital
Sight DS-5M Nikon camera (Nikon Instruments, Inc. Melville,
New York, NY, http://www.nikoninstruments.com). To quantify
lipid deposition, ORO was eluted with 1 ml 100% isopropanol
for 10 minutes and absorbance measured at 490 nm [26].
Measurement of Glycerol in Culture Media
Determination of free glycerol concentration in culture media was
measured by coupled enzymatic reactions catalyzed by glycerol
kinase, glycerol phosphate oxidase, and peroxidase (Sigma; cat#
F6428). Ten microliters of supernatant or standard was added to
800 ll of free glycerol reagent and incubated for 5 minutes at
37 C. Absorbance was measured at 540 nm and glycerol concen-
tration determined using a standard curve. All tests were done in
duplicate.
www.StemCells.com
1043
Table 1. Oligonucleotide primers used for real-time PCR
Primer sequences 50 –30 Accession
(forward and reverse) number
PPARc2 TCCATGCTGTTATGGGTGAA NM_015869
TCAAAGGAGTGGGAGTGGTC
Adiponectin GGCCGTGATGGCAGAGAT NM_004797
TTTCACCGATGTCTCCCTTAGG
CEBPa AAGAAGTCGGTGGACAAGAACAG NM_004364
TGCGCACCGCGATGT
aP2 AAAGAAGTAGGAGTGGGCTTTGC NM_001442
CCCCATTCACACTGATGATCAT
LPL TCCGCGTGATTGCAGAGA NM_000237
CGCTCGTGGGAGCACTTC
GAPDH GAAATCCCATCACCATCTTCC NM_002046
AAATGAGCCCCAGCCTTCTC
Thermal profile for all PCRs: 40 cycles; denaturation 95 C/15
seconds; annealing 60 C/15 seconds; extension 72 C/30 seconds.
Abbreviations: CEBPa, CCAAT/enhancer binding protein alpha;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LPL,
lipoprotein lipase; PPARc2, peroxisome proliferator-activated
receptor gamma.
MTS Viability Assay
To test whether treatment with IFNc has any effect on cell sur-
vival, differentiating MSCs were seeded in 96-well plates. At
60% confluence, media were replaced with AIM containing either
IFNc (1, 10, and 100 ng/ml) or vehicle alone. At timed intervals
(24, 48, and 72 hours), 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxy-
methoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-Forma-
zan cell viability assays (Promega, Madison, WI, http://www.
promega.com) were performed and corrected for cell number.
Briefly, a stock solution of MTS was dissolved in PBS at a con-
centration of 5 mg/ml and was added in a 1:10 ratio (MTS/Dul-
becco’s modified Eagle’s medium) to each well, incubated at
37 C for 2 hours, and the optical density was determined at a
wavelength of 490 nm on a microplate reader model 3550
(FLUOstar; BMG Labtech, Durham, NC, http://www.bmglabtech.
com). The percent survival was defined as [(experimental absorb-
ance  blank absorbance)/control absorbance  blank absorb-
ance)]
100, where the control absorbance is the optical density
obtained for 1
104 cells per well (number of cells plated at the
start of the experiment), and blank absorbance is the optical den-
sity determined in wells containing medium and MTS alone. This
experiment was replicated three times.
Real-Time PCR and Western Blotting
Total RNA and proteins were extracted from the same cell pellet,
collected at the end of the second week of differentiation using the
specifications of PARIS protocol (Ambion Inc., Austin, TX, http://
www.invitrogen.com/site/us/en/home/brands/ambion.html). Briefly,
treated cells were kept on ice rinsed with PBS and directly dis-
rupted by adding a cell disruption buffer. Proteins were protected
by adding halt protease and phosphatase inhibitors (Thermo Fisher
Scientific Inc., Rockford, IL, http://www.thermofisher.com), col-
lected using a rubber spatula and stored at 80 C until further
analysis. RNA in the lysate was treated with b-mercaptoethanol
(Sigma-Aldrich, Co.) and guanidinium thiocyanate (provided) and
linked to a filter cartridge according to the PARIS manufacturer
conditions. RNA and protein concentrations were estimated based
on UV absorbance (260 and 280 nm, respectively) readings by
spectrophotometry. First strand complementary DNA (cDNA) syn-
thesis was performed using 200 ng of total RNA, 50 ng random
hexamers, and 50 units reverse transcriptase at 42 C for 1 hour, as
described by manufacturer (Bioline Australia Pty, Alexandria,
NSW, Australia, http://www.bioline.com; cat# BIO-65025).
Real-time polymerase chain reaction (RT-PCR) for expressed
genes as markers for adipogenesis was performed in duplicate in a
1044 Effect of Interferon Gamma on Adipogenesis

Figure 1. IFNc inhibits adipogenesis in vitro: (A) human mesenchymal stem cells were committed to differentiate into adipocytes and treated
for 2 weeks with either IFNc (1, 10, and 100 ng/ml) or vehicle alone (C ¼ control). At week 2, cells were fixed, stained with oil red O (ORO),
and counterstained with hematoxylin to assess adipocyte differentiation. Lower magnification (
10) shows higher amount of fat droplets (red)
and differentiated adipocytes in untreated cells (A, upper panels) when compared with IFNc-treated cells at a dose of 10 and 100 ng/ml. At
higher magnification (
100, A, lower panels), the amount and distribution of fat droplets are highly affected by IFNc where lipid droplets (red)
are unable to reach confluence when compared with untreated cells. (B): ORO was extracted using isopropanol and the optical density was meas-
ured at 492 nm confirming the strong dose-dependent effect of IFNc on fat production in differentiating adipocytes. *, p < .01 versus vehicle-
treated cells; #, p < .01 versus lower dose of IFNc (1 ng/ml). (C): The capacity of secreting glycogen in the culture media was also impaired af-
ter treatment with IFNc in a dose-dependent manner. *, p < .01 versus vehicle-treated cells. (D): Treatment with IFNc did not show any effect
on cell survival at three timed intervals (24, 48, and 72 hours). Abbreviation: IFNc, interferon gamma.

total reaction volume of 25 ll, 10% of which was cDNA (or water
for nontemplate control), 3 mM MgCl2, and 250 nM each forward
and reverse-specific primer for target genes and normalizer (Table
1). All PCRs were performed in a Corbett Rotor-Gene 3000 (QIA-
GEN Pty, http://www.qiagen.com) using SYBR green with no-
ROX reaction mix and a standard thermal profile as described by
supplier (Bioline Australia Pty; cat# QT6750-02). Quantitative RT-
PCR data were defined by threshold cycle (Ct) normalized for the
housekeeping gene glyceraldehyde-3-phosphate dehydrogenase
(GAPDH). Quantification of relative differences of expressed genes
between different adipogenic conditions was calculated using REST
software (QIAGEN Pty) [27] correcting for PCR reaction efficien-
cies (>0.90). A statistical significant change in relative expression
between treated and untreated cells was taken at p < .05.
Protein samples for Western blotting were reduced with dithi-
othreitol 50 mM in NuPAGE lithium dodecyl sulfate Sample
Buffer
1 and were run on a NuPAGE Novex Bis-Tris mini-gel
using the XCell SureLock Mini-Cell and blotted to a nitrocellu-
lose membrane using the XCell II Blot module (all reagents and
equipment from Invitrogen Corporation, Carlsbad, CA, http://
www.invitrogen.com/site/us/en/home.html). After membrane
blocking with 5% bovine serum albumin, they were incubated
overnight at 4 C using monoclonal antibodies directed against
peroxisome proliferator-activated receptor gamma (PPARc) 1 and
2, CCAAT/enhancer binding protein alpha (CEBPa), and adipo-
nectin (Santa Cruz Biotechnology Inc., Santa Cruz, CA, http://
www.scbt.com). The linked antibodies were detected with the
corresponding secondary antibodies conjugated with horseradish
peroxidase (HRP). Blots were developed by chemiluminescence
using the Quantity One 4.4.0 software (Bio-Rad Laboratories,
Hercules, CA, http://www.bio-rad.com) and the Super Signal
West reagents (Thermo Fisher Scientific Inc.). In all experiments,
GAPDH gene and protein expression were used as internal con-
trol. These experiments were repeated three times.
PPARc Activity
PPARc activity as a transcription factor, binding to the peroxisome
proliferator response element, was determined using the enzyme-
linked immunosorbent assay-based PPARc activation TransAM kit
(Active Motif, Rixensart, Belgium, http://www.activemotif.com) as
previously described [28]. In brief, each one of the 96 wells in the
Trans-AM PPARc-Kit contains the immobilized oligonucleotide
containing a PPARc consensus-binding site (50 -AACTAGGN-
CAAAGGTCA-30 ). PPARc, if present, specifically binds to this oli-
gonucleotide. The primary antibody used in the probe recognizes an
accessible epitope on PPARc protein upon DNA binding. The sec-
ondary HRP-conjugated antibody provides a sensitive colorimetric
readout easily quantified by spectrophotometry (450 nm). To quan-
tify PPARc activity in the cell lysate, 10 lg of proteins was added
to the wells, incubated 1 hour at room temperature, and revealed by
posterior addition of primary and secondary antibodies. After wash-
ing steps, developing and stop solutions were added, as recom-
mended by manufacturer.
Animal Tissue Preparation
Eight-week-old virgin female C57BL/6 mice (Charles River,
Quebec, Canada, http://www.criver.com) were OVX under gen-
eral anesthesia. Two weeks after surgery, mice received intra-
peritoneal injections of either 2,000, 5,000, or 10,000 interna-
tional units (IU) IFNc (R&D Systems Inc., Minneapolis, MN,
http://www.rndsystems.com) or vehicle (PBS) three times a
week for a total of 6 weeks. Mice were housed in cages in a
limited access room. Animal husbandry adhered to Canadian
Council on Animal Care Standards and all protocols were
approved by the McGill University Health Center Animal Care
Utilization Committee. One side femur from each animal in
each group was removed at the time of euthanization, fixed in
70% ethanol, dehydrated, and embedded undecalcified in methyl
methacrylate (J-T Baker, Phillipsburg, NJ, http://www.jtbaker.
com). At 50-mm intervals, longitudinal sections 5- and 8-mm
thick were cut using a Polycut-E microtome (Reichert-Jung
Leica, Heerbrugg, Switzerland, http://www.leica.com), placed on
gelatin-coated glass slides, deplasticized, and stained with von
Kossa. For fat quantification, after von Kossa staining, fat frac-
tion (fat volume vs. total volume), adipocyte number, adipocyte
diameter, and adipocytic/hematopoietic (A/H) ratio were
Vidal, Bermeo, Li et al. 1045

quantified using von Kossa stained sections, as previously

described [29].
Immunohistochemistry
The details of these methods were described previously [9].
Briefly, for immunohistochemistry, sections were incubated over-
night at 4 C with a goat polyclonal antibody IgG against either
PPARc2 or CEBPa (Santacruz Biotechnology Inc.). Primary anti-
body was detected by incubation with an anti-goat IgG secondary
antibody conjugated with horseradish peroxidase (1:300 in BSA
1%, Sigma-Aldrich). Antibody complexes were visualized with
DAB, a 3,3-diaminobenzine solution containing hydrogen peroxide
(Zymed Laboratories Inc., San Francisco, CA, http://www.invitro-
gen.com/zymed.html) and then counterstained in 1% hematoxylin.
Photographs were taken under an Olympus fluorescence micro-
scope controlled by an IPLab system. Brightness and contrast
adjustments were performed in Photoshop (Adobe). Levels of
PPARc2 and CEBPa expression were quantified as percentage of
bone marrow surface using the Bioquant Image Analysis Software.
Statistical Methods
All results were expressed as the mean 6 SE. Differences of the
structural and static parameters of bone histomorphometry
between different groups of mice were determined using Lev-
ene’s test for homogeneity of variances and the unpaired t test
for equality of means. In all experiments, a value of p < .05 was
considered significant.

RESULTS
Lipid Accumulation In Vitro Is Impaired
by IFNc Treatment
As shown in Figure 1A, the proportion of cells having easily
identifiable fat globules (adipocytes) was inversely related to
the IFNc concentration in the media. To assess lipid deposition,
ORO was eluted and quantified by measuring the absorbance
at 490 nm by spectrophotometry (Fig. 1B). Whereas cells
treated with the lowest dose of IFNc showed no difference
when compared with vehicle-treated cells, higher concentra-
tions of IFNc in the media induced a significant decrease in
lipid deposition (p < .01). In addition, IFNc treatment induced
a significant reduction in glycerol secretion by differentiating
cells in a dose-dependent manner (Fig. 1C). Finally, treatment
with IFNc had no effect on cell survival (Fig. 1D).
Effect of IFNc on Transcription and Protein
Expression of Adipogenic Factors
To assess the effect of IFNc administration on differentiating
adipocytes, we tested two major adipogenic genes by quantita-
tive real-time PCR. As shown in Figure 2, gene relative expres-
sion of the adipogenic markers, adiponectin and CEBPa, was
significantly reduced by IFNc treatment in a dose-dependent
manner (p < .05). In addition, Western blot analysis showed
that levels of adiponectin and CEBPa were significantly
reduced upon treatment with IFNc (p < .05) (Fig. 2).
Furthermore, we performed a comprehensive assessment
of the effect of IFNc administration on PPARc, a transcrip-
tion factor essential for marrow fat differentiation. Treatment
with IFNc induced a significant decrease in PPARc gene
(Fig. 3A) and reduced PPARc2 protein expression without
affecting protein expression of PPARc1 (Fig. 3B). In addi-
tion, cells treated with IFNc showed lower levels of binding
of PPARc to DNA (and hence ability to initiate transcrip-
tion) in a dose-dependent manner (p < .05) (Fig. 3C).
Finally, and concomitantly with the lower levels of DNA
binding of PPARc, we also observed a reduced expression
of the PPARc target genes adipocyte fatty acid binding pro-
www.StemCells.com
Figure 2. Effect of IFNc on adipocyte-specific proteins: cells were
induced to differentiate and treated as previously described. At week
2, protein extracts and mRNA were obtained, and levels of gene and
protein expression of adiponectin and CEBPa were determined by
real-time polymerase chain reaction (left panels) and Western blot
(right panels), respectively. The figure shows that treatment with
IFNc reduced the levels of mRNA and protein expression of both
transcription factors at week 2 of differentiation in a dose-dependent
manner. *, p < .01 versus vehicle-treated cells. Abbreviations:
CEBPa, CCAAT/enhancer binding protein alpha; GAPDH, glyceral-
dehyde-3-phosphate dehydrogenase; IFNc, interferon gamma.
tein (aP2) (Fig. 3D) and lipoprotein lipase (Fig. 3E) in the
IFNc-treated cells.
IFNc Treatment Decreases Marrow Fat and
Increases Hematopoiesis in OVX Mice
We treated OVX and SHAM mice with IFNc, as described
before, and marrow adipogenesis was determined by means of
quantification of fat fraction (fat volume/total volume), adipo-
cyte number, and adipocyte diameter. As shown in Figure
4A--4E, treatment with IFNc significantly reduced the amount
of marrow fat (fat fraction) and adipocytes number in a dose-
dependent manner when compared with vehicle-treated OVX
mice (p < .001). In contrast, adipocyte diameter was not
affected by IFNc treatment. Finally, A/H ratio was signifi-
cantly decreased in the IFNc-treated group in a dose-depend-
ent manner (p < .001).
To further assess a potential mechanism for the reduction
in adipocyte parameters induced by treatment with IFNc, we
assessed the changes in PPARc2 and CEBPa expression
within the bone marrow of OVX mice treated with either
IFNc or vehicle. As shown in Figure 4F--4H, after 6 weeks of
treatment, IFNc significantly reduced the levels of PPARc2
and CEBPa expression within the bone marrow when com-
pared with vehicle-treated animals (p < .01).
1046 Effect of Interferon Gamma on Adipogenesis

Figure 3. IFNc treatment inhibits PPARc expression and activity in differentiating mesenchymal stem cell: cells were induced to differentiate
and treated as previously described. At week 2, protein extracts and mRNA were obtained and levels of PPARc gene and levels of protein
expression for both PPARc1 and 2 were determined by real-time polymerase chain reaction (A) and Western blot (B), respectively. The figure
shows that treatment with IFNc reduced both levels of mRNA for PPARc and protein expression of PPARc2 at week 2 of differentiation in a
dose-dependent manner. *, p < .01 versus vehicle-treated cells. (C): PPARc DNA-binding activity was determined using enzyme-linked immuno-
sorbent assay-based PPARc activation kit and quantified by colorimetry. The figure shows the levels of activity after treatment with either IFNc
(1, 10, and 100 ng/ml) or vehicle alone. Higher doses of IFNc (10 and 100 ng/ml) significantly reduced the activity of the PPARc complex in the
nuclei. Values are mean 6 SEM of six wells per group in three independent experiments. *, p < .01 versus vehicle-treated cells. (D, E): The
reduction in PPARc DNA-binding activity was associated with reduced levels of protein expression of the PPARc target genes adipocyte fatty
acid binding protein (aP2) (D) and LPL (E). *, p < .01 versus vehicle-treated cells. Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehy-
drogenase; IFNc, interferon gamma; LPL, lipoprotein lipase; PPARc, peroxisome proliferator-activated receptor gamma.

is explained by induction of osteoblast differentiation and

DISCUSSION
The pro-osteogenic effect of IFNc has been previously
reported both in vitro and in vivo [8, 9]. In this study, we
tested the effect of osteogenic doses of IFNc on adipocyte dif-
ferentiation from MSC in vitro and on marrow fat infiltration
in vivo. Our results support the hypothesis that, at osteogenic
doses, IFNc concurrently inhibits adipogenesis and marrow
fat infiltration.
IFNc is a cytokine produced by innate and adaptive cells in
the immune system [13] as well as by MSC [8]. IFNc interacts
with its receptors expressed constitutively to promote cell signal-
ing and transcription through Jak1/STAT1 pathway [30]. Its pro-
duction is regulated by cytokines (positively, IL-12 and IL-18;
negatively, IL-4, IL-10, transforming growth factor-b, and gluco-
corticoids) to exert antiviral activity (principally) and both directly
and indirectly affecting a number of other biological pathways
[30]. In terms of osteoimmunology, IFNc plays an important role
in the regulation of both bone formation and bone resorption in a
dose-dependent manner [3, 11]. Depending of the dose and the
experimental model, IFNc could regulate osteoclastogenesis and
osteoclastic activity either positively [15, 18, 31] or negatively
[12]. In addition, IFNc is required in early phases of osteoblasto-
genesis [8] while treatment with low doses of exogenous IFNc
induces osteoblastogenesis both in vitro [8] and in vivo [9].
Considering that the principle of a bone anabolic is the
stimulation of bone formation through either the activation of
osteoblastogenesis or prolonging osteoblast survival, in the
case of IFNc, it was initially proposed that its anabolic effect
bone formation [9]. However, since osteoblasts and adipocytes
share the same precursors, it was tempting to hypothesize
that, as in the case of other bone anabolics [22–24], IFNc
could also have an inhibitory effect on adipogenesis, thus
increasing the number of MSC suitable to differentiate into
osteoblasts.
In fact, the effect on IFNc on adipogenesis has been pre-
viously tested in differentiating 3T3-L1 murine preadipocytes
[32] and in mice embryonic-differentiating fibroblasts [33]. In
both studies, IFNc showed an inhibitory effect on adipogene-
sis; however, the significance of this effect on balancing
osteoblastogenesis and hematopoiesis remained untested.
To obtain this lacking evidence on the effect of IFNc on
the bone marrow milieu, in this study, we looked at the effect
of IFNc on both a model of adipocyte-differentiating human
MSC in vitro and on marrow fat of OVX mice, a mouse model
that was selected since OVX is a potent inducer of marrow fat
infiltration [34]. In both models, we used the same osteogenic
doses as previously reported [8, 9]. Our results showed that the
higher (and osteogenic) doses (10 and 100 ng/ml) of IFNc sig-
nificantly reduced adipocyte differentiation and lipid deposition
in vitro. Furthermore, expression of adipocyte-specific proteins
was negatively affected by IFNc treatment at the transcriptional
and protein levels in a dose-dependent manner. In addition,
when testing the effect of IFNc on PPARc we found that, as in
the case of other compounds that simultaneously inhibit adipo-
genesis while favor osteoblastogenesis [22–24], the effect of
IFNc was mostly targeted to PPARc2 expression. This effect is
relevant since the activation of the PPARc2 (with or without
Vidal, Bermeo, Li et al. 1047

Figure 4. IFNc inhibits marrow fat infiltration in vivo: sections of plastic-embedded tibiae from IFNc (2,000 IU, 5,000 IU, and 10,000 IU) and
vehicle-treated oophorectomized mice were stained sequentially for von Kossa (VK) for fat quantification (A). Treatment with IFNc induced a
significant reduction in marrow fat fraction (B) and adipocyte number (C) with no effect on adipocyte diameter (D). In addition, adipocytic/hema-
topoietic (A/H) ratio was decreased in the IFNc-treated groups in a dose-dependent manner (E) indicating that treatment with IFNc increased
hematopoiesis independently of its effect on bone mass. Micrographs are representative of those from eight different mice of each treatment
group. Magnification
20. *, p < .01, **, p < .001 versus control. (F--H): Immunohistochemistry shows lower levels of protein expression of
the adipogenic factors PPARc and CEBPa in the marrow fat of IFNc-treated mice in a dose-dependent manner. Micrographs are representative of
those from eight different mice of each treatment group. Magnification
60. *, p < .01. Abbreviations: CEBPa, CCAAT/enhancer binding pro-
tein alpha; IFNc, interferon gamma; PBS, phosphate buffered saline; PPARc, peroxisome proliferator-activated receptor gamma.

activation of PPARc1) directs MSC differentiation toward the
adipocyte lineage at the expense of osteoblast formation [35],
an effect that was inhibited by IFNc administration. Finally,
we also observed that the inhibitory effect of IFNc on PPARc
is not only limited to its transcription and translation but also
limited to its DNA-binding, thus decreasing the expression of
PPARc target genes.
When compared with previous evidence on the osteogenic
effect of IFNc on differentiating MSC [8], this evidence sug-
gests that the osteogenic doses of IFNc enhance the shift of
human MSC from adipogenesis into osteoblastogenesis, thus
increasing bone formation. In addition, from a mechanistic
correlation, the previously reported stimulatory effect of IFNc
on several transcription factors for osteoblastogenesis [8, 9]
correspond with the inhibitory effect on the critical transcrip-
tion factors for adipogenesis evaluated in this study. This is a
dual and dose-dependent action of IFNc on MSC that could
be used for therapeutic purposes in the near future.
www.StemCells.com
Interestingly, when we treated OVX animals with osteo-
genic doses of IFNc, we found a dose-dependent effect on mar-
row fat in the treated mice, which also correlated with low lev-
els of expression of adipogenic factors within the bone marrow.
This finding is relevant since it seems to be independent of the
anabolic effect on bone mass as suggested by the high amount
of hematopoietic bone marrow and by the increase in A/H ratio
noticed in the mice treated with the higher osteogenic doses of
IFNc. This increase in hematopoiesis in IFNc-treated mice is
unexpected because IFNc has been reported to inhibit hemato-
poiesis through the activation of lymphocytes [36]. Considering
that IFNc increases the T lymphocyte repository within the bone
marrow in OVX mice [9], it would be expected that treatment
with IFNc would also decrease hematopoiesis. In this case,
higher levels of hematopoiesis observed in IFNc-treated OVX
mice could be mostly associated with the significant reduction
in marrow adipocytes, which are known to be strong inhibitors
of hematopoiesis [37], thus confirming previous theories that
1048
shifting the balance between adipogenesis and osteoblastogene-
sis substantially influences hematopoiesis [38].
CONCLUSIONS
In conclusion, we are reporting that osteogenic doses of IFNc
negatively affect adipogenesis. Decreasing adipocyte differen-
tiation and hence adipocyte numbers not only favors osteo-
blastogenesis and hematopoiesis but also improves the overall
bone microenvironment. This dual and dose-dependent effect
of IFNc on bone marrow cellularity is an important finding
for the understanding of the effect of IFNc on bone cells and
for the potential use of IFNc in the treatment of osteoporosis
in older persons in the near future.
REFERENCES
1 Raggatt LJ, Partridge NC. Cellular and molecular mechanisms of bone
remodeling. J Biol Chem 2010;285:25103–25108.
2 Datta HK, Ng WF, Walker JA et al. The cell biology of bone metabo-
lism. J Clin Pathol 2008;61:577–587.
3 Takayanagi H. Osteoimmunology and the effects of the immune sys-
tem on bone. Nat Rev Rheumatol 2009;5:667–76.
4 Schett G, David J-P. The multiple faces of autoimmune-mediated
bone loss. Nat Rev Endocrinol 2010;6:698–706.
5 Reid I. Relationships between fat and bone. Osteoporos Int 2008;19:
595–606.
6 Barbour KE, Zmuda JM, Boudreau R et al. Adipokines and the risk of
fracture in older adults. J Bone Miner Res 2011;26:1568–1576.
7 Gasparrini M, Rivas D, Elbaz A et al. Differential expression of cyto-
kines in subcutaneous and marrow fat of aging C57BL/6J mice. Exp
Gerontol 2009;44:613–618.
8 Duque G, Huang DC, Macoritto M et al. Autocrine regulation of inter-
feron gamma in mesenchymal stem cells plays a role in early osteo-
blastogenesis. Stem Cells 2009;27:550–558.
9 Duque G, Huang DC, Dion N et al. Interferon g plays a role in bone
formation in vivo and rescues osteoporosis in ovariectomized mice. J
Bone Miner Res 2011 26:1472–1483.
10 Ross FP. Osteoclast biology and bone resorption. In: Rosen CJ,
Compston JE, Lian JB, eds. Primer on the Metabolic Bone Diseases
and Disorders of Mineral Metabolism. 7th ed. Washington: American
Society for Bone and Mineral Research, 2008:16–22.
11 Ferrari Lacraz S, Ferrari S. Is IFN-c involved in bone loss or protection?
Nothing is simple with cytokines. Bonekey Osteovision 2007;4:83–87.
12 Gao Y, Grassi F, Ryan MR et al. IFN-gamma stimulates osteoclast
formation and bone loss in vivo via antigen-driven T cell activation. J
Clin Invest 2007;117:122–132.
13 Takayanagi H, Sato K, Takaoka A et al. Interplay between interferon
and other cytokine systems in bone metabolism. Immunol Rev 2005;
208:181–193.
14 Pacifici R. The immune system and bone. Arch Biochem Biophys
2010;503:41–53.
15 Takayanagi H, Ogasawara K, Hida S et al. T-cell-mediated regulation
of osteoclastogenesis by signalling cross-talk between RANKL and
IFN-[gamma]. Nature 2000;408:600–605.
16 Key LL Jr., Rodriguiz RM, Willi SM et al. Long-term treatment of
osteopetrosis with recombinant human interferon gamma. N Engl J
Med 1995;332:1594–1599.
17 Kohara H, Kitaura H, Fujimura Y et al. IFN-[gamma] directly inhibits
TNF-[alpha]-induced osteoclastogenesis in vitro and in vivo and indu-
ces apoptosis mediated by Fas/Fas ligand interactions. Immunol Lett
2011;137:53–61.
18 Ayon Haro ER, Ukai T, Yokoyama M et al. Locally administered
interferon-c accelerates lipopolysaccharide-induced osteoclastogenesis
independent of immunohistological RANKL upregulation. J Periodon-
tal Res 2011;46:361–373.
19 Duque G. Bone and fat connection in aging bone. Curr Opin Rheuma-
tol 2008;20:429–434.
Effect of Interferon Gamma on Adipogenesis
ACKNOWLEDGMENTS
This study was supported by the Australian National Health and
Medical Research Council (NHMRC 632767), the Nepean Med-
ical Research Foundation to Dr. Duque, and by the Canadian
Institutes for Health Research (CIHR MOP 10839) to Dr.
Kremer.
DISCLOSURE OF POTENTIAL
CONFLICTS OF INTEREST
The authors indicate no potential conflicts of interest.
20 Rosen CJ, Bouxsein ML. Mechanisms of disease: Is osteoporosis the
obesity of bone? Nat Clin Pract Rheumatol 2006;2:35–43.
21 Moerman EJ, Teng K, Lipschitz DA et al. Aging activates adipogenic
and suppresses osteogenic programs in mesenchymal marrow stroma/
stem cells: The role of PPAR-c2 transcription factor and TGF-b/BMP
signaling pathways. Aging Cell 2004;3:379–389.
22 Duque G, Rivas D. Alendronate has an anabolic effect on bone
through the differentiation of mesenchymal stem cells. J Bone Miner
Res 2007;22:1603–1611.
23 Duque G, Macoritto M, Kremer R. 1,25(OH)2D3 inhibits bone mar-
row adipogenesis in senescence accelerated mice (SAM-P/6) by
decreasing the expression of peroxisome proliferator-activated receptor
gamma 2 (PPARgamma2). Exp Gerontol 2004;39:333–338.
24 Rickard DJ, Wang FL, Rodriguez-Rojas AM et al. Intermittent treat-
ment with parathyroid hormone (PTH) as well as a non-peptide small
molecule agonist of the PTH1 receptor inhibits adipocyte differentia-
tion in human bone marrow stromal cells. Bone 2006;39:1361–1372.
25 Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential of
adult human mesenchymal stem cells. Science 1999;284:143–147.
26 Reger RL, Tucker AH, Wolfe MR. Differentiation and characteriza-
tion of human MSCs. Methods Mol Biol 2008;449:93–107.
27 Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool
(RESTV C ) for group-wise comparison and statistical analysis of relative
expression results in real-time PCR. Nucleic Acids Res 2002;30:e36.
28 Rivas D, Akter R, Duque G. Inhibition of protein farnesylation arrests
adipogenesis and affects PPARgamma expression and activation in
differentiating mesenchymal stem cells. PPAR Res 2007;2007:81654.
29 Verma S, Rajaratnam JH, Denton J et al. Adipocytic proportion of
bone marrow is inversely related to bone formation in osteoporosis. J
Clin Pathol 2002;55:693–698.
30 Akdis M, Burgler S, Crameri R et al. Interleukins, from 1 to 37, and
interferon-[gamma]: Receptors, functions, and roles in diseases. J
Allergy Clin Immunol 2011;127:701-721.e1–e70.
31 Kotake S, Nanke Y, Mogi M et al. IFN-gamma-producing human T
cells directly induce osteoclastogenesis from human monocytes via
the expression of RANKL. Eur J Immunol 2005;35:3353–3363.
32 Li B, Shin J, Lee K. Interferon-stimulated gene ISG12b1 inhibits adi-
pogenic differentiation and mitochondrial biogenesis in 3T3-L1 cells.
Endocrinology 2009;150:1217–1224.
33 Todoric J, Strobl B, Jais A et al. Cross-talk between interferon-c and
hedgehog signaling regulates adipogenesis. Diabetes 2011;60:1668–1676.
34 Elbaz A, Rivas D, Duque G. Effect of estrogens on bone marrow adi-
pogenesis and Sirt1 in aging C57BL/6J mice. Biogerontology 2009;
10:747–755.
35 Lecka-Czernik B. PPARs in bone: The role in bone cell differentiation
and regulation of energy metabolism. Curr Osteoporos Rep 2010;8:84–90.
36 Raefsky EL, Platanias LC, Zoumbos NC et al. Studies of interferon as
a regulator of hematopoietic cell proliferation. J Immunol 1985;135:
2507–2512.
37 Naveiras O, Nardi V, Wezel PL et al. Bone-marrow adipocytes as
negative regulators of the haematopoietic microenvironment. Nature
2009;460:259–263.
38 Sugimura R, Li L. Shifting in balance between osteogenesis and adi-
pogenesis substantially influences hematopoiesis. J Mol Cell Biol
2010;2:61–62.