Immune suppressive and bone inhibitory effects of prednisolone in growing and

regenerating zebrafish tissues

Karina Geurtzen1, Aude Vernet2, Andrew Freidin3, Martina Rauner4, Lorenz Hofbauer4,

Jürgen Schneider2, Michael Brand1, Franziska Knopf1, 3*

1
Center for Regenerative Therapies Dresden (CRTD) and Biotechnology Center, Technische

Universität Dresden, Fetscherstraße 105, 01307 Dresden, Germany

2
Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford

OX3 7BN, United Kingdom

3
The Kennedy Institute of Rheumatology, University of Oxford, Roosevelt Drive, Oxford

OX3 7FY, United Kingdom

4
Division of Endocrinology, Diabetes, and Bone Diseases, Department of Medicine III,

Technische Universität Dresden, Fetscherstraße 74, 01307 Dresden, Germany

*
Corresponding author: franziska.knopf@biotec.tu-dresden.de, telephone: +49-351-45882304

Supplemental data has been included with the submission.

Disclosures
The authors declare no competing financial interest.

2
Abstract

Glucocorticoids are widely used as therapeutic agents to treat immune-mediated diseases in

humans because of their anti-inflammatory and immunosuppressive effects. However,

glucocorticoids have various adverse effects, in particular glucocorticoid-induced

osteoporosis, a common form of secondary osteoporosis. In zebrafish, which are increasingly

used to study processes of bone regeneration and disease, glucocorticoids show detrimental

effects on bone tissue; however, the underlying cellular mechanisms are incompletely

understood. Here, we show that treatment with the glucocorticoid prednisolone impacts on the

number, activity and differentiation of osteoblasts, osteoclasts and immune cells during

ontogenetic growth, homeostasis and regeneration of zebrafish bone. Macrophage numbers

are reduced in both larval and adult tissues, correlating with decreased generation of

myelomonocytes and enhanced apoptosis of these cells. In contrast, osteoblasts fail to

proliferate, show decreased activity and undergo incomplete differentiation. In addition,

prednisolone treatment mitigates the number and recruitment of osteoclasts to sites of bone

regeneration in adult fish. In combination, these effects delay bone growth and impair bone

regeneration. Our study demonstrates the many-faceted effects of glucocorticoids in non-

mammalian vertebrates and helps to further establish the zebrafish as a model to study

glucocorticoid-induced osteoporosis.

Key words (max. 5)

Animal models, Corticosteroids, Osteoblast, Osteoclast, Osteoporosis

3
Introduction

Osteoporosis affects millions of patients, who suffer from fragile bone often resulting in

fractures of the hip, spine and wrist. With estimated annual costs of 31.7 billion € in Europe

alone osteoporosis represents an enormous burden to the health care system (1). While

primary osteoporosis develops as a consequence of reduced estrogen levels and affects

predominantly women in their menopause, the second most common form of osteoporosis

results from long term glucocorticoid treatment and is referred to as glucocorticoid-induced

osteoporosis (GIO). Glucocorticoids are commonly used to treat inflammatory diseases such

as rheumatoid arthritis and asthma (2), but have detrimental effects on bone and its resident

cells in vivo. In mammals, the bone-resorbing osteoclasts increase their lifespan under high

glucocorticoid levels leading to transiently enhanced bone resorption (3). On the contrary,

mammalian osteoblast function is markedly reduced by different means, predominantly

enhancement of osteoblast apoptosis (2, 4-6). Glucocorticoids also transrepress the collagen 1

and osteocalcin genes leading to decreased bone matrix formation and fragile bone (3). The

multiple effects of glucocorticoids illustrate the need to dissect glucocorticoid function in vivo

and to develop immunomodulatory strategies that spare bone tissue.

Zebrafish has become a popular vertebrate model organism, in particular due to its genetic

tractability and ability to perform large-scale genetic (7, 8) and chemical (9-11) screens at

reasonable cost. In particular, zebrafish are a valuable tool for identifying genes and

compounds that influence bone metabolism and density (12, 13), and to study genetic (14-16)

and acquired skeletal disorders (17). Skeletal structures form comparatively early in zebrafish,

facilitating research on bone tissue (18). Besides, zebrafish have a strong regenerative

capacity and can readily regenerate bone in the amputated fin (19-21) and also repair other

types of bone injuries such as in the skull (22). One limitation of the zebrafish model might be

the fact that zebrafish do not possess cortical bone in the narrower sense, i.e. compact bone

that surrounds a bone marrow cavity containing hematopoietic stem cells (23). However,

4
much of the zebrafish skeleton is composed of rigid and dense bone which is also referred to

as compact bone, although osteons are found only rarely (24). Furthermore, the existence of

trabecular bone in the zebrafish skull has recently been reported (24). Thus, albeit there are

some differences between the skeletons of zebrafish and mammals, many features are shared.

This is especially true at the cellular level of bone tissue. Both cellular and acellular bone

exist in zebrafish (24), and also osteoclasts have been reported (25). Importantly, zebrafish

osteoblasts undergo a differentiation cascade very similar to mammalian osteoblasts (22, 26),

both during intramembranous and peri- and endochondral ossification (23, 24). Thus,

zebrafish shares key features regarding bone formation and remodeling with other vertebrates,

and due to its experimental accessibility represents a powerful model system to study bone

regeneration and repair (27).

Glucocorticoid-mediated bone loss has previously been induced in zebrafish larvae which led

to the identification of counter-active compounds that increase bone mass in a small molecule

screen (28), and in zebrafish scales (29, 30). The cellular and molecular effects that

glucocorticoids exert on zebrafish bone tissue, however, are not well understood.

Furthermore, there is no established adult GIO model taking the endoskeleton into account.

In this study, we comprehensively characterize the cellular and molecular effects of short and

long term glucocorticoid treatment on immune cells and cells of the bone tissue in zebrafish.

We use different experimental paradigms in larval and adult fish that reflect bone

development, homeostatic bone formation, and bone regeneration. These studies further

establish the zebrafish as a model to study GIO in vivo.

5
Materials and Methods

Animal experiments:

All procedures were in accordance with the animal handling and research regulations of the

Landesdirektion Dresden (Permit numbers: AZ 24D-9168.11-1/2008-1, AZ 24-9168.11-

1/2011-52 , AZ 24-9168.11-1/2013-5, AZ 24-9168.11-1/2013-14, AZ DD24.1-5131/354/87).

Transgenic fish lines and fish husbandry:

The transgenic lines used in this study osterix:nGFP (Ola.sp7:nlsGFPzf132), osteocalcin:GFP

(Ola.Bglap.1:EGFPhu4008), runx2:GFP (Hsa.RUNX2-Mmu.Fos:EGFPzf259), mpeg1:mCherry

(mpeg1:mCherrygl23) and mpx:GFP (BACmpo:gfpi114) have been described elsewhere (20, 31-

33). Fish were bred and maintained as described previously (34).

Prednisolone treatment:

Prednisolone, purchased from Sigma was dissolved at 100 mM in DMSO (dimethylsulfoxid)

to create a stock solution. Larval zebrafish were treated with 25 µM prednisolone or

corresponding amount of DMSO as control in sterilized E3 media (5 mM NaCl, 0.17 mM

KCl, 0.33 mM CaCl 3 2 H2O, 0.33 mM MgSO4 3 7 H2O) for 5 consecutive days starting at 6

dpf (days post fertilization) (28). Adult fish were treated individually by incubation in 50 µM

prednisolone or corresponding amount of DMSO in sterilized fish water. Both sexes were

used. Littermates were randomly assigned to the different groups. Experiments were open (i.e.

not blinded). The solutions were changed daily.

Fin amputations and drill injuries:

The fin amputations were performed as previously described (35), as were the drill injuries

('trepanation', (22); Kaslin and Brand, unpublished). Afterwards the fish were returned to

27°C water.

6
Quantification of GFP expression:

For quantification of GFP expression the fish were anesthetized with 0.02% Tricaine (MS222)

and imaged repeatedly with a Leica MZ16 FA stereomicroscope equipped with a

QIMAGING RETIGA-SRV camera. Identical settings for magnification, exposure time, gain

and contrast were used throughout the whole experiment and intensity measurements were

done using the Plot Profile Tool in Image J Software version 1.51h. To normalize for

differences in transgene expression levels between individual fish, all values were normalized

to the corresponding uninjured fins.

Bone staining techniques:

Alizarin red staining on adult fins was performed as previously described (22). For alizarin

red staining of skulls, samples were treated with 50 mg/ml trypsin in 30% saturated Na 2B4O7

O/N before the alizarin red solution was added. For alizarin red staining in larvae, larvae were

bleached with a 1:1 solution of 2% KOH and 3% H 2O2 for 20 minutes before the alizarin red

solution was added. To detect calcium deposition in larvae, live fish were incubated for 5

minutes in 0.2% Calcein (Sigma Aldrich) in dH2O (pH 7.5), rinsed in water several times and

incubated in water for additional 10 minutes. TRAP staining was performed according to

Blum and Begemann (2015) (36).

µCT:

To determine whole body bone mineral density, complete fish were scanned with a Scanco

Medical vivaCT 40 at 10.5 µm resolution. Software for analysis??

For µCT of the vertebrae, part of the head and trunk region were scanned with a SkyScan

1172 at 4.6 µm resolution. Image projections were reconstructed with NRecon software using

the Feldkamp algorithm. In order to visualize and analyze data in 2D and 3D, image rendering

7
was performed with dataViewer and CTVox. The region of the 3rd vertebrae was used to

measure bone volume.

Immunohistochemistry:

Fin and head cryosections were prepared as described (20, 37). Larval sections were prepared

with the same protocol used for heads. Immunofluorescence on fin and larval cryosections

was performed according to (20). A similar protocol was used for heads, except that the

methanol-fixation was omitted. For anti-PCNA staining the slides were treated with 10 mM

sodium citrate (pH 6) for 10 minutes at 85°C and washed twice with PBST before blocking.

Primary antibodies used in this study were: mouse anti-mCherry (Clontech), mouse anti-

PCNA (Dako) and rabbit anti-dsRed (Clontech) at 1:500, chicken anti-GFP (Abcam) at

1:2000-3000, mouse anti-Zns5 (Zebrafish International Resource Center, Eugene, OR, USA)

at 1:300. Secondary antibodies used were goat anti-mouse-Alexa 555, goat anti-chicken-

Alexa 488, goat anti-mouse-Alexa 488, donkey anti-rabbit-Alexa 555 (all Invitrogen, at

1:1000).

TUNEL assay:

TUNEL staining on cryosections was performed with the ApopTag Red In Situ Apoptosis

Detection Kit or ApopTag Fluorescein In Situ Apoptosis Detection Kit (both Millipore)

according to the manufacturer’s instructions. Transgenic osterix:nGFP (Ola.sp7:nlsGFPzf132)

zebrafish, in which osteoblasts are labeled by nuclear GFP or transgenic mpeg1:mCherry

(mpeg1:mCherrygl23) zebrafish, in which macrophages are labeled by mCherry, were used.

GFP and mCherry were visualized by immunohistochemistry detecting GFP or mCherry (see

above) preceding the TUNEL assay.

Kidney extraction and flow cytometry:

8
Whole kidney marrow cells were isolated as previously described (38). Flow cytometric

settings were chosen according to the ability to separate the major blood cell lineages

(erythrocytes, lymphocytes, precursors and myelomonocytes) by their light-scatter

characteristics (38).

qRT-PCR:

For qRT-PCR uninjured fins or regenerates were harvested (7-10 fish per sample) and RNA

was isolated using Trizol (Life Technologies). The RNA was DNaseI-digested (Invitrogen)

and precipitated afterwards with LiCl. The cDNA was synthesized with the Transcriptor First

Strand cDNA Synthesis Kit (Roche) using a mix of oligodT and random hexamers. Negative

controls (-RT) were generated replacing the Transcriptor RT with water. Relative mRNA

expression was determined with the LightCycler 480 SYBR Green I Master in a LightCycler

480 qPCR machine.

Primers were designed exon-spanning and were tested for their efficiency (1,95 < E < 2,05).

The target gene levels were normalized to β-actin and for each sample triplicates were run. In

each reaction with target gene primers 1 µl of undiluted cDNA was used whereas the cDNA

used for ß-actin amplification was diluted 1:10. Relative expression of the target genes was

calculated using the 2(-ΔΔC(T)) method (39).

The following primers were used: β-actin (CCTTCCTGGGTATGGAATCT;

GACAGCACTGTGTTGGCATA), runx2a (TGGAAGAGGAAAGAGCTTCA;

CCACTGTGACCTTTATGGCT), runx2b (GGTTCGACAGACTTGAGTCC;

GGTAGTGCATTCTGGGACTG), bglap (TGAAGGTGTGTTTGTGAAGC;

TCACAGGCCACATTTGTCTC), cxcl8a (TTTCCTGGCATTTCTGACCA;

AGAGATCATTGCCACCTTGATG), tnf-α (GCCATCCATTTAACAGGTGGAT;

TCCTCAGTCAGTTCAGACGT)

9
Results

Immunosuppressive effects of prednisolone in fish

Recently, it has become clear that bone cells closely interact with cells of the immune system,

and vice versa. For example, innate immune cells of the monocyte/macrophage lineage are

able to trigger osteogenesis in mesenchymal stem cells in vitro (40) (41, 42). Moreover, bone

tissue resident macrophages named osteomacs have been shown to stimulate osteoblast

mineralization in mammals in vivo (43). The same cells also enhance mammalian bone repair

after a fracture, by regulating osteoblast recruitment and differentiation (44). Thus,

macrophages are crucial partners for osteoblasts in regulating bone mass during homeostasis

and repair. Notably, cells of the myelomonocytic lineage including macrophages represent a

main target of glucocorticoids in mammals (45). As a result of pharmacologic glucocorticoid

treatment macrophages become inhibited, show increased apoptosis and partly lose their

ability to home to site of infections. Moreover, the transition of monocytes to macrophages is

negatively affected (45, 46).

Therefore, we set out to characterize the potency of prednisolone, one of the most prescribed

glucocorticoids, to suppress immune cells in zebrafish. We specifically determined the impact

of prednisolone treatment on macrophages. In transgenic mpeg1:mCherry zebrafish larvae,

mpeg1 (macrophage expressed gene 1) positive cells are labelled by mCherry (32). Following

treatment with 25 µM prednisolone, macrophage numbers throughout the body were strongly

reduced after 1 day of treatment (dt; Figure 1A and B, 3±1 macrophages/cryosection in Pred.

vs. 8±2 cells/cryosection in DMSO), and stayed low during consecutive days of treatment

(Supplemental Figure 1A, 3±1 macrophages/cryosection in Pred (1dt, 2dt, 5dt) vs. 8±2

macrophages/cryosection in 5dt DMSO). We next tested whether macrophages underwent

enhanced apoptosis after prednisolone exposure, as reported for mammals. Indeed, a

significant number of macrophages underwent apoptosis during prednisolone treatment, as

10
detected by TUNEL staining (Figure 1C, 61±22% TUNEL+ macrophages in Pred. vs. 8±2%

in DMSO).

Next, we quantified the number of macrophages after prednisolone treatment in different

tissues of adult fish. Macrophage numbers in the head region were reduced by one third after

14 days of 50 µM prednisolone treatment (Figure 1D and E, 8±2 macrophages/mm tissue in

Pred. vs. 12±3 macrophages/mm tissue in DMSO). In the caudal fin, macrophage numbers

dropped to less than 50% in comparison to control treated fins (Figure 1F, 7±3 cells/mm fin

tissue in Pred. vs. 16±3 cells/mm fin tissue). Additionally, we isolated the adult zebrafish

kidney, the site of hematopoiesis in zebrafish (47), after 14 dt and performed FACS analysis

according to gating criteria established by Traver et al. (48). This analysis distinguishes

between HSC precursors, lymphocytes, monocyte/macrophage + neutrophil precursors (the

myelomonocytes), and erythrocytes. In contrast to HSC precursors (Supplemental Figure

1B, 2.8±0.7% of all cells in Pred. vs. 1.4±0.2% in DMSO) and erythrocytes (Supplemental

Figure 1C, 24.6±1.1% of all cells in Pred. vs. 23.0±1.5% in DMSO), the number of

myelomonocytes in the kidney of fish treated with prednisolone was significantly reduced

(Figure 1G, 4.4±0.3% of all cells in Pred. vs. 10.3±0.8% in DMSO). Lymphocytes, which are

a known target of glucocorticoids in mammals (49), were reduced as well (Figure 1H,

4.6±0.6% of all cells in Pred. vs. 7.1±0.7% DMSO), indicating immune suppression.

To confirm immunosuppression in zebrafish, we treated uninjured zebrafish for 2 days with

prednisolone and tested the expression levels of cxcl8a and tnf-α, cytokines released by

activated macrophages and other immune cells, by qRT-PCR. Indeed, expression of both

genes was reduced about 3-fold (Figure 1I and J, 30+9/-7% in Pred. vs. 100+44/-31% in

DMSO for tnf-α and 33+9/-7% in Pred. vs. 100+34/-26% for cxcl8a).

In contrast to the inhibitory effect of glucocorticoids on myelomonocytes and lymphocytes,

the number of neutrophils in humans undergoing corticosteroid therapy is not reduced.

Instead, treatment can lead to inhibition of neutrophil apoptosis, which is counter-productive

11
in neutrophil-dominated inflammatory diseases such as asthma and chronic obstructive

pulmonary disease (50). In zebrafish, neutrophils are rapidly recruited to sites of injury (32).

Thus, in order to investigate the effects of prednisolone on neutrophils, we used fin

amputation and fin regeneration regimes in adult fish (e.g. (20)). The caudal fins of transgenic

mpx:GFP zebrafish, in which neutrophils are labelled by GFP, were transsected and fish were

treated with prednisolone for 1 day. The number of neutrophils that are recruited into the

forming regenerate did not significantly change with prednisolone treatment (Figure 1K,

0.11±0.1 cells/µm2 in Pred. vs. 0.13±0.09 cells/µm2 in DMSO ).

Together, these results show that prednisolone treatment rapidly leads to programmed cell

death in the monocyte/macrophage lineage, and that longer treatment inhibits the generation

of new myelomonocytes from their precursors. As macrophages within different tissues are

affected, our results also show that prednisolone administration in larval and adult zebrafish

induces systemic immune suppression. Neutrophil recruitment to sites of injury is however

unaffected.

Bone inhibitory effects of prednisolone in zebrafish bone formation, homeostasis and

regeneration

We next characterized the effects of short- and long-term prednisolone treatment on bone

formation in zebrafish larvae. To this aim, we employed a previously described protocol to

induce larval GIO (28), with some minor modifications (see Methods). Treatment of 6 dpf

(days post fertilization) larvae with prednisolone for 5 days, followed by alizarin red staining,

shows that bone formation in the developing head and spine is reduced upon treatment

(Figure 2A and B, 49±19% in Pred. vs. 100±30% in DMSO). A similar inhibition of bone

formation in treated larvae was observed by calcein staining (Figure 2C and D, 63±14% in

Pred. vs. 100±8% in DMSO). These results are in agreement with previous reports (28, 51),

and clearly indicate glucocorticoid-induced inhibition of bone formation during ontogeny.

12
We next sought to delineate the effects of glucocorticoid treatment during homeostatic bone

formation in exoskeletal elements of zebrafish. To this end, we treated adult zebrafish with

prednisolone and control substance, respectively, for 6 weeks. Following treatment,

exoskeletal bony elements of the fins (bony fin rays or lepidotrichiae), which grow by distal

addition of bone throughout life (52), were visualized by alizarin red staining and their length

was measured. Prednisolone treated fins showed significantly shorter domains of alizarin red+

bone matrix (as percentage of the fin length distal to the first bifurcation) than fins treated

with control substance (Figure 2E and F, Supplemental Figure 2A, 65±7% in Pred. vs.

74±3% in DMSO). Conversely, prednisolone treated fins showed longer alizarin red- domains

at the fin tips than their controls (Figure 2E and F, Supplemental Figure 2A, 35±7% in

Pred. vs. 26±3% in DMSO). Thus, bone formation is impaired by prednisolone treatment

during homeostatic bone formation in the exoskeletal fin rays of adult fish.

Next, we asked whether prednisolone treatment would affect homeostatic bone formation in

bones of the endoskeleton, too. To test this, we treated zebrafish for 4 weeks with

prednisolone or control substance, and quantified whole body bone mineral density, i.e. the

amount of bone mineral in all bone tissues of zebrafish, by µCT (voxel size 10.5µm).

Surprisingly, we did not detect a significant change in bone mineral density due to

prednisolone treatment (Supplemental Figure 2B, 772.6±8.1mg HA/cm3 in Pred. vs.

761.2±15.6mg HA/cm3 in DMSO). Similarly, bone volume was unchanged (data not shown).

We hypothesized that inhibitory effects of prednisolone on the zebrafish endoskeleton require

longer treatments. We thus treated zebrafish for 8 weeks and scanned selected vertebrae via

µCT at a higher resolution (voxel size 4.6µm). Again, there was no significant difference in

bone volume between prednisolone and control substance treated vertebrae (Figure 2G,

0.0271±0.0063mm3 in Pred. vs. 0.0271±0.0062mm3 in DMSO). These results indicate that

prednisolone treatment in zebrafish does not manifest in inhibition of endoskeletal

homeostatic bone formation.

13
Next, we determined whether prednisolone treatment alters fin regeneration after amputation,

as suggested by studies of other synthetic glucocorticoids (53-55). We resected the caudal fin

of adult fish by 50% and treated the fish with prednisolone and control substance,

respectively, for up to 27 days, and imaged the fins repeatedly during this time. Regeneration

of the fin, as assayed by fin regenerate length, was significantly reduced from day 7 of

treatment onwards (Figure 2H, 0.49±0.16mm in Pred. vs. 0.68±0.07mm in DMSO at 4 dpa,

1.19±0.13 in Pred. vs. 1.53±0.09 in DMSO at 7 dpa); from this time, prednisolone treated

regenerates stayed significantly shorter and reached their maximum length at 14 dt, while

control regenerates elongated further (Figure 2H, 1.37±0.14 in Pred. vs. 1.88±0.16 in DMSO

at 9 dpa, 1.70±0.20 in Pred. vs. 2.44±0.25mm in DMSO at 14 dpa, 1.87±0.26 in Pred. vs.

2.70±0.22 in DMSO at 17 dpa, 1.73±0.14 in Pred. vs. 2.95±0.19 in DMSO at 22 dpa,

1.80±0.21 in Pred. vs. 3.04±0.20 in DMSO at 27 dpa).

We thus asked whether bone formation during regeneration is affected by prednisolone

treatment. In fin regenerates, the accumulation of osterix+ cells predicts the formation of bone

matrix within the regenerating fin ray ((22) and data not shown). Accordingly, to further

investigate the effects on bone formation in the regenerating fin, we used transgenic

osterix:nGFP fish, in which maturing osteoblasts are labeled by GFP (31). Prednisolone

treatment led to a marked reduction in the GFP+ domain length in the regenerate of these fish,

suggesting reduced bone matrix formation (Figure 2I, J, 2.3±0.2mm in Pred. vs. 3.1±0.4mm

in DMSO and Supplemental Figure 2C, D, 0.37±0.12mm in Pred. vs. 0.49±0.09mm in

DMSO at 4 dpa, 1.06±0.13mm in Pred. vs. 1.34±0.09mm in DMSO at 7 dpa, 1.27±0.15mm in

Pred. vs. 1.77±0.12mm in DMSO at 9 dpa, 1.57±0.19mm in Pred. vs. 2.29±0.27 in DMSO at

14 dpa, 1.63±0.21 in Pred. vs. 2.61±0.18 in DMSO at 17 dpa, 1.63±0.15mm in Pred. vs.

2.87±0.22mm in DMSO at 22 dpa, 1.69±0.22mm in Pred. vs. 2.92±0.19mm in DMSO at 27

dpa). Also, the length of alizarin red+ bone matrix within the regenerates was slightly

diminished after prednisolone treatment (Figure 2K, 1.44±0.45mm in Pred. vs. 2.05±0.35 in

14
DMSO). However, the observed reduction in the length of the osterix+ domain and the

alizarin red+ domain of bone formation was accompanied by an overall decrease of fin

regenerate length, and was in fact proportionate (Supplemental Figure 2E, alizarin red+

domain length (% of total regenerate length): 36±5% in Pred. vs. 40±5% in DMSO; alizarin

red- domain length (% of total regenerate length): 64±5% in Pred. vs. 60±5% in DMSO). This

indicates an overall inhibitory effect of prednisolone on fin regeneration, including the

regeneration of bone in the fin.

Lepidotrichal bone lacks homologous bone in the mammalian skeleton (14). We therefore

also determined the effect of prednisolone treatment on regeneration of the Os frontale, a

skull bone found in the calvariae of all vertebrates. To this end, we performed a trepanation of

this bone (i.e., we drilled a hole), and subsequently treated the fish with prednisolone. At 14

days post injury (dpi) and dt, the GFP+ domain in skull-injured osterix:nGFP zebrafish did

not completely cover the injured area, while injuries in control treated fish were fully covered

with GFP+ cells at the same time (Figure 2L, area not yet covered 0.008±0.009mm2 in Pred.

vs. 0.000±0.001mm2 in DMSO). In agreement with this observation, we noted a decreased

formation of mineralized bone matrix (Figure 2M) in trepanated fish after 7 dpi and dt.

Notably, the amount of bone matrix formed at a later time point (27 dpi and dt) did not differ

significantly, indicating that bone regeneration in the skull is delayed but not fully abrogated

(Figure 2N, area filled with new bone 98±1% in Pred. vs. 98±3% of injury filled and

Supplemental Figure 2F).

These results illustrate the capacity of prednisolone to inhibit bone formation during processes

of bone regeneration, and suggest that impaired osteoblast function might contribute to this

inhibition.

Effects of prednisolone on osteoblast proliferation, differentiation and survival

15
To unravel how prednisolone might reduce bone formation in different contexts in zebrafish,

we studied the cellular effects of prednisolone treatment on bone forming osteoblasts. In

conditions of GIO in mammals, osteoblasts undergo increased apoptosis, while both their

activity and genesis are reduced at the same time (4). As the osterix+ osteoblast population

appeared overall affected by prednisolone treatment, we used osterix:nGFP fish to quantify

the number and activity of osteoblasts. The latter was quantified by gathering the intensity of

GFP fluorescence in fin regenerates and skull injuries (22). In both injury models, GFP

fluorescence in cells covering the regenerating tissue was weaker in prednisolone treated fish

than in the respective controls (Figure 2K, 3A, average of all values along osterix+ domain in

fin ray 1.48±0.14 arbitrary units (AU) in Pred. vs. 2.46±0.11 AU in DMSO, and Figure 3B,

33.7±3.8 AU in Pred. vs. 43.1±2.2 AU in DMSO), supporting the idea that osterix+

osteoblasts reduce their bone-forming activity upon glucocorticoid administration.

To test whether the number of osterix+ osteoblasts in prednisolone treated fin regenerates was

diminished, we resected the caudal fins of zebrafish and treated them for 7 days with

prednisolone. Quantification showed that the number of osterix+ osteoblasts dropped in the

forming regenerate, although not significantly (Supplemental Figure 3A, 102±15 osterix+

cells/mm bone in Pred. vs. 113±10 osterix+ cells/mm bone in DMSO). In contrast, the

number of osterix+ osteoblasts per mm bone was unaffected at 4 days post amputation (dpa)

and days of treatment (dt) (data not shown).

We hypothesized that the decline in osterix+ cells at 7 dpa and dt might result from osteoblast

apoptosis at an earlier time point, and therefore tested for the presence of osterix+, TUNEL+

osteoblasts at 4 dpa and dt. Surprisingly, we did not detect a significant amount of TUNEL+

cells in the osterix+ cell population of prednisolone treated fin samples (Figure 3C,

0.003±0.002% in Pred. vs. 0.005±0.002% in DMSO). Moreover, prednisolone treatment did

not lead to increased osteoblast apoptosis in prednisolone treated larvae (Supplemental

Figure 3B, 4.95±1.46% of osterix+ osteoblasts in 1 dt Pred., 2.08±0.3% in 2 dt Pred.,

16
2.98±2.70 in 5 dt Pred. vs. 3.52±0.68 in 5 dt DMSO), although there was a reduced number of

osteoblasts in larvae after 5 dt (Supplemental Figure 3C, 9.74±2.79 osterix+

osteoblasts/section in Pred. vs. 16.85±4.69 osterix+ osteoblasts/section in DMSO). This

contrasts with the situation in mammals, including humans, which show a strong induction of

osteoblast apoptosis upon glucocorticoid administration (4).

Because apoptosis appeared not to cause the reduction of osteoblast numbers after

prednisolone treatment in regenerating bone, we investigated whether decreased proliferative

activity of osterix+ osteoblasts might explain the effect of prednisolone. Indeed, osteoblast

proliferation, as assayed by immunohistochemistry for PCNA (proliferating cell nuclear

antigen), was significantly reduced in regenerating fins treated with prednisolone at 4 dpa and

dt (Figure 3D and E, Mean (SD): 1.6±0.9 PCNA+ osteoblasts/mm bone in Pred. vs. 5.6±3.0

PCNA+ osteblasts/mm bone in DMSO and 0.1±0.3 in untreated & uninjured). These results

show that osteoblastogenesis as measured by impaired proliferation, is severely reduced in

zebrafish undergoing bone regeneration and simultaneous prednisolone treatment.

Conversely, proliferation of osteoblasts lining vertebral, endoskeletal bone was generally rare

and unaltered after prednisolone treatment (Supplemental Figure 3D, 0.000±0.000% in Pred.

vs. 0.001±0.002% in DMSO). This indicates that osteoblast proliferation after prednisolone

treatment is particularly affected in bone tissue undergoing enhanced proliferation, such as

during regeneration or directed growth in the fin tips, but not in tissues displaying low rates of

osteoblast proliferation.

Reduced bone matrix formation upon prednisolone treatment might not only result from

reduced osteoblastogenesis and decreased osterix-activity, but could also result from a failure

of osteoblasts to undergo osteogenic differentiation. To test this possibility, we incubated fish

in prednisolone and performed qRT-PCR on the two runx2-genes (runx2a/b) in zebrafish fin

tissue. Additionally, we quantified the expression of GFP in transgenic runx2:GFP reporter

fish that underwent fin resection and prednisolone administration. Interestingly, in contrast to

17
osterix gene expression in osterix:nGFP fish, runx2 expression in both experimental settings

was unchanged after prednisolone administration (Figure 3F, runx2a: 95+10/-9% in Pred. vs.

100+26/-21 % in DMSO, G and Supplemental Figure 3E, runx2b: 75+10/-9% in Pred. vs.

100+23/-18% in DMSO).

We then assayed for the expression of osteocalcin (bglap), a gene which is active in

terminally differentiating osteoblasts, via qRT-PCR, and detected a 3-fold reduction at 4 dpa

and dt (Figure 3H, 28+13/-9% in Pred. vs. 100+19/-16% in DMSO). Furthermore, GFP

fluorescence in fin regenerates of transgenic osteocalcin:GFP reporter fish, in which

terminally differentiating osteoblasts are labeled by GFP, was severely reduced in regenerates

undergoing a longer treatment with prednisolone (Figure 3I). This suggests that osteoblasts

do not fail in initiating osteogenic differentiation but instead are hindered at a later maturation

stage, a time when osterix and osteocalcin gene expression are expressed.

Effects of prednisolone on osteoclast recruitment, number and activity

In the initial phase of GIO, glucocorticoid treatment increases genesis, life span and activity

of mammalian osteoclasts, leading to increased bone resorption (4, 56). Longer treatments,

however, rather impair osteoclast function in mammalian bone tissue by decreasing

osteoclastogenesis (57).

In order to better understand the detrimental effects of glucocorticoids on bone tissue in fish,

we also investigated the effects of prednisolone on TRAP+ (tartrate resistant acid

phosphatase) cells in zebrafish larvae and adults. In larvae that had been treated with

prednisolone for 2 days, TRAP staining revealed that TRAP+ cells, very likely representing

osteoclasts, were decreased to less than half of the control (Figure 4A and B, 20.8±7.0

TRAP+ cell accumulations compared to 45.2±16.9 TRAP+ cell accumulations in the DMSO

control). Also, larvae that had undergone longer prednisolone treatments showed a significant

reduction in number of TRAP+ cells (data not shown). The rapid inhibitory effect of

18
prednisolone on these cells indicates that zebrafish lack the initial phase of enhanced

osteoclastogenesis and function, which is reported for mammals. The observed reduction in

TRAP+ cell number after longer prednisolone treatments, however, appears to better reflect

the situation in mammals.

We also assayed the number of osteoclasts after prednisolone treatment in adult fish. In fish

undergoing fin regeneration and simultaneous prednisolone treatment for 4 days, the number

of osteoclasts in the forming regenerate was reduced to about half compared to the control

(Figure 4C and D, 54.4±10.9 TRAP+ cell accumulations compared to 122.7±10.6 TRAP+

cell accumulations in DMSO). Conversely, osteoclast numbers at a distance from the

amputation plane, in the part of the fin stump, were slightly elevated upon treatment (Figure

4E, 55.5±14.3 TRAP+ cell accumulations in Pred. compared to 39.6±8.9 TRAP+ cell

accumulations in DMSO). This might indicate a failure of osteoclast recruitment from the fin

stump to the forming regenerate due to prednisolone treatment. Osteoclast numbers both in

the regenerate and the stump of the injured fin combined, however, were significantly lower

in prednisolone treated fins (Supplemental Figure 4A, 109.9±41.0 TRAP+ cell

accumulations in Pred. vs. 162.3±18.7 TRAP+ cell accumulations in DMSO), indicating an

overall inhibition of the formation of osteoclasts. This impairment might largely result from

inhibited myelomonocyte formation in the kidney of adult fish (see above). Taken together,

our results show that prednisolone treatment strongly reduces the number of osteoclasts, and

in addition might affect osteoclast migration from stump tissue into the regenerate.

Discussion

Long-term administration of synthetic glucocorticoids, even at low doses, leads to GIO in two

third of treated patients (58). The deleterious effects of glucocorticoids on bone tissue have

been known for decades, however, the underlying cellular mechanisms of glucocorticoid

action in GIO are incompletely understood. For example, the individual contributions of

19
impaired osteoblast versus osteoclast function in the pathogenesis of GIO have been

controversial (3, 58). Furthermore, different small and big animal models respond differently

to synthetic glucocorticoid treatment (59). Here, we characterized the immunosuppressive and

bone inhibitory effects of the glucocorticoid prednisolone in zebrafish, a small vertebrate

animal model which has become popular in skeletal research. We present a comprehensive

study on the anti-inflammatory and bone-inhibitory effects of prednisolone at different ages

and in different contexts of zebrafish tissue regeneration and homeostasis. In particular, we

give a detailed report of prednisolone-induced effects relating to proliferation and apoptosis in

immune and bone cells. Thereby, we add insight to the multifaceted effects of glucocorticoids

in vivo and provide a strong basis for GIO research in zebrafish.

Immunosuppressive effects of prednisolone in fish

Glucocorticoids are potent immunosuppressive drugs used to treat inflammatory diseases. In

zebrafish, immunosuppressive effects of synthetic glucocorticoids other than prednisolone

have been reported. For example, beclomethasone leads to attenuation of the inflammatory

response in zebrafish larvae whose fin fold had been amputated (60). Kyritsis et al. (2012)

(61) reported down-regulation of cxcl8a, il-1β and tnf-α upon dexamethasone treatment in the

course of brain regeneration. Furthermore, reduced macrophage numbers were shown to result

from dexamethasone treatment in wounded zebrafish fin fold tissue (62). In this context, also

abberant migration of macrophages and neutrophils in the wounded tissue has been reported

(60, 62).

We addressed the immunosuppressive efficacy of prednisolone in larval and adult zebrafish

and focused on macrophages as powerful mediators of inflammation. Prednisolone treatment

significantly reduced the generation of myelomonocytes, the macrophage 'precursors', and

rapidly decreased macrophage number in larval and adult tissues. This decrease was

attributable to induction of apoptosis, similar to what has been reported for rodent models of

20
GIO (63, 64). Similarly, human monocytes undergo enhanced apoptosis upon glucocorticoid

treatment (65).

In line with results of Kyritsis et al. (61) we noted reduced expression levels of cxcl8a and tnf-

α, two inflammatory cytokines produced by activated macrophages in regenerating zebrafish

fins, confirming reduced macrophage number and function. We did not, however, detect

altered neutrophil numbers in adult regenerating fins, unlike the reported effects of

beclomethasone in larval wounded fin fold tissue (60). This might reflect differences in

regenerative strategies of larval versus adult fins or might relate to the structural differences

of the injured tissues. Notably, glucocorticoids have been reported to improve, rather than

diminish, neutrophil survival in mammals (50). Thus, our results illustrate the

immunomodulatory capacity of prednisolone in zebrafish and demonstrate larval and adult

treatment paradigms as valuable tools to model immune-mediated effects of glucocorticoids

in vivo.

Bone inhibitory effects of prednisolone during zebrafish bone formation and bone

homeostasis

GIO results from inhibitory effects of synthetic glucocorticoids during bone growth and tissue

homeostasis. Here, we show that deposition of bone matrix is negatively affected by

prednisolone treatment also in zebrafish, both during development and in tissue homeostasis

of fins. In growing larvae and homeostatic adult fins, prednisolone treatment reduced the

presence of mineralized bone matrix. This is in line with reports in rodent in vivo and in vitro

models of glucocorticoid action on bone (66, 67), and corresponds to recently published

results in zebrafish larvae and scales (30, 51). However, as µCT analyses showed, bone

volume of endoskeletal bones, in particular of the spine, is not affected by prednisolone

treatment. This is in contrast to observed glucocorticoid side effects in patients, which

21
undergo long term immune suppressive therapy. These patients often present with bone loss

in the spine, and increased vertebral fracture incidence (68). The reason for this discrepancy is

unclear; however, we suspect that both the low proliferative rate of osteoblasts in the

zebrafish spine and the continuous anti-catabolic effects of prednisolone might be of

importance (see below).

Anti-regenerative effects of prednisolone in fish

Besides their bone inhibitory effects on development and tissue homeostasis, natural and

synthetic glucocorticoids have been shown to exert anti-regenerative effects. For instance,

prednisolone impairs callus formation and endochondral ossification during fracture repair in

mice (69). In zebrafish, increased cortisol secretion due to stress after crowding as well as

dexamethasone treatment (mimicking a stress response) impair regeneration after cryoinjury

of the heart (70). Likewise, fin regeneration is inhibited by dexamethasone treatment (61, 62).

Furthermore, administration of prednisolone leads to impaired scale regeneration in adult

zebrafish (29).

Here, we show that regeneration of adult zebrafish fins after amputation is affected by

prednisolone treatment. In particular, outgrowth of the regenerate and, correspondingly, the

length of the bone forming osterix+ domain are reduced, starting between day 4 and day 7

post amputation. Later on, fin regenerates always remain shorter in prednisolone treated fish

and stop growing at around 2 weeks. This is in contrast to regenerating bone in the injured

zebrafish skull (which catches up after a while) and might reflect an exhaustion of pro-

regenerative cells at the growing tip of the fin. The fact that up to day 3 fin regenerates grow

normally suggests that initial stages of adult fin regeneration, namely wound epidermis and

blastema formation (71), proceed normally.

Effects of prednisolone on osteoblast proliferation, differentiation and survival

22
Both enhanced osteoblast apoptosis and decreased osteoblast proliferation account for the

development of GIO (3). In this study, we tested whether prednisolone exerts anti-

proliferative effects on vertebral bone during homeostasis. In agreement with the maintained

bone volume in the spine after long term treatment (see above), osteoblast proliferation was

not significantly reduced by prednisolone treatment. Of note, the inherent proliferative rate of

osteoblasts lining vertebral bone was also very low in control substance treated fish. This

indicates a low bone turnover in the zebrafish spine, which might partially explain the

resistence of the spine to prednisolone induced bone loss.

In contrast, fin regeneration, which goes hand in hand with enhanced cell proliferation in the

regenerate, was clearly affected by prednisolone treatment. The same is true for homeostatic

growth of uninjured fins at the fin tips, a process which proceeds through pulses of cell

proliferation (72). We thus suggest that glucocorticoids exert their bone inhibitory effects

mainly in highly proliferative tissues.

In the fin regenerate, reduced outgrowth in prednisolone treated fish is, at least in part, caused

by decreased cell proliferation, as shown for osteoblasts at 4 dpa. Remarkably, enhanced

osteoblast apoptosis was not detected, questioning whether osteoblast apoptosis contributes

significantly to the pathogenesis of GIO (58). However, elevated numbers of apoptotic cells in

the epidermis of the regenerate at these time points could be found (data not shown). This is

in agreement with previous studies reporting increased necrosis and apoptosis after

dexamethasone treatment in zebrafish larvae (62). Apoptosis in the wound epidermis might

add to the negative impact of prednisolone on tissue regeneration, since the wound epidermis

is of crucial importance during fin regeneration (73). Thus, glucocorticoid treatment

negatively affects both cell survival and generation of new cells in different regenerating

tissues.

In addition, osteogenic differentiation of bone forming cells is impaired by prednisolone

treatment. Both quantification of mRNA expression and reporter assays for osteoblast activity

23
during fin regeneration indicate that the pool of runx2+ preosteoblasts forms normally.

Caution is however warranted, because runx2 in mammalian cells is strongly regulated

posttranslationally (58), and this might also be the case in zebrafish. Certainly, further

osteogenic differentiation is hampered, as demonstrated by reduced osterix and osteocalcin

gene expression. Similar results have been obtained in mammalian studies, for example, Yao

et al. (2008) noted decreased alkaline phosphatase (alp) expression in prednisolone treated

mice, and reported a strong reduction of serum osteocalcin levels (74). Likewise, a study in

zebrafish scales undergoing prednisolone treatment demonstrated reduced alp expression

(30). This shows that osteoblasts in the regenerating fin face similar differentiation problems

due to glucocorticoid treatment as homeostatic mammalian and teleost bone tissue.

Effects of prednisolone on osteoclast recruitment, number and activity

We suggest that decreased proliferation and differentiation of bone forming osteoblasts is a

major cause for reduced bone matrix formation after prednisolone treatment. In contrast to

studies in mammals, which report an increased osteoclast function during the initial stages of

GIO (74), we did not detect increased osteoclast activity or number following prednisolone

treatment. This might reflect a fundamental difference in bone biology between teleost fish

and mammals. However, others have demonstrated increased TRAP activity, increased

expression of osteoclastogenic genes and more resorption lacunae in zebrafish scales after

prednisolone treatment (29, 30). This might indicate that zebrafish scales react differently to

glucocorticoid treatment than other bones in larval and adult zebrafish.

In contrast to the situation in mammals, we detected reduced osteoclast numbers both during

larval and adult (regenerative) stages after short and long term treatment with prednisolone,

and thus an initial stage of enhanced bone resorption may be lacking.

Osteoclasts derive from myelomonocytic precursors (75); as we have shown here generation

of these cells is strongly reduced after prednisolone treatment. Furthermore, short term

24
treatment has profound effects on expression of tnf-α, an inflammatory cytokine which has

been shown to trigger osteoclastogenesis via promotion of RANKL (receptor activator of NF-

κB ligand) (76). Likewise, expression of cxcl8a, an orthologue of human CXCL8, is decreased

after short term prednisolone treatment. Notably, CXCL8 can indirectly trigger

osteoclastogenesis by increasing IL-6 levels in osteoblasts in tissue culture (77), thus low

level expression might reduce osteoclastogenesis triggered by osteoblasts.

Together, these observations indicate a strong anti-osteoclastogenic effect of prednisolone in

zebrafish. We suspect that this anti-catabolic effect also exists in homeostatic endoskeletal

bones of zebrafish, in addition to or in conjunction with low bone turn-over, thereby

contributing to the spine's resistence to treatment. This hypothesis, however, awaits further

testing.

In regenerating fins, we noted an altered distribution of osteoclasts in the fin stump versus fin

regenerate in prednisolone treated fish. This is indicative of a defective osteoclast recruitment

to sites of bone breakdown and repair and could be an additional cause for impaired fin

regeneration. While aberrant migration of cells after glucocorticoid treatment has been

reported for immune cells such as macrophages and neutrophils (60, 62), to our knowledge

aberrant recruitment of osteoclasts due to glucocorticoids and possible consequences of such

malfunction have not been investigated in the context of GIO. A detailed analysis of

osteoclast motility in zebrafish regenerating fins that undergo prednisolone treatment will give

further insight into this topic.

Conclusions

In conclusion, we present a comprehensive study of prednisolone-induced effects in different

experimental paradigms of bone formation in zebrafish. We observed rapid anti-

inflammatory, bone inhibitory and anti-regenerative effects upon treatment. Reduced bone

formation resulted from impaired osteoblast proliferation and differentiation, rather than

25
osteoblast apoptosis or enhanced osteoclast activity. Instead, defective recruitment of

osteoclasts to sites of bone remodelling was observed. Of note, bone volume of homeostatic

endoskeletal bones was unaffected by prednisolone treatment. Further experiments are needed

to reveal the molecular basis underlying the observed cellular effects of prednisolone

treatment in zebrafish.

Acknowledgements

This study was supported by a grant of the Center of Regenerative Therapies Dresden

("Zebrafish as a model to unravel the mechanisms of glucocorticoid-induced bone loss") to

FK, and by grants of the Technische Universität Dresden (Support-the-best grant) and the

European Union (ERC advanced grant Zf-BrainReg) to MB. The SkyScan 1172 µCT scanner

was funded by the British Heart Foundation Centre for Research Excellence. Experiments

were designed, performed and analyzed by KG and FK. µCT analyses were performed by

AV, AF, MR and KG. All authors interpreted experiments and edited the manuscript. FK and

KG wrote the manuscript and accept responsibility for the integrity of data analysis. We are

thankful to Bogdana Borodkina for technical assistance. We would like to thank the Light

Microscopy and FACS facilities, core facilities of the BIOTEC/CRTD at the Technische

Universität Dresden, and Marika Fischer and Jitka Michling for excellent fish care.

26
References

1. Kanis JA, Johnell O. Requirements for DXA for the management of osteoporosis in

Europe. Osteoporos Int. 2005;16(3):229-38. Epub 2004/12/25.

2. den Uyl D, Bultink IE, Lems WF. Advances in glucocorticoid-induced osteoporosis.

Current rheumatology reports. 2011;13(3):233-40. Epub 2011/03/03.

3. Hofbauer LC, Rauner M. Minireview: live and let die: molecular effects of

glucocorticoids on bone cells. Mol Endocrinol. 2009;23(10):1525-31. Epub 2009/05/30.

4. Weinstein RS, Jilka RL, Parfitt AM, Manolagas SC. Inhibition of osteoblastogenesis

and promotion of apoptosis of osteoblasts and osteocytes by glucocorticoids. Potential

mechanisms of their deleterious effects on bone. J Clin Invest. 1998;102(2):274-82. Epub

1998/07/17.

5. Plotkin LI, Manolagas SC, Bellido T. Glucocorticoids induce osteocyte apoptosis by

blocking focal adhesion kinase-mediated survival. Evidence for inside-out signaling leading

to anoikis. J Biol Chem. 2007;282(33):24120-30. Epub 2007/06/22.

6. Moutsatsou P, Kassi E, Papavassiliou AG. Glucocorticoid receptor signaling in bone

cells. Trends in molecular medicine. 2012;18(6):348-59. Epub 2012/05/15.

7. Driever W, Solnica-Krezel L, Schier AF, Neuhauss SC, Malicki J, Stemple DL, et al.

A genetic screen for mutations affecting embryogenesis in zebrafish. Development.

1996;123:37-46. Epub 1996/12/01.

8. Haffter P, Granato M, Brand M, Mullins MC, Hammerschmidt M, Kane DA, et al.

The identification of genes with unique and essential functions in the development of the

zebrafish, Danio rerio. Development. 1996;123:1-36. Epub 1996/12/01.

9. Peterson RT, Link BA, Dowling JE, Schreiber SL. Small molecule developmental

screens reveal the logic and timing of vertebrate development. Proc Natl Acad Sci U S A.

2000;97(24):12965-9. Epub 2000/11/23.

27
10. Yu PB, Hong CC, Sachidanandan C, Babitt JL, Deng DY, Hoyng SA, et al.

Dorsomorphin inhibits BMP signals required for embryogenesis and iron metabolism. Nat

Chem Biol. 2008;4(1):33-41. Epub 2007/11/21.

11. Kaufman CK, White RM, Zon L. Chemical genetic screening in the zebrafish embryo.

Nat Protoc. 2009;4(10):1422-32. Epub 2009/09/12.

12. Barros TP, Alderton WK, Reynolds HM, Roach AG, Berghmans S. Zebrafish: an

emerging technology for in vivo pharmacological assessment to identify potential safety

liabilities in early drug discovery. Br J Pharmacol. 2008;154(7):1400-13. Epub 2008/06/17.

13. Huitema LF, Apschner A, Logister I, Spoorendonk KM, Bussmann J, Hammond CL,

et al. Entpd5 is essential for skeletal mineralization and regulates phosphate homeostasis in

zebrafish. Proc Natl Acad Sci U S A. 2012;109(52):21372-7. Epub 2012/12/14.

14. Marí-Beffa M, Santamaria JA, Murciano C, Santos-Ruiz L, Andrades JA, Guerado E,

et al. Zebrafish fins as a model system for skeletal human studies.

TheScientificWorldJOURNAL. 2007;7:1114-27.

15. Andreeva V, Connolly MH, Stewart-Swift C, Fraher D, Burt J, Cardarelli J, et al.

Identification of adult mineralized tissue zebrafish mutants. Genesis. 2011;49(4):360-6. Epub

2011/01/13.

16. Parsons KJ, Andreeva V, James Cooper W, Yelick PC, Craig Albertson R.

Morphogenesis of the zebrafish jaw: development beyond the embryo. Methods Cell Biol.

2011;101:225-48. Epub 2011/05/10.

17. Olsen AS, Sarras MP, Jr., Intine RV. Limb regeneration is impaired in an adult

zebrafish model of diabetes mellitus. Wound Repair Regen. 2010;18(5):532-42. Epub

2010/09/16.

18. Cubbage CC, Mabee PM. Development of the cranium and paired fins in the zebrafish

Danio rerio (Ostariophysi, Cyprinidae). J Morphol. 1996;229:121-60.

28
19. Quint E, Smith A, Avaron F, Laforest L, Miles J, Gaffield W, et al. Bone patterning is

altered in the regenerating zebrafish caudal fin after ectopic expression of sonic hedgehog and

bmp2b or exposure to cyclopamine. Proceedings of the National Academy of Science.

2002;99(13):8713-8.

20. Knopf F, Hammond C, Chekuru A, Kurth T, Hans S, Weber CW, et al. Bone

Regenerates via Dedifferentiation of Osteoblasts in the Zebrafish Fin. Dev Cell.

2011;20(5):713-24. Epub 2011/05/17.

21. Singh SP, Holdway JE, Poss KD. Regeneration of amputated zebrafish fin rays from

de novo osteoblasts. Dev Cell. 2012;22(4):879-86. Epub 2012/04/21.

22. Geurtzen K, Knopf F, Wehner D, Huitema LF, Schulte-Merker S, Weidinger G.

Mature osteoblasts dedifferentiate in response to traumatic bone injury in the zebrafish fin and

skull. Development. 2014;141(11):2225-34. Epub 2014/05/14.

23. Apschner A, Schulte-Merker S, Witten PE. Not all bones are created equal - using

zebrafish and other teleost species in osteogenesis research. Methods Cell Biol.

2011;105:239-55. Epub 2011/09/29.

24. Weigele J, Franz-Odendaal TA. Functional bone histology of zebrafish reveals two

types of endochondral ossification, different types of osteoblast clusters and a new bone type.

J Anat. 2016;229(1):92-103. Epub 2016/06/10.

25. Witten PE, Huysseune A. A comparative view on mechanisms and functions of

skeletal remodelling in teleost fish, with special emphasis on osteoclasts and their function.

Biol Rev Camb Philos Soc. 2009;84(2):315-46. Epub 2009/04/23.

26. Li N, Felber K, Elks P, Croucher P, Roehl HH. Tracking gene expression during

zebrafish osteoblast differentiation. Dev Dyn. 2009;238(2):459-66. Epub 2009/01/24.

27. Brittijn SA, Duivesteijn SJ, Belmamoune M, Bertens LF, Bitter W, de Bruijn JD, et al.

Zebrafish development and regeneration: new tools for biomedical research. Int J Dev Biol.

2009;53(5-6):835-50. Epub 2009/06/27.

29
28. Barrett R, Chappell C, Quick M, Fleming A. A rapid, high content, in vivo model of

glucocorticoid-induced osteoporosis. Biotechnol J. 2006;1(6):651-5. Epub 2006/08/08.

29. de Vrieze E, van Kessel MA, Peters HM, Spanings FA, Flik G, Metz JR. Prednisolone

induces osteoporosis-like phenotype in regenerating zebrafish scales. Osteoporos Int.

2014;25(2):567-78. Epub 2013/08/02.

30. Pasqualetti S, Congiu T, Banfi G, Mariotti M. Alendronate rescued osteoporotic

phenotype in a model of glucocorticoid-induced osteoporosis in adult zebrafish scale.

International journal of experimental pathology. 2015;96(1):11-20. Epub 2015/01/22.

31. Spoorendonk KM, Peterson-Maduro J, Renn J, Trowe T, Kranenbarg S, Winkler C, et

al. Retinoic acid and Cyp26b1 are critical regulators of osteogenesis in the axial skeleton.

Development. 2008;135(22):3765-74. Epub 2008/10/18.

32. Ellett F, Pase L, Hayman JW, Andrianopoulos A, Lieschke GJ. mpeg1 promoter

transgenes direct macrophage-lineage expression in zebrafish. Blood. 2011;117(4):e49-56.

Epub 2010/11/19.

33. Renshaw SA, Loynes CA, Trushell DM, Elworthy S, Ingham PW, Whyte MK. A

transgenic zebrafish model of neutrophilic inflammation. Blood. 2006;108(13):3976-8. Epub

2006/08/24.

34. Brand M, Granato M, Nüsslein-Volhard C. Keeping and raising zebrafish. In:

Nüsslein-Volhard C, Dahm R, editors. Zebrafish: A Practical Approach. New York: Oxford

University Press; 2002. p. 7-37.

35. Poss KD, Shen J, Keating MT. Induction of lef1 during zebrafish fin regeneration.

Developmental Dynamics. 2000;219:282-6.

36. Blum N, Begemann G. Osteoblast de- and redifferentiation are controlled by a

dynamic response to retinoic acid during zebrafish fin regeneration. Development.

2015;142(17):2894-903. Epub 2015/08/09.

30
37. Grandel H, Kaslin J, Ganz J, Wenzel I, Brand M. Neural stem cells and neurogenesis

in the adult zebrafish brain: origin, proliferation dynamics, migration and cell fate. Dev Biol.

2006;295(1):263-77. Epub 2006/05/10.

38. Traver D, Winzeler A, Stern HM, Mayhall EA, Langenau DM, Kutok JL, et al. Effects

of lethal irradiation in zebrafish and rescue by hematopoietic cell transplantation. Blood.

2004;104(5):1298-305. Epub 2004/05/15.

39. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time

quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-8. Epub

2002/02/16.

40. Guihard P, Danger Y, Brounais B, David E, Brion R, Delecrin J, et al. Induction of

Osteogenesis in Mesenchymal Stem Cells by Activated Monocytes/Macrophages Depends on

Oncostatin M Signaling. STEM CELLS. 2012;30(4):762-72.

41. Nicolaidou V, Wong MM, Redpath AN, Ersek A, Baban DF, Williams LM, et al.

Monocytes Induce STAT3 Activation in Human Mesenchymal Stem Cells to Promote

Osteoblast Formation. PLoS One. 2012;7(7):e39871.

42. Fernandes TJ, Hodge JM, Singh PP, Eeles DG, Collier FM, Holten I, et al. Cord

Blood-Derived Macrophage-Lineage Cells Rapidly Stimulate Osteoblastic Maturation in

Mesenchymal Stem Cells in a Glycoprotein-130 Dependent Manner. PLoS One.

2013;8(9):e73266.

43. Chang MK, Raggatt LJ, Alexander KA, Kuliwaba JS, Fazzalari NL, Schroder K, et al.

Osteal tissue macrophages are intercalated throughout human and mouse bone lining tissues

and regulate osteoblast function in vitro and in vivo. J Immunol. 2008;181(2):1232-44. Epub

2008/07/09.

44. Alexander KA, Chang MK, Maylin ER, Kohler T, Muller R, Wu AC, et al. Osteal

macrophages promote in vivo intramembranous bone healing in a mouse tibial injury model. J

Bone Miner Res. 2011;26(7):1517-32. Epub 2011/02/10.

31
45. Russo-Marie F. Macrophages and the glucocorticoids. Journal of neuroimmunology.

1992;40(2-3):281-6. Epub 1992/10/01.

46. Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation.

Nature reviews Immunology. 2008;8(12):958-69. Epub 2008/11/26.

47. Davidson AJ, Zon LI. The 'definitive' (and 'primitive') guide to zebrafish

hematopoiesis. Oncogene. 2004;23(43):7233-46. Epub 2004/09/21.

48. Traver D, Paw BH, Poss KD, Penberthy WT, Lin S, Zon LI. Transplantation and in

vivo imaging of multilineage engraftment in zebrafish bloodless mutants. Nat Immunol.

2003;4(12):1238-46. Epub 2003/11/11.

49. Distelhorst CW. Recent insights into the mechanism of glucocorticosteroidinduced

apoptosis. Cell Death Differ. 2002;9(1):6-19.

50. Saffar AS, Ashdown H, Gounni AS. The molecular mechanisms of glucocorticoids-

mediated neutrophil survival. Current drug targets. 2011;12(4):556-62. Epub 2011/04/20.

51. Luo SY, Chen JF, Zhong ZG, Lv XH, Yang YJ, Zhang JJ, et al. Salvianolic acid B

stimulates osteogenesis in dexamethasone-treated zebrafish larvae. Acta pharmacologica

Sinica. 2016;37(10):1370-80. Epub 2016/08/30.

52. Goldsmith MI, Fisher S, Waterman R, Johnson SL. Saltatory control of isometric

growth in the zebrafish caudal fin is disrupted in long fin and rapunzel mutants. Dev Biol.

2003;259(2):303-17. Epub 2003/07/23.

53. Oppedal D, Goldsmith MI. A chemical screen to identify novel inhibitors of fin

regeneration in zebrafish. Zebrafish. 2010;7(1):53-60. Epub 2010/04/14.

54. Ochandio BS, Bechara IJ, Parise-Maltempi PP. Dexamethasone action on caudal fin

regeneration of carp Cyprinus carpio (Linnaeus, 1758). Brazilian journal of biology = Revista

brasleira de biologia. 2015;75(2):442-50. Epub 2015/07/02.

32
55. Mathew LK, Sengupta S, Kawakami A, Andreasen EA, Löhr CV, Loynes CA, et al.

Unraveling tissue regeneration pathways using chemical genetics. The Journal of Biological

Chemistry. 2007;282(48):35202.

56. Hofbauer LC, Gori F, Riggs BL, Lacey DL, Dunstan CR, Spelsberg TC, et al.

Stimulation of osteoprotegerin ligand and inhibition of osteoprotegerin production by

glucocorticoids in human osteoblastic lineage cells: potential paracrine mechanisms of

glucocorticoid-induced osteoporosis. Endocrinology. 1999;140(10):4382-9. Epub 1999/09/28.

57. Buehring B, Viswanathan R, Binkley N, Busse W. Glucocorticoid-induced

osteoporosis: an update on effects and management. J Allergy Clin Immunol.

2013;132(5):1019-30.

58. Frenkel B, White W, Tuckermann J. Glucocorticoid-Induced Osteoporosis. Advances

in experimental medicine and biology. 2015;872:179-215. Epub 2015/07/29.

59. Komori T. Animal models for osteoporosis. Eur J Pharmacol. 2015;759:287-94. Epub

2015/03/31.

60. Chatzopoulou A, Heijmans JP, Burgerhout E, Oskam N, Spaink HP, Meijer AH, et al.

Glucocorticoid-Induced Attenuation of the Inflammatory Response in Zebrafish.

Endocrinology. 2016;157(7):2772-84. Epub 2016/05/25.

61. Kyritsis N, Kizil C, Zocher S, Kroehne V, Kaslin J, Freudenreich D, et al. Acute

inflammation initiates the regenerative response in the adult zebrafish brain. Science.

2012;338(6112):1353-6. Epub 2012/11/10.

62. Sharif F, Steenbergen PJ, Metz JR, Champagne DL. Long-lasting effects of

dexamethasone on immune cells and wound healing in the zebrafish. Wound Repair Regen.

2015;23(6):855-65. Epub 2015/09/06.

63. Haim YO, Unger ND, Souroujon MC, Mittelman M, Neumann D. Resistance of LPS-

activated bone marrow derived macrophages to apoptosis mediated by dexamethasone.

Scientific reports. 2014;4:4323. Epub 2014/03/13.

33
64. Nguyen KB, McCombe PA, Pender MP. Increased apoptosis of T lymphocytes and

macrophages in the central and peripheral nervous systems of Lewis rats with experimental

autoimmune encephalomyelitis treated with dexamethasone. Journal of neuropathology and

experimental neurology. 1997;56(1):58-69. Epub 1997/01/01.

65. Schmidt M, Pauels HG, Lugering N, Lugering A, Domschke W, Kucharzik T.

Glucocorticoids induce apoptosis in human monocytes: potential role of IL-1 beta. J

Immunol. 1999;163(6):3484-90. Epub 1999/09/08.

66. Yao W, Cheng Z, Pham A, Busse C, Zimmermann EA, Ritchie RO, et al.

Glucocorticoid-induced bone loss in mice can be reversed by the actions of parathyroid

hormone and risedronate on different pathways for bone formation and mineralization.

Arthritis Rheum. 2008;58(11):3485-97. Epub 2008/11/01.

67. Wang FS, Ko JY, Weng LH, Yeh DW, Ke HJ, Wu SL. Inhibition of glycogen

synthase kinase-3beta attenuates glucocorticoid-induced bone loss. Life sciences. 2009;85(19-

20):685-92. Epub 2009/09/29.

68. Amiche MA, Albaum JM, Tadrous M, Pechlivanoglou P, Levesque LE, Adachi JD, et

al. Fracture risk in oral glucocorticoid users: a Bayesian meta-regression leveraging control

arms of osteoporosis clinical trials. Osteoporos Int. 2016;27(5):1709-18. Epub 2015/12/24.

69. Doyon AR, Ferries IK, Li J. Glucocorticoid attenuates the anabolic effects of

parathyroid hormone on fracture repair. Calcif Tissue Int. 2010;87(1):68-76. Epub

2010/05/07.

70. Sallin P, Jazwinska A. Acute stress is detrimental to heart regeneration in zebrafish.

Open biology. 2016;6(3). Epub 2016/04/01.

71. Poss KD, Keating MT, Nechiporuk A. Tales of regeneration in zebrafish. Dev Dyn.

2003;226:202-10.

72. Jain I, Stroka C, Yan J, Huang WM, Iovine MK. Bone growth in zebrafish fins occurs

via multiple pulses of cell proliferation. Dev Dyn. 2007;236(9):2668-74. Epub 2007/08/07.

34
73. Wehner D, Weidinger G. Signaling networks organizing regenerative growth of the

zebrafish fin. Trends Genet. 2015;31(6):336-43. Epub 2015/05/02.

74. Yao W, Cheng Z, Busse C, Pham A, Nakamura MC, Lane NE. Glucocorticoid excess

in mice results in early activation of osteoclastogenesis and adipogenesis and prolonged

suppression of osteogenesis: a longitudinal study of gene expression in bone tissue from

glucocorticoid-treated mice. Arthritis Rheum. 2008;58(6):1674-86. Epub 2008/06/03.

75. Quinn JM, Gillespie MT. Modulation of osteoclast formation. Biochem Biophys Res

Commun. 2005;328(3):739-45. Epub 2005/02/08.

76. Greenblatt MB, Shim JH. Osteoimmunology: a brief introduction. Immune network.

2013;13(4):111-5. Epub 2013/09/07.

77. Pathak JL, Bakker AD, Verschueren P, Lems WF, Luyten FP, Klein-Nulend J, et al.

CXCL8 and CCL20 Enhance Osteoclastogenesis via Modulation of Cytokine Production by

Human Primary Osteoblasts. PLoS One. 2015;10(6):e0131041. Epub 2015/06/24.

Figure legends

Figure 1. Immunosuppressive effects of prednisolone in zebrafish

(A) Larval head regions of transgenic mpeg1:mCherry larvae at 11 dpf. Macrophage numbers

are strongly reduced after 1 day of prednisolone treatment. Red arrows = macrophages, white

dashed line = eyes and larva outline. Scale bar = 50 µm

(B) Quantification of experiment shown in A. Pred. = prednisolone. Mean (SD), Student’s t-

test: ** p<0.01 (0,009) (n = 4 DMSO, 3 Pred.)

(C) Quantification of TUNEL, mpeg1:mCherry double-positive apoptotic cells in larvae at 1

dt (day of treatment) demonstrating induction of apoptosis upon prednisolone treatment.

Mean (SD), Student’s t-test: ** p<0.01 (0,007), Pred. = prednisolone (n = 3 each with at least

4 sections each)

35
(D) Immunofluorescence on adult transverse head sections of adult transgenic osterix:nGFP x

mpeg1:mCherry fish stained with anti-dsRed and anti-GFP antibodies at 14 dt. GFP+

osteoblasts line the bone. Macrophage number is reduced in prednisolone treated fish. White

dashed line = bone matrix outline. mCh = mCherry. Scale bar = 20 µm

(E) Quantification of experiment shown in D (macrophages in adult heads). Mean (SD),

Student’s t-test: * p<0.05 (0,032) (n = 3 DMSO, 4 Pred., each at least 15 sections)

(F) Quantification of macrophages in the caudal fin of the same fish as in D. The macrophage

number was strongly reduced in prednisolone treated fish at 14 dt. Mean (SD), Student’s t-

test: ** p<0.01 (0,003) (n = 3 DMSO, 4 Pred., each at least 18 sections)

(G) Quantification of myelomonocytes in the zebrafish kidney at 14 dt by FACS. The

percentage of myelomonocytes in the kidney is reduced by prednisolone treatment. Mean

(SD), Student’s t-test: * p<0.01(n = 5 DMSO, 4 Pred.)

(H) Quantification of lymphocytes in the zebrafish kidney at 14 dt by FACS. Prednisolone

exposure leads to a significant reduction of lymphocytes. Mean (SD), Student’s t-test: *

p<0.05 (n = 5 DMSO, 4 Pred.)

(I) Endogenous cxcl8a levels determined by qRT-PCR in 2 dt fins of prednisolone treated fish

shown relative to the levels of 2 dt DMSO. Mean (SD of technical error). Representative of 3

experiments.

(J) Endogenous tnf-α levels determined by qRT-PCR in 2 dt fins of prednisolone treated fish

shown relative to the levels of 2 dt DMSO. Mean (SD of technical error). Representative of 2

experiments.

(K) Quantification of mpx:GFP labeled neutrophils in 1 dpa/dt regenerates. There is no

difference in number comparing prednisolone with DMSO treated fish. Mean (SD) (n = 5,

three rays per fish)

Figure 2. Bone inhibitory effects of prednisolone in zebrafish

36
(A) Alizarin red staining of 11 dpf larvae treated for 5 days. Red arrow and white dashed

circle in the close up indicate bony structure not yet mineralized in prednisolone treated

larvae. Black box = area of close up. Scale bars = 100 µm and 20 µm

(B) Quantification of alizarin red staining shown in A indicating reduced bone formation.

Mean (SD), Student’s t-test: ** p<0.01 (0,003) (n = 7 DMSO, 8 Pred.)

(C) In vivo calcein staining of zebrafish larvae at 11 dpf treated for 5 days. Prednisolone

treated larvae display less calcified bone structures than control fish (difference marked by red

arrow). Scale bar = 100 µm

(D) Quantification of experiment shown in C. Mean (SD), Student’s t-test: ** p<0.01 (0,007)

(n = 5 DMSO, 6 Pred.)

(E) Alizarin red staining on adult fins treated for 6 weeks. The red dashed line shows the most

distal ray bifurcation which is not calcified in prednisolone treated fish. Red box indicates

region of insets. Black dashed line = most distal bifurcation. Scale bars = 1 mm and 100 µm

(F) Quantification of alizarin red staining shown in E. Prednisolone exposure leads to an

increase in the percentage of unstained bone. Mean (SEM), Student’s t-test: * p<0.05 (0,028)

(n = 5, three rays per fish)

(G) Quantification of bone volume (BV) of the third vertebrae of zebrafish after 8 weeks of

treatment. Prednisolone does not affect BV. Mean (SD), including individual data points,

Student's t-test (n = 5)

(H) Quantification of the fin regenerate length during the course of regeneration. Prednisolone

treated fish show reduced fin regenerate length. Mean (SD), ANOVA * p<0.05

*** p<0.001 (n = 5, three rays per fish)

(I) Whole mount live images of caudal fin regenerates at 14 dpa/dt in osterix:nGFP transgenic

fish. The regenerates of prednisolone treated fish are shorter (indicated by the bracket). Red

dashed line = amputation plane. Scale bar = 100 µm

37
(J) Quantification of the osterix:nGFP expressing domain length at 14 dpa (experiment shown

in I) with shorter domain in prednisolone exposed fins. Mean (SD), Student’s t-test: **

p<0.01 (0,004) (n = 4, three rays per fish)

(K) Quantification of alizarin red+ domain in regenerating fins at 14 dpa/dt. There is no

significant difference between prednisolone and DMSO treated fish. Mean (SD), Student's t-

test (n = 5, three rays per fish)

(L) Whole mount live image of injured skull in osterix:nGFP transgenic fish at 14 dpi/dt. The

white dashed line demarcates the osterix:nGFP free region in prednisolone treated fish

indicating delayed healing. Red dashed lines in brightfield images = outlines of injured areas.

(n = 5). Scale bar = 100 µm

(M) Whole mount alizarin red staining on regenerating skulls at 7 dpi/dt. Prednisolone

treatment leads to reduced mineralized bone matrix formation in the injured area. (n = 5

DMSO, 4 Pred.). Scale bar = 100 µm

(N) Quantification of the regenerated skull bone at 27 dpi/dt. There is no significant

difference. Mean (SD), Student's t-test (n = 5). Scale bar = 200 µm

Figure 3. Effects of prednisolone on osteoblasts in zebrafish

(A) GFP intensity measurement in fin regenerates of osterix:nGFP transgenic zebrafish at 14

dpa/dt (experiment shown in 2I/J). GFP intensity is strongly reduced along the entire fin ray

in prednisolone treated fish. Mean (SEM) (n = 5, three rays per fish)

(B) Average intensity of GFP fluorescence in skull injuries of osterix:nGFP transgenic

zebrafish at 14 dpa/dt (experiment shown in 2L). GFP intensity is significantly reduced in

prednisolone treated fish. Mean (SD), Student’s t-test: ** p.0.01 (0,003) (n = 5)

(C) Quantification of TUNEL, GFP double-positive osteoblasts in osterix:nGFP transgenic

zebrafish fin sections at 4 dpa/dt. There is no significant difference in percentage of apoptotic

osteoblasts. Mean (SEM), Student’s t-test (n = ?)

38
(D) Quantification of PCNA, GFP double-positive (proliferating) osteoblasts in osterix:nGFP

transgenic fin sections at 7 dpa/dt. The number of proliferating osteoblasts is significantly

reduced in prednisolone treated fish, compared to DMSO and untreated/uninjured controls.

Horizontal line = Median, box = upper and lower quartile, whiskers = minimum/maximum

value, ANOVA : * p<0.05 ** p<0.01, untr. = untreated/uninjured (n = 5, minimum of 4

sections each)

(E) Longitudinal section view of anti-PCNA and anti-GFP stained osterix:nGFP transgenic

zebrafish fin hemirays at 4 dpa/dt (plus untreated/uninjured control) (experiment quantified in

D). Red arrow = proliferating osteoblast in the DMSO group. Scale bar = 20 µm

(F) Endogenous runx2a levels determined by qRT-PCR in 2 dpa/dt fin regenerates of

prednisolone treated fish shown relative to the levels of DMSO treatment. Mean (SD of

technical error).

(G) Whole mount live images of fin regenerates at 3 dpa/dt in runx2:GFP transgenic

zebrafish. The upregulation of runx2:GFP in the Prednisolone treated group is comparable to

the one in DMSO. Red dashed line = amputation plane. Scale bar = 100 µm (n = ?)

(H) Endogenous osteocalcin (bglap) levels determined by qRT-PCR in 2 dpa/dt fin

regenerates of prednisolone treated zebrafish shown relative to the levels of DMSO treatment.

Mean (SD of technical error).

(I) Whole mount live images of fin regenerates at 10 dpa/dt in osteocalcin:eGFP transgenic

zebrafish. GFP expression is strongly reduced in the stump and the regenerate of prednisolone

treated fins. Red dashed line = amputation plane. Scale bar = 100 µm (n = ?)

Figure 4. Effects of Prednisolone on osteoclasts in zebrafish

39
(A) TRAP staining at 11 dpf and 2 dt demonstrating reduced osteoclast numbers in

prednisolone treated zebrafish larvae. The inset shows the stomach-region. Scale bars = 500

µm and 100 µm

(B) Quantification of experiment shown in A. Mean (SD), Student’s t-test: ** p<0.01 (0,001)

(n=10)

(C) TRAP staining on 4 dpa fin regenerates. The number of osteoclasts is reduced at the

amputation plane and in the regenerate in prednisolone treated fins. Red dashed line =

amputation plane. Scale bar = 250 µm

(D) Quantification in fin regenerates of experiment shown in C. The cells were counted at the

amputation plane and in the regenerate in corresponding areas. Mean (SD), Student’s t-test:

*** p<0.001 (n = 5, three rays per fish)

(E) Quantification in fin stumps of experiment shown in C. The cells were counted in

corresponding areas at the same distance from the amputation plane. The number of TRAP+

osteoclasts is slightly (although not significantly) increased in prednisolone treated fins. Mean

(SEM) Student's t-test (n = 5, three rays per fish)

40