| Applied and Industrial Microbiology | Research Article

Saccharomyces cerevisiae biofactory to produce naringenin using

a systems biology approach and a bicistronic vector expression
strategy in flavonoid production
Luis Alberto Mejía-Manzano,1 César Iván Ortiz-Alcaráz,1 Laura E. Parra Daza,1,2 Lina Suarez Medina,2 Teresa Vargas-Cortez,1 Miguel
Fernández-Niño,2,3 Andrés Fernando González Barrios,2 José González-Valdez1

AUTHOR AFFILIATIONS See affiliation list on p. 11.

ABSTRACT Naringenin is the central flavonoid in the biosynthesis of several bioactive

compounds and presents a growing demand for its nutraceutical properties. Naringe­
nin extraction from plants is non-viable due to low yields, and microbial platforms
could represent a controlled and sustained alternative to produce it using several
metabolic engineering tools. This study shows the naringenin production in Saccha­
romyces cerevisiae from glucose through a combined approach of systems biology,

Downloaded from https://journals.asm.org/journal/spectrum on 15 December 2023 by 2a02:2454:9fa7:c900:8cb3:50b5:aeb2:e06a.

enzyme criteria selection, and a molecular engineering strategy. In silico prediction
using a mixed integer linear programming (MILP) algorithm showed that the phenylpro­
panoid pathway was the shortest and most viable metabolic pathway. Two biscistronic
constructs were generated using the PTV-1 2A peptide sequence, and a naringenin
biofactory was assembled with the phenylalanine ammonia-lyase/tyrosine ammonia-
lyase genes encoding phenylalanine/tyrosine ammonia-lyase (Rhodobacter capsulatus),
4-coumaroyl (4 Cl) encoding a p-coumaroyl-CoA ligase (Solanum lycopersicum), CHS
encoding chalcone synthase (Hypericum androsaemum), and CHI encoding a chalcone
isomerase (Glycine max). Naringenin productivity in batch fermentation was about 40.67
± 3.47 µg/Lh with a 6.10 ± 0.52 mg/L titer (22.41 ± 1.91 µM) and a 3.26 ± 1.36 mg/g yield
(YP/S) with the detection of additional flavonoids. The obtained concentration is better
than other related works in diverse engineered microorganisms. The results suggest
a successful and optimizable alternative for the heterologous flavanone production in
yeast combined with bicistronic expression mediated by a 2A peptide sequence for the
first time. This strategy supports the production of extensive routes for other nutraceuti­
cal compounds.

IMPORTANCE Flavonoids are a group of compounds generally produced by plants with

proven biological activity, which have recently beeen recommended for the treatment
and prevention of diseases and ailments with diverse causes. In this study, naringenin
was produced in adequate amounts in yeast after in silico design. The four genes of the
Editor Jan Claesen, Lerner Research Institute,
involved enzymes from several organisms (bacteria and plants) were multi-expressed in
Cleveland Clinic, Cleveland, Ohio, USA
two vectors carrying each two genes linked by a short viral peptide sequence. The batch
kinetic behavior of the product, substrate, and biomass was described at lab scale. The Address correspondence to José González-Valdez,
jose_gonzalez@tec.mx.
engineered strain might be used in a more affordable and viable bioprocess for industrial
naringenin procurement. The authors declare no conflict of interest.

Received 17 October 2023

KEYWORDS naringenin, S. cerevisiae, 2A peptide, systems biology, bicistronic vector Accepted 21 November 2023
Published 13 December 2023

F lavonoids are phenolic compounds of two six-membered rings and a three-

carbon unit with diverse attributed biological and pharmacological proper­
ties like antioxidant, antiinflamatory, antitumoral, antineoplastic, antithrombogenic,
Copyright © 2023 Mejía Manzano et al. This is an
open-access article distributed under the terms of
the Creative Commons Attribution 4.0 International
license.

Month XXXX Volume 0 Issue 0 10.1128/spectrum.03374-23 1

Research Article Microbiology Spectrum

antiatherosclerotic, antidiabetic, cardioprotective, hepatoprotective, antiviral, antibacte­

rial, and antifungal activities (1, 2). Naringenin (5,7,4'-trihydroxyflavanone) is a
flavanone, considered a central molecule in the biosynthesis of other flavonoids, and like
other molecules in this group, it presents interesting biological and therapeutic activities
(3, 4). These types of compounds are exclusively biosynthesized by plants; however, their
industrial exploitation presents problems such as long growth periods, low abundance,
and complex purification steps (5). To date, chemical synthesis of naringenin and other
flavonoids is unfeasible, and a viable alternative for overcoming the described difficulties
and to obtain these compounds in economic and environmentally friendly ways is
through their production in genetically modified microorganisms, using them as cellular
biofactories (6). To achieve this, systems metabolic engineering plays an essential role
in integrating several methodologies and tools derived from the metabolic engineering,
systems biology, and synthetic biology fields (7).
Until now, heterologous production of naringenin has been carried out mainly in
Escherichia coli and Saccharomyces cerevisiae strains and in a minor degree in Strepto­
myces sp. (8). In these microorganisms, the needed enzymes of the phenylpropanoid
pathway presented in plants and some microorganisms have been expressed. Basically,
the mentioned pathway starts with the tyrosine or phenylalanine amino acids, which are
converted into p-coumaric acid. In the case of phenylalanine, this change is catalyzed by
two enzymes: phenylalanine ammonia-lyase (PAL) and cinnamate 4-hydroxylase (C4H),
while for tyrosine, the reaction is only carried out by tyrosine ammonia-lyase (TAL).
After that, p-coumaroyl-CoA ligase [4-coumaroyl (4 Cl)] forms p-coumaroyl-CoA, and
then three molecules of malonyl-CoA are condensed, leading to naringenin chalcone by

Downloaded from https://journals.asm.org/journal/spectrum on 15 December 2023 by 2a02:2454:9fa7:c900:8cb3:50b5:aeb2:e06a.

chalcone synthase (CHS). Finally, the chalcone isomerase (CHI) renders naringenin (9).
The use of diverse organisms as a source of enzymes and even isoforms reflects the
diversity in the productivity results. Despite the advances in the use of additional genetic
engineering strategies to achieve the best naringenin productivity, production yields
have remained low (10), and the need to continue generating stable engineered strains
with minimal alterations and maximal efficiency is demanded.
The use of yeasts over bacteria as hosts for flavonoid production is advantageous
since yeasts present limited interference of the endogenous secondary metabolism,
subcellular compartmentation, and the ability to perform post-translational modifica-
tions required for eukaryotic enzymes (11). Particularly, the genome of S. cerevisiae is
widely sequenced and known, with a diversity of studied tools for its alteration and
prediction. Moreover, it is recognized as a generally recognized as safe (GRAS) microor­
ganism in the pharmaceutical, food, and nutraceutical industries (12, 13). Nevertheless,
one of the scarcely mentioned causes of S. cerevisiae’s low performance when enzymes
of complex pathways requires to be expressed is its low tolerance or instability for the
transcription of multiple heterologous genes (11), in addition to the size limitations
imposed by the vectors used (14).
In this regard, the discovery of 2A peptide sequences can help tackle these difficul-
ties. 2A peptide-like sequences or cis-acting hydrolase elements (CHYSELs) are small
aminoacidic (18–22) peptides found in some viruses, which can be harnessed as
mechanisms for expressing several proteins in a single transcript. The ribosomal complex
skips the 2A peptide, and the translated fused proteins suffer “self-cleaving” (15, 16). In
literature, this described system has begun to be studied in multi-gene expression in
several organisms (17–19). In this work, we present the development of an S. cerevisiae
cell factory to produce naringenin, supporting the choice of the biosynthetic pathway by
predictive algorithmic analysis and the testing of the multi-gene co-expression through
2A peptides.

Month XXXX Volume 0 Issue 0 10.1128/spectrum.03374-23 2

Research Article Microbiology Spectrum

RESULTS AND DISCUSSION

Construction of the S. cerevisiae naringenin-producing biofactory
We constructed a naringenin-producing biofactory with S. cerevisiae based on the
determination of the shortest metabolic pathway for naringenin biosynthesis and gene
and enzyme selection. The selected phenylpropanoid metabolic pathway is schematized
in Fig. 1, and it involves the use of four key enzymes in the naringenin biosynthesis from
L-tyrosine and L-phenylalanine (9). Gene selection obeyed the inclusion of three specific
criteria [previous evidence of expression in yeast (S. cerevisiae preferably), a low value
of the Michaelis-Menten constant (KM), and the existence of mutations for naringenin
production]. The evidence of the previous gene expression in S. cerevisiae reported in
the literature was considered the most important since this is a proof of successful
expression of the enzymes. For the PAL/TAL enzyme, the three criteria were fulfilled
by choosing the gene from Rhodobacter capsulatus which presents a high selectivity
by L-tyrosine (KM = 0.0156 mM) without losing its affinity by L-phenylalanine (KM =
1.277 mM) (20) and with wide evidence of its expression in S. cerevisiae (13, 21). The
4-coumaroyl-CoA ligase (4 Cl) gene was taken from Solanum lycopersicum mutant Q274H
since this enzyme, despite having a minor KM (0.179 mM) value with respect to that
of Ruta graveolens (KM = 0.0031 and 0.0055 mM) (22), showed an increased naringenin
production due to its mutation (23). For the CHS gene, the suggested options from the
database (22) were Hypericum androsaemum and Medicago sativa, both with very similar
KM values (0.0231 and 0.0227 mM, respectively). However, CHS from H. androsaemum
was preferred because of the strong evidence of its expression in yeast (24). Glycine

Downloaded from https://journals.asm.org/journal/spectrum on 15 December 2023 by 2a02:2454:9fa7:c900:8cb3:50b5:aeb2:e06a.

max and Scutellaria baicalensis were the candidates for the CHI enzyme gene according
to the BRENDA database. However, attending to the absent reported Michaelis-Menten
constant for the CHI from S. baicalensis, G. max was the chosen option (KM = 0.021 mM)
(25).
The naringenin producer strain was constructed in two steps. First, the genes for
PAL/TAL and 4 Cl enzymes linked by a PTV-1 2A peptide sequence were integrated to
the genome of S. cerevisiae CEN.PK 2–1C, obtaining the IM90 strain. In a subsequent
transformation, the CHS and CHI genes also linked by the 2A peptide sequence were
incorporated to a IM90 strain to generate the IM100 strain. Both sets of genes were
under the control of the constitutive TEF1 promotor and ADH1 terminator. Figure S1a
and S1b show the growth of transformed colonies on selection medium lacking uracil
or uracil and leucine, correspondingly. Also, these assays showed that there was no
yeast growth in both negative transformation controls, in which the plasmid DNA and
the plasmid DNA and single-stranded salmon sperm DNA (ssDNA) carrier were omitted,
respectively, in the first and second controls. Colony PCR analysis confirmed the presence
of the amplicons in each one of the colonies observed in the plates (data not shown).
Later, for the first transformation, genomic DNA was extracted and analyzed by gel
electrophoresis, indicating that the presence of the 2.2-kb amplicon for all the analyzed

FIG 1 Expressed phenylpropanoid metabolic pathway for naringenin production.

Month XXXX Volume 0 Issue 0 10.1128/spectrum.03374-23 3

Research Article Microbiology Spectrum

transformants (Fig S2a) in correspondence with the plasmid control is considered as a

positive control of the amplicon (Fig. S2a, lane 3). The unmodified S. cerevisiae strain was
also included in the assay, and it did not display the amplicon band. In the same way, for
the second transformation, plasmid DNA extraction and electrophoresis tests revealed
the expected amplicon of about 0.65 kb in the selected colonies, using pUDIB2P3 as a
positive control (Fig. S2b, lane 6).
The efficiency in the first transformation had an average of 641 CFU/μg of plasmid
DNA, and in the second one, the average was 5,600 CFU/μg. These low transformation
efficiencies were lower than expected when using this modified lithium transformation
method (26), but it could be caused by a genetic component in the strains and/or some
other factors such as cell washing (27).

Naringenin identification
Naringenin biosynthesis was verified by high-performance liquid chromatography
(HPLC) analysis after culture media extraction. No naringenin formation was identified
in the control extract experiment from the unmodified strain, while the compound
was detected in the IM100 strain extract harboring the expressed genes (Fig. 2A). The
identified peak had the same retention time (tr = 20.67 min) in our analysis conditions
as the naringenin standard. For additional verification, the sample extract was fortified
with a naringenin standard at 2.5 µM. As a result, a proportional increment in peak area
was observed (Fig. 2B). Also, the UV-Vis spectrum of the sample correlated adequately
with a previously reported spectrum of naringenin in literature (28) (Fig. 3). Interestingly,
about five additional hydrophobic compounds with absorbances at 290 and 230 nm

Downloaded from https://journals.asm.org/journal/spectrum on 15 December 2023 by 2a02:2454:9fa7:c900:8cb3:50b5:aeb2:e06a.

were observed in the chromatographic profile of the engineered strain in comparison
with the profiles of the unmodified one (Fig. 2A). These compounds with close reten­
tion times (21–26 min) to naringenin may be related to flavonoid derivates (such as
pinocembrin, eriodictyol, homoeriodictyol, and phloretin) as a result of the biotransfor­
mation processes in the fermentation after flavanone biosynthesis (24, 29), since the
majority of UV-Vis spectra of these chromatographic peaks (data not shown) presented
the characteristic flavonoid bands in the range 240–285 nm (Band II) and 300–400 nm
(Band I). Band I corresponds to the absorption of the cinnamoyl system in Ring B, while
Band II is attributed to the benzoyl system in Ring A (30). However, further identification
and characterization of these compounds are required.

Bicistronic expression of the heterologous pathway of naringenin

Molecular evidence of the transformation and naringenin detection allowed the
confirmation that the bicistronic vector strategy was suitable for expressing the
phenylpropanoid pathway in S. cerevisiae. In this way, this work represents additional
evidence about the suitability of 2A peptide sequences for supporting multi-cistronic
gene expression. Some works have previously established the application of 2A
peptide-like sequences in the efficient display of heterologous unrelated proteins or
enzymes such as Sun et al. (31) and Subramanian et al. (18), in which a double lipase
B from Candida antarctica was expressed in the membrane of Pichia pastoris and a
cellobiohydrolase enzyme from Penicillium funiculosum and green fluorescent protein
were assembled in the same cassette in Trichoderma reesei. In both cases, the 2A
peptide of the foot-and-mouth disease virus (FMDV) was used. As it can be inferred,
the testing of this tool for building compound biofactories remained unclear, mainly
when a final product is the result of several expressed enzymes. For this reason, the
present study contributes as positive evidence of this last aspect. Another of the studies
holding the use of this system as an expression mechanism for complex metabolic
pathways is the co-expression of the protein genes ctrI, ctrE, and ctrYB of the Xantho­
phyllomyces dendrorhous fungi in S. cerevisiae for β-carotene production (32). In this
case, the genes were separated with a T2A sequence from the Thosea asigna virus.
Also, friedelin production in S. cerevisiae was achieved with a bicistronic expression of
friedelin synthase from Maytenus ilicifolia and 3-hydroxy-3-methylglutaryl coenzyme A

Month XXXX Volume 0 Issue 0 10.1128/spectrum.03374-23 4

Research Article Microbiology Spectrum

Downloaded from https://journals.asm.org/journal/spectrum on 15 December 2023 by 2a02:2454:9fa7:c900:8cb3:50b5:aeb2:e06a.

FIG 2 Identification of naringenin by HPLC-UV analysis. (A) Chromatographic profile of the engineered and the unmodified S.
cerevisiae extracts. IM100 strain, continuous black line; unmodified strain, dashed black line; naringenin standard, continuous
red line. (B) Chromatographic spiked profile for the engineered S. cerevisiae extract. IM100 strain, continuous blue line; spiked
IM100 strain, dashed blue line; naringenin standard at 2.5 µM, continuous red line.

reductase (HMG1), linked by the 2A peptide from equine rhinitis B virus (33). Also, the
T2A sequence from T. asigna was recently used for expressing a four-copy cassette of
the antimicrobial peptide plectasin with outstanding yields in yeast (34). For naringenin,
this is the first time that production is achieved through bicistronic expression, which
represents an important issue and advance in the heterologous production of this
nutraceutical.

Naringenin production and kinetics in batch cultures

Figure 4A depicts the growth curves for biomass and pH media of the batch cultures
during 150 h of the engineered IM100 and unmodified S. cerevisiae strains. As it can
be appreciated, under the cultural conditions, both strains presented similar behaviors
in their growth. In fact, during the exponential phase, the IM100 presented a growth
rate of 0.22 ± 0.02/h, very similar to that of the unmodified strain (0.21 ± 0.01/h) at
a substrate concentration of about 4.5 g/L. Nevertheless, the medium’s pH in IM100

Month XXXX Volume 0 Issue 0 10.1128/spectrum.03374-23 5

Research Article Microbiology Spectrum

suffered a notorious decay from the beginning up to 10 h, and it was closely kept at pH
3.0 over the monitoring period. On its part, the control strain had a pH of about 4.4. This
marked difference in the fermentation media acidity of the engineered strain compared
to the unmodified strain can be explained by a more intense metabolic activity because
of the need to produce naringenin flavone and consequently the generation of many
acidic metabolites (i.e., trycarboxylic acid cycle [TCA] intermediate metabolites such as
malate, citrate, fumarate, and succinate) in comparison with the wild-type strain (10).
When the substrate consumption is revised (Fig. 4B), a slightly faster consumption is
observed in the unmodified S. cerevisiae strain than in the modified one at the beginning
of the fermentation. However, in the next hours, the IM100 culture had a small concen­
tration of glucose, being approximately half of the substrate concentration presented in
the unmodified S. cerevisiae culture at the end of the fermentation. Glucose was con­
sumed in 90.6% by the IM100 strain. During the first 60 h of culture, naringenin was not
detected, although naringenin production has been reported to begin in shake flasks
when the substrate is consumed in its majority (10). In this case, major glucose consump­
tion reached a plateau around 36 h (IM100 strain). The late naringenin detection may be
due to the low-level production (discussed later) and to the sensitivity of our developed
analytical method. The concentration of naringenin at the end of the fermentation was
6.10 ± 0.52 mg/L (22.41 ± 1.91 µM), with productivity of 40.67 ± 3.47 µg/L/h and a yield
(YP/S) of 3.26 ± 1.36 mg/g. The obtained titer exceeded that in E. coli (35) and Streptomy­
ces venezuelae (36) using sugars as carbon source. When the reports where S. cerevisiae is
used as a host for this purpose are carefully reviewed, our result is more like the values
achieved (i.e., 7 mg/L) when L-tyrosine or phenylalanine is fed (24), and it was higher

Downloaded from https://journals.asm.org/journal/spectrum on 15 December 2023 by 2a02:2454:9fa7:c900:8cb3:50b5:aeb2:e06a.

than those cases in which the phenylpropanoid pathway has been only partially
expressed starting from cinnamic acid (i.e., 200 mg/L) (19). The highest reported
production of naringenin in S. cerevisiae has been up to 100 mg/L starting from glucose
(13, 18) and up to 650 mg/L from p-coumaric acid (37); nonetheless, this titer has been
achieved after strain and culture condition optimization. As it has been found from
diverse reports (38, 39), low naringenin biosynthesis may be caused by the bottlenecks
that the microorganism faces during flavonoid production. One of these is the limited

FIG 3 Absorption spectrum of identified naringenin at retention time (20.67 min) in culture with the engineered S. cerevisiae strain IM100.

Month XXXX Volume 0 Issue 0 10.1128/spectrum.03374-23 6

Research Article Microbiology Spectrum

Downloaded from https://journals.asm.org/journal/spectrum on 15 December 2023 by 2a02:2454:9fa7:c900:8cb3:50b5:aeb2:e06a.

FIG 4 Growth and product formation of the IM100 and unmodified S. cerevisiae strains. (A) Growth curves of engineered and unmodified S. cerevisiae strains
and culture media pH. (B) Naringenin production and substrate consumption of the IM100 and unmodified S. cerevisiae. Solid symbols represent the engineered
IM100 strain, while open symbols indicate the unmodified strain. Biomass, triangle; pH, square; naringenin, diamond; glucose, circle.

precursor generation and availability in the cytosol, such as malonyl-CoA, which

consequently interferes in the biosynthesis of the flavonoids (40). Moreover, the reported
naringenin titer and production in our fermentation might be subestimated, and the
value may be higher than the quantified, due to equivalent amounts observed in the
other biotransformed flavonoid signals which are not being considered.

Month XXXX Volume 0 Issue 0 10.1128/spectrum.03374-23 7

Research Article Microbiology Spectrum

In our case, future production optimization is being considered. This might contem­
plate some metabolic engineering issues with intuitive approaches such as redirection
of the carbon flux to target products (i.e., reducing intracellular concentrations of
precursors by transporters, eliminating genes of precursors, overexpressing by-product
genes, or increasing precursor supply by catabolism in other pathways), implementing
flavonoid glycosylation and systematic approaches such as expression of multiple gene
copy number or testing effective promotors (6, 41–43). Until now, through our current
engineering design, naringenin production has been ensured by the sides of adequate
custom-made DNA in the host, efficient affinity of enzymes for their substrates, and
multi-cistronic expression. In addition, optimization at the bioprocessing fermentation
level such as bioreactor culture and medium conditions (44) may give high enough titers
even without appealing to metabolic tools, but this also requires further validation.

Conclusions
This work presents, for the first time, the biosynthetic production of naringenin with the
use of multi-cistronic expression through a 2A peptide strategy, starting from glucose
without precursor use in an engineered S. cerevisiae strain. This represents additional
proof of a successful case of the use of 2A peptide sequences for the heterologous
expression of multiple genes. The expressed phenylpropanoid pathway resulted in
integrative systems biology analysis through a mixed integer linear programming (MILP)
algorithm and a rational enzyme criteria selection. The production of naringenin was
verified by standard fortification in HPLC, and some other flavonoids were visualized
at the end of the fermentation. There were no growth rate differences between the

Downloaded from https://journals.asm.org/journal/spectrum on 15 December 2023 by 2a02:2454:9fa7:c900:8cb3:50b5:aeb2:e06a.

unmodified and the engineered S. cerevisiae strains in flask cultures. However, slightly
lower changes were identified at substrate-level consumption and medium pH in the
engineered IM100 strain compared to the unmodified one. Naringenin titer reached a
value of 6.10 ± 0.52 mg/L, superior to some works producing this flavanone with E.
coli and S. venezuelae used as substrate sugars and, at the same time, a comparable
concentration in S. cerevisiae from L-phenylalanine or L-tyrosine. The previous analy­
sis suggests strong and positive evidence of successful application of the bicistronic
expression strategy using 2A peptide sequences. It is believed that this titer is decreased
by the biotransformation effect of other flavonoid compounds observed at the end of
the fermentation. However, genetic, metabolic, and bioprocess optimization will give
important improvements in the production of this important flavonoid soon.

MATERIALS AND METHODS

Chemicals, strains, and maintenance
All restriction enzymes and DNA ligase were purchased from New England BioLabs
(Massachusetts, USA). The solvents used in the chromatographic analysis were acquired
from Desarrollo de Especialidades Quimicas (DEQ) (NL, México). E. coli XL1-Blue was
provided by Agilent (Santa Clara, CA, USA) while S. cerevisiae CEN.PK 2–1C 30,000A
(MATalpha ura3 his3 leu2 trp1 MAL2-8cSUC2) was purchased from Scientific Research
and Development GmbH (Oberursel, Germany). Stock cultures for E. coli were grown
at 37°C and 200 rpm in Luria-Bertani (LB) medium and ampicillin (100 µg/mL). Stock
cultures for S. cerevisiae were grown at 37°C and 200 rpm in 50 mL Corning tubes
containing 10 mL of yeast extract-peptone-dextrose (YPD) medium with 20 g/L of
dextrose, 20 g/L of peptone enzymatic digest of casein, and 10 g/L yeast extract. Main
cultures were stored at −80°C in 1-mL microtubes with 20% of glycerol.

Genes and plasmid construction

The metabolic pathway for the heterologous production of naringenin was defined
based on the obtained results of the OptStoic-minRxn/minRxn algorithm, a problem
of MILP aimed to identify the overall stoichiometry of conversion of L-tyrosine and

Month XXXX Volume 0 Issue 0 10.1128/spectrum.03374-23 8

Research Article Microbiology Spectrum

L-phenylalanine to naringenin, by maximization of a desired yield using a metabo­

lite/reaction database and their respective stoichiometric coefficients. For this, scientific
information sources and databases such as Patric (45), MetaCyc (46), MetRxn (46), and
Kyoto Encyclopedia of Genes and Genomes (KEGG) (47, 48) were used. The whole
biosynthetic pathway is displayed in Fig. 1. Gene and enzyme selection criteria were
previous evidence of expression in yeast (S. cerevisiae preferably), a low value of the
Michaelis-Menten constant (KM) (obtained in BRENDA database), and the existence of
mutations that can contribute to naringenin production. Hence, the set of genes was
integrated by PAL/TAL from R. capsulatus (GenBank accession number: JX268036.1),
4 Cl from S. lycopersicum (GenBank accession number: NM_001346841), CHS from H.
androsaemum (GenBank accession number: AF315345), and CHI from G. max (GenBank
accession number: AY595413). All DNA sequences were obtained from the National
Center for Biotechnology Information (NCBI) GenBank.
The pUDEA2P3 and the pUDIB2P3 plasmids (Fig. 5) were selected and re-designa­
ted for this endeavor. In the first one (Fig. 5A), the genes of the PAL/TAL and 4
Cl were incorporated taking as a backbone the centromeric plasmid pUDE172 (Gen­
Bank accession number: JX268037.1), having URA3 as an auxotrophic marker (13). The
pUDIB2P3 plasmid (Fig. 5B) was designated to contain the CHS and CHI genes, consid­
ering the plasmid pUDI065 (GenBank accession number: JX268039) with LEU2 as an
auxotrophic marker (13). Each pair of genes in the plasmids were placed in a single
cassette under a constitutive TEF1 promoter and ADH1 terminator; the genes were
linked with the PTV-1 2A peptide sequence from porcine teschovirus-1 (15) (Fig. 2C).
Both plasmids were synthesized by Gen Script (New Jersey, USA). Table 1 shows all the

Downloaded from https://journals.asm.org/journal/spectrum on 15 December 2023 by 2a02:2454:9fa7:c900:8cb3:50b5:aeb2:e06a.

strains and vectors used in this study.

Plasmid construction and recombinant strain generation

The synthesized vectors were transformed and propagated in E. coli XL1-Blue. Each
plasmid was isolated separately from E. coli using the Wizard Plus SV Minipreps DNA
Purification System (Promega, Madison, WI), verifying the concentration and purity
in a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). The
pUDEA2P3 plasmid was linearized using NcoI for its optimal integration in the chromoso­
mal PYK2 locus. First, S. cerevisiae CEN.PK2-1C was transformed with pUDEA2P3 through
the lithium acetate method (26). Briefly, S. cerevisiae competent cells were transformed
with a mix containing PEG 3350, lithium acetate, ssDNA as a carrier, and the purified
pUDEA2P3 plasmid at 42°C for 60 min. The cell suspension was incubated in 1 mL of

FIG 5 Constructs used in the expression of the phenylpropanoid pathway for naringenin production in S. cerevisiae. (A) pUDEA2P3 plasmid containing the
PAL/TAL and the 4 Cl genes. (B) pUDIB2P3 plasmid containing the CHS and the CHI genes. Genes are indicated in color, the 2A peptide sequence is presented in
red, GSG linker in brown, promotor/terminator in white, selection markers in black, and E. coli replication origin/recombination site are displayed in gray. (C) DNA
and amino acid sequences of the PTV-1 2A peptide used.

Month XXXX Volume 0 Issue 0 10.1128/spectrum.03374-23 9

Research Article Microbiology Spectrum

TABLE 1 Strains and vectors used in genetic engineering of S. cerevisiae for naringenin production

Strain or plasmid Description Reference

Strains
E. coli BL21 This study
S. cerevisiae
CEN.PK2-1C Genotype MATalpha ura3 his3 leu2 trp1 MAL2-8cSUC2 (13)
IM90 S. cerevisiae CEN.PK2-1C containing pUDEA2P3 This study
IM100 IM90 containing pUDIB2P3 This study
Plasmids
pUDEA2P3 URA3, PAL/TAL, and 4 Cl genes with PTV-1 2A peptide sequence 13; this study
pUDIB2P3 LEU2, CHS, and CHI genes with PTV-1 2A peptide sequence 13; this study

sterile water at 30°C for 2 h and plated directly and in 1:10 and 1:100 dilutions per
triplicate into the appropriate selection medium. The plates were incubated for 4 days
at 30°C (26, 49), resulting in the IM90 strain. The transformation of the IM90 strain
with the pUDIB2P3 plasmid was performed as previously described when constructing
the S. cerevisiae IM100 strain. All transformations in S. cerevisiae with the plasmids
described above were verified by colony PCR (50). After the genomic and plasmid
DNA was extracted with the YeaStar Genomic DNA Kit (Zymo Research, Irvine, CA) and
the Zymoprep Yeast Plasmid Miniprep I Kit (Zymo Research, Irvine, CA), respectively,
gel electrophoresis was performed. The primers used for the verification of the PCR
amplifications were carried out with 20–50 ng of DNA (corresponding to 10 µM of the

Downloaded from https://journals.asm.org/journal/spectrum on 15 December 2023 by 2a02:2454:9fa7:c900:8cb3:50b5:aeb2:e06a.

forward and reverse primers) (Table 2) and 12.5 µL of Go Taq Master Mix (Promega, WI,
USA) in a final volume of 25 µL. The reaction was performed in a Veriti 96-Well Thermal
Cycler (Applied Biosystems, Singapore, Singapore), with the following parameters: (i)
initial denaturation at 95°C for 2 min; (ii) 35 or 30 cycles of denaturation at 95°C for 30 s,
primer annealing for 30 s at 65°C or 56°C depending on primer sets; and (iii) extension
at 72°C for 1–2 min, with final elongation at 72°C for 5 min. Agarose gel separation of
the amplicons was performed using a 1% (wt/vol) agarose (Sigma-Aldrich, Zwijdrecht,
Netherlands) gel in 1 × Tris-acetate-EDTA (TAE) (40-mM Tris-acetate pH 8.0 and 1-mM
EDTA).

Culture and media

The transformed and original strains of S. cerevisiae were cultured in Verduyn mineral
medium containing 20 g/L of glucose, 5 g/L of ammonium sulfate, 3 g/L of potassium
dihydrogen phosphate, 0.5 g/L of magnesium sulfate heptahydrate, trace element
solution, and vitamin solution, adjusting the pH to 6.0 with potassium hydroxyde
(KOH) or hydrochloric acid (HCl) and supplementing histidine monohydrochloride
(1,034 mg/L), tryptophan (757.57 mg/L), leucine (3877. 55 mg/L), and uracil (757 mg/L)
according to the auxotrophic requirements of the strains (13). The cultures were grown
in 500-mL shake flasks with 100 mL of mineral medium at 30°C and 250 rpm in a
MaxQ6000 incubator (Thermo Scientific, Marietta, USA). During fermentation, pH media
was measured externally with an Orion Start potentiometer (Thermo Fisher Scientific,
Waltham, MA).

TABLE 2 Primers used for verification

Name Direction Sequence Purpose Reference

FT90 Fw CTCTAGGGTGTCGTTAATTACCC Confirmation of first This study
FT91 Rev CTGGCAAGGTAGACAAGCC transformation This study
ST100 Fw GGCAGGTTTAGTTGAAAGAC Confirmation of second This study
ST101 Rev CGAAACAGTAAGAATGCAATGGC transformation This study

Month XXXX Volume 0 Issue 0 10.1128/spectrum.03374-23 10

Research Article Microbiology Spectrum

Biomass determination and substrate consumption estimation

Biomass was determined by diluting the cultures at 1:10 and by measuring optical
density (OD) at 600 nm using a Genesys 10S UV-Vis spectrophotometer (Thermo Fisher
Scientific, Waltham, MA). To start growth curves, OD was established at 0.2, inoculating
from an intermediate culture in the exponential phase. The glucose consumption during
the fermentation was monitored through soluble solid determination with a PR-101 Alfa
Refractometer (Atago, Bellevue, USA).

Naringenin analysis by HPLC

Culture medium supernatant (obtained by centrifugation at 9,000 × g for 8 min) was
extracted with an equivalent volume of ethyl acetate (DEQ, Monterrey, Mexico) for
2 h at room temperature under dark conditions. After that, the organic upper phase
was separated and evaporated in an EZ-2 series evaporator (Genevac, Gardiner, USA).
The extract was resuspended using 1 mL of mobile phase A. Naringenin analysis was
performed in HPLC with a diode array detector (Agilent 1290, Waldbronn, Germany) at
230 and 290 nm and a reversed-phase Zorbax SB-C18 column (4.6mm × 150 mm ×
3.5 µm) kept at 30°C. Two mobile phases were used: Phase A was 20 mM of KH2PO4
(pH 2) with 1% acetonitrile, and Phase B was acetonitrile 100%. Gradient elution was
performed at 1 mL/min, starting from 0 to 10% Phase B during 6 min, followed by a
change from 10% to 40% of B during 17 min. From 23 to 27 min, B decreased to 0%;
additionally, the gradient was held to 0% B for 10 min. A naringenin standard with 95%
purity was purchased from Sigma Aldrich (St. Louis, MO, USA). The standard addition

Downloaded from https://journals.asm.org/journal/spectrum on 15 December 2023 by 2a02:2454:9fa7:c900:8cb3:50b5:aeb2:e06a.

method was used for validating the identity of the analyte in the samples, adding
naringenin at 2.5 µM.

ACKNOWLEDGMENTS

The authors would like to thank the School of Engineering and Science of Tecnológico de
Monterrey and the Vicerrectoría de Investigación y Creación of Universidad de los Andes
for supporting this work though their collaboration program. Some figures were made
using BioRender.com.
This work was supported by the Molecular and Systems Bioengineering Research
Group in the FEMSA Biotechnology Center at Tecnologico de Monterrey.
L.A.M.M. defined, planned, and executed most of the experiments. Also, L.A.M.M.
wrote the manuscript. C.I.O.A. technically assisted in the molecular construction of
the naringenin-producing chasis and propaged the constructs. L.E.P.D. established the
enzyme selection criteria and performed some of the initial tests for the strain growth
in culture media. L.S.M. created and executed the algorithm for defining the metabolic
pathway. T.V.C. helped experimentally with the proving of the second transformation.
M.F.N. participated in the algorithm definition and manuscript revision. A.F.G.B. and J.G.V.
conceived the project and revised the manuscript. All the authors read and approved the
final manuscript.

AUTHOR AFFILIATIONS
1
School of Engineering and Science, Tecnologico de Monterrey, Monterrey, Nuevo León,
Mexico
2
Department of Chemical and Food Engineering, Grupo de Diseño de Productos y
Procesos (GDPP), Universidad de los Andes, Bogotá, Colombia
3
Department of Bioorganic Chemistry, Leibniz-Institute of Plant Biochemistry, Halle,
Germany

AUTHOR ORCIDs

Luis Alberto Mejía-Manzano http://orcid.org/0000-0001-8314-9713

José González-Valdez http://orcid.org/0000-0001-6734-8245

Month XXXX Volume 0 Issue 0 10.1128/spectrum.03374-23 11

Research Article
AUTHOR CONTRIBUTIONS
Luis Alberto Mejía-Manzano, Investigation, Methodology, Validation, Writing – original
draft | César Iván Ortiz-Alcaráz, Investigation | Laura E. Parra Daza, Investigation |
Lina Suarez Medina, Formal analysis, Investigation | Teresa Vargas-Cortez, Investigation,
Methodology | Miguel Fernández-Niño, Formal analysis, Methodology, Supervision |
Andrés Fernando González Barrios, Conceptualization, Methodology, Resources, Writing
– review and editing | José González-Valdez, Conceptualization, Project administration,
Resources, Supervision, Writing – review and editing
ADDITIONAL FILES
The following material is available online.
Supplemental Material
Fig. S1 and Fig. S2 (Spectrum03374-23-s0001.docx). Growth of transformed strains and
electrophoresis validation.
REFERENCES
1. Tapas AR, Sakarkar DM, Kakde R 2. 2008. Flavonoids as nutraceuticals: a
review. Trop J Pharm Res 7:1089–1099. https://doi.org/10.4314/tjpr.v7i3.
14693
2. Agrawal AD. 2011. Pharmacological activities of flavonoids: a review. Int
J Pharm Sci Nanotechnol 4:1394–1398. https://doi.org/10.37285/ijpsn.
2011.4.2.3
3. Patel K, Singh GK, Patel DK. 2018. A review on pharmacological and
analytical aspects of naringenin. Chin J Integr Med 24:551–560. https://
doi.org/10.1007/s11655-014-1960-x
4. Salehi B, Fokou PVT, Sharifi-Rad M, Zucca P, Pezzani R, Martins N, Sharifi-
Rad J. 2019. The therapeutic potential of naringenin: a review of clinical
trials. Pharmaceuticals 12:11. https://doi.org/10.3390/ph12010011
5. Chemler JA, Koffas MAG. 2008. Metabolic engineering for plant natural
product biosynthesis in microbes. Curr Opin Biotechnol 19:597–605.
https://doi.org/10.1016/j.copbio.2008.10.011
6. Wu J, Du G, Zhou J, Chen J. 2014. Systems metabolic engineering of
microorganisms to achieve large-scale production of flavonoid scaffolds.
J Biotechnol 188:72–80. https://doi.org/10.1016/j.jbiotec.2014.08.016
7. Chae TU, Choi SY, Kim JW, Ko YS, Lee SY. 2017. Recent advances in
systems metabolic engineering tools and strategies. Curr Opin
Biotechnol 47:67–82. https://doi.org/10.1016/j.copbio.2017.06.007
8. Shah FLA, Ramzi AB, Baharum SN, Noor NM, Goh H-H, Leow TC, Oslan
SN, Sabri S. 2019. Recent advancement of engineering microbial hosts
for the biotechnological production of flavonoids. Mol Biol Rep 46:6647–
6659. https://doi.org/10.1007/s11033-019-05066-1
9. Wang Y, Chen S, Yu O. 2011. Metabolic engineering of flavonoids in
plants and microorganisms. Appl Microbiol Biotechnol 91:949–956.
https://doi.org/10.1007/s00253-011-3449-2
10. Lyu X, Ng KR, Mark R, Lee JL, Chen WN. 2018. Comparative metabolic
profiling of engineered Saccharomyces cerevisiae with enhanced
flavonoids product. J Funct Foods 44:274–282. https:/​/​doi.org/​10.1016/​j.
jff.2018.03.012
11. Siddiqui MS, Thodey K, Trenchard I, Smolke CD. 2012. Advancing
secondary metabolite biosynthesis in yeast with synthetic biology tools.
FEMS Yeast Res 12:144–170. https://doi.org/10.1111/j.1567-1364.2011.
00774.x
12. Fowler ZL, Koffas MAG. 2009. Biosynthesis and biotechnological
production of flavanones: current state and perspectives. Appl Microbiol
Biotechnol 83:799–808. https://doi.org/10.1007/s00253-009-2039-z
13. Koopman F, Beekwilder J, Crimi B, van Houwelingen A, Hall RD, Bosch D,
van Maris AJA, Pronk JT, Daran J-M. 2012. De novo production of the
flavonoid naringenin in engineered Saccharomyces cerevisiae. Microb
Cell Fact 11:1-15. https://doi.org/10.1186/1475-2859-11-155
14. Szymczak AL, Vignali DA. 2005. Development of 2A peptide-based
strategies in the design of multicistronic vectors. Expert Opin Biol Ther
5:627–638. https://doi.org/10.1517/14712598.5.5.627
Month XXXX Volume 0 Issue 0
Microbiology Spectrum
15. Szymczak-Workman AL, Vignali KM, Vignali DA. 2012. Design and
construction of 2A peptide-linked multicistronic vectors, p 199–204. In
Cold spring Harb Protoc. Spring Harbor Laboratory Press, New York.
16. Daniels RW, Rossano AJ, Macleod GT, Ganetzky B. 2014. Expression of
multiple Transgenes from a single construct using viral 2A peptides in
Downloaded from https://journals.asm.org/journal/spectrum on 15 December 2023 by 2a02:2454:9fa7:c900:8cb3:50b5:aeb2:e06a.
Drosophila. PLoS ONE 9:e100637. https://doi.org/10.1371/journal.pone.
0100637
17. Kim JH, Lee S-R, Li L-H, Park H-J, Park J-H, Lee KY, Kim M-K, Shin BA, Choi
S-Y. 2011. High cleavage efficiency of a 2A peptide derived from porcine
Teschovirus-1 in human cell lines, Zebrafish and mice. PLoS ONE
6:e18556. https://doi.org/10.1371/journal.pone.0018556
18. Subramanian V, Schuster LA, Moore KT, Taylor LE, Baker JO, Vander Wall
TA, Linger JG, Himmel ME, Decker SR. 2017. A versatile 2A peptide-based
bicistronic protein expressing platform for the industrial cellulase
producing fungus, Trichoderma reesei. Biotechnol Biofuels 10:1:15. https:
//doi.org/10.1186/s13068-017-0710-7
19. Mizote Y, Masumi-Koizumi K, Katsuda T, Yamaji H. 2020. Production of an
antibody Fab fragment using 2A peptide in insect cells. J Biosci Bioeng
130:205–211. https://doi.org/10.1016/j.jbiosc.2020.03.009
20. Kyndt JA, Meyer TE, Cusanovich MA, Van Beeumen JJ. 2002. Characteri­
zation of a bacterial tyrosine ammonia lyase, a biosynthetic enzyme for
the photoactive yellow protein. FEBS Lett 512:240–244. https://doi.org/
10.1016/s0014-5793(02)02272-x
21. Li Y, Mao J, Song X, Wu Y, Cai M, Wang H, Liu Q, Zhang X, Bai Y, Xu H,
Qiao M. 2020. Optimization of the l-tyrosine metabolic pathway in
Saccharomyces cerevisiae by analyzing p-coumaric acid production. 3
Biotech 10:1-15. https://doi.org/10.1007/s13205-020-02223-3
22. BRENDA enzyme database. 2020. Technische Universität Braunschweig.
Available from: https://www.brenda-enzymes.org/index.php
23. Alberstein M, Eisenstein M, Abeliovich H. 2012. Removing allosteric
feedback inhibition of tomato 4‐coumarate: CoA ligase by directed
evolution. Plant J 69:57–69. https://doi.org/10.1111/j.1365-313X.2011.
04770.x
24. Jiang H, Wood KV, Morgan JA. 2005. Metabolic engineering of the
phenylpropanoid pathway in Saccharomyces cerevisiae. Appl Environ
Microbiol 71:2962–2969. https://doi.org/10.1128/AEM.71.6.2962-2969.
2005
25. Ralston L, Subramanian S, Matsuno M, Yu O. 2005. Partial reconstruction
of flavonoid and isoflavonoid biosynthesis in yeast using soybean type I
and type II chalcone isomerases. Plant Physiol 137:1375–1388. https://
doi.org/10.1104/pp.104.054502
26. Gietz RD, Schiestl RH. 2007. High-efficiency yeast transformation using
the Liac/SS carrier DNA/PEG method. Nat Protoc 2:38–41. https://doi.
org/10.1038/nprot.2007.15
27. Kawai S, Murata K. 2015. Transformation of intact cells of Saccharomyces
cerevisiae: lithium methods and possible underlying mechanism, p 187–
10.1128/spectrum.03374-23 12
Research Article
192. In Van den Maruthachalam (ed), (ed), (ed), (ed), (ed), (ed), (ed), (ed),
Genetic transformation systems in fungi. Springer, Cham.
28. Wu MH, Zhu L, Zhou ZZ, Zhang YQ. 2013. Coimmobilization of
naringinases on silk fibroin nanoparticles and its application in food
packaging. J Nanomater 2013:1–5. https://doi.org/10.1155/2013/901401
29. Yan Y, Kohli A, Koffas MAG. 2005. Biosynthesis of natural flavanones in
Saccharomyces cerevisiae. Appl Environ Microbiol 71:5610–5613. https://
doi.org/10.1128/AEM.71.9.5610-5613.2005
30. Bhat SV, Nagasampagi BA, Sivakumar M. 2006. Chemistry of natural
products. 2nd reprint. Narosa Publishing House, New Delhi.
31. Sun Y-F, Lin Y, Zhang J-H, Zheng S-P, Ye Y-R, Liang X-X, Han S-Y. 2012.
Double Candida antarctica lipase B co-display on Pichia pastoris cell
surface based on a self-processing foot-and-mouth disease virus 2A
peptide. Appl Microbiol Biotechnol 96:1539–1550. https://doi.org/10.
1007/s00253-012-4264-0
32. Beekwilder J, van Rossum HM, Koopman F, Sonntag F, Buchhaupt M,
Schrader J, Hall RD, Bosch D, Pronk JT, van Maris AJA, Daran J-M. 2014.
Polycistronic expression of a β-carotene biosynthetic pathway in
Saccharomyces cerevisiae coupled to β-ionone production. J Biotechnol
192:383–392. https://doi.org/10.1016/j.jbiotec.2013.12.016
33. Souza-Moreira TM, Navarrete C, Chen X, Zanelli CF, Valentini SR, Furlan
M, Nielsen J, Krivoruchko A. 2018. Screening of 2A peptides for
polycistronic gene expression in yeast. FEMS Yeast Res 18. https://doi.
org/10.1093/femsyr/foy036
34. Liang X, Jiang H, Si X, Xin Q, Meng D, Chen P, Mao X. 2022. Boosting
expression level of plectasin in recombinant Pichia pastoris via 2A self-
processing peptide assembly. Appl Microbiol Biotechnol 106:3669–3678.
https://doi.org/10.1007/s00253-022-11942-x
35. Choi O, Wu C-Z, Kang SY, Ahn JS, Uhm T-B, Hong Y-S. 2011. Biosynthesis
of plant-specific phenylpropanoids by construction of an artificial
biosynthetic pathway in Escherichia coli. J Ind Microbiol Biotechnol
38:1657–1665. https://doi.org/10.1007/s10295-011-0954-3
36. Park SR, Yoon JA, Paik JH, Park JW, Jung WS, Ban Y-H, Kim EJ, Yoo YJ, Han
AR, Yoon YJ. 2009. Engineering of plant-specific phenylpropanoids
biosynthesis in Streptomyces venezuelae. J Biotechnol 141:181–188.
https://doi.org/10.1016/j.jbiotec.2009.03.013
37. Gao S, Lyu Y, Zeng W, Du G, Zhou J, Chen J. 2019. Efficient biosynthesis
of (2 S)-naringenin from p-coumaric acid in Saccharomyces cerevisiae. J
Agric Food Chem 68:1015–1021. https://doi.org/10.1021/acs.jafc.
9b05218
38. Fowler ZL, Gikandi WW, Koffas MAG. 2009. Increased malonyl coenzyme
A biosynthesis by tuning the Escherichia coli metabolic network and its
application to flavanone production. Appl Environ Microbiol 75:5831–
5839. https://doi.org/10.1128/AEM.00270-09
39. Santos CNS, Koffas M, Stephanopoulos G. 2011. Optimization of a
heterologous pathway for the production of flavonoids from glucose.
Metab Eng 13:392–400. https://doi.org/10.1016/j.ymben.2011.02.002
Month XXXX Volume 0 Issue 0
Microbiology Spectrum
40. Krivoruchko A, Nielsen J. 2015. Production of natural products through
metabolic engineering of Saccharomyces cerevisiae. Curr Opin
Biotechnol 35:7–15. https://doi.org/10.1016/j.copbio.2014.12.004
41. Zhang Q, Yu S, Lyu Y, Zeng W, Zhou J. 2021. Systematically engineered
fatty acid catabolite pathway for the production of (2 S)-naringenin in
Saccharomyces cerevisiae. ACS Synth Biol 10:1166–1175. https://doi.org/
10.1021/acssynbio.1c00002
42. Li H, Ma W, Lyv Y, Gao S, Zhou J. 2022. Glycosylation modification
enhances (2 S)-naringenin production in Saccharomyces cerevisiae. ACS
Synth Biol 11:2339–2347. https://doi.org/10.1021/acssynbio.2c00065
43. Li H, Gao S, Zhang S, Zeng W, Zhou J. 2021. Effects of metabolic pathway
gene copy numbers on the biosynthesis of (2S)-naringenin in
Saccharomyces cerevisiae. J Biotechnol 325:119–127. https://doi.org/10.
1016/j.jbiotec.2020.11.009
44. Parra Daza LE, Suarez Medina L, Tafur Rangel AE, Fernández-Niño M,
Mejía-Manzano LA, González-Valdez J, Reyes LH, González Barrios AF.
2023. Design and assembly of a biofactory for (2 S)-naringenin
production in Escherichia coli effects of oxygen transfer on yield and
gene expression. Biomolecules 13:565. https://doi.org/10.3390/
biom13030565
45. Wattam AR, Abraham D, Dalay O, Disz TL, DriscollT, Gabbard JL, Gillespie
JJ, Gough R, Hix D, Kenyon R, Machi D, Mao C, Nordberg EK, Olso R,
Overbeek R, Pusch GD, Shukla M, Schulman J, Stevens RL, SullivanDE,
Vonstein V, Warren A, Will R, Wilson MJC, Yoo HS, Zhang C, ZhangY,
Sobral BW. 2014. PATRIC, the bacterial Bioinformatics database and
analysis resource. Nucleic Acids Res 42:D581–D591. https://doi.org/10.
1007/s13205-014-0202-4
46. Caspi R, Altman T, Billington R, Dreher K, Foerster H, Fulcher CA, Holland
TA, Keseler IM, Kothari A, Kubo A, Krummenacker M, Latendresse M,
Mueller LA, Ong Q, Paley S, Subhraveti P, Weaver DS, Weerasinghe D,
Downloaded from https://journals.asm.org/journal/spectrum on 15 December 2023 by 2a02:2454:9fa7:c900:8cb3:50b5:aeb2:e06a.
Zhang P, Karp PD. 2014. The MetaCyc database of metabolic pathways
and enzymes and the BioCyc collection of pathway/genome databases.
Nucleic Acids Res 42:D471–D480. https://doi.org/10.1093/nar/gkt1103
47. Kanehisa M, Goto S. 2000. KEGG: kyoto encyclopedia of genes and
genomes. Nucleic Acids Res 28:27–30. https://doi.org/10.1093/nar/28.1.
27
48. Kanehisa M, Furumichi M, Tanabe M, Sato Y, Morishima K. 2017. KEGG:
new perspectives on genomes, pathways, diseases and drugs. Nucleic
Acids Res 45:D353–D361. https://doi.org/10.1093/nar/gkw1092
49. Gietz RD, Woods RA. 2006. Yeast transformation by the LiAc/SS carrier
DNA/PEG method, p 107–120. In Xiao W (ed), Yeast protocols. Humana
Press, Totowa, New Jersey.
50. Azevedo F, Pereira H, Johansson B. 2017. Colony PCR, p 129–139. In
Domingues L (ed), (ed), Methods in molecular biology
10.1128/spectrum.03374-23 13