Letters in Applied Microbiology ISSN 0266-8254

ORIGINAL ARTICLE

Use of the rpoB gene as an alternative to the V3 gene for

the identification of spoilage and pathogenic bacteria
species in milk and milk products
V. Deperrois-Lafarge and T. Meheut
ANSES (French Agency for Food, Environmental and Occupational Health & Safety), Maisons-Alfort Laboratory for Food Safety, Ecophysiology and
Bacterial Detection unit, Maisons Alfort Cedex, France

Keywords
bacterial species, database, denaturing
gradient gel electrophoresis, milk and milk
products, RNA-polymerase beta-subunit
Correspondence
Véronique Deperrois-Lafarge, ANSES (French
Agency for Food, Environmental and
Occupational Health & Safety), Maisons-Alfort
Laboratory for Food Safety, Ecophysiology
and Bacterial Detection unit, 23 avenue du
Général de Gaulle, 94706 Maisons Alfort
Cedex, France.
E-mail: veronique.deperrois@anses.fr
2011 ⁄ 1905: received 8 November 2011,
revised 27 April 2012 and accepted 27 April
2012
doi:10.1111/j.1472-765X.2012.03261.x
Abstract
Aim: To evaluate the rpoB gene as an alternative to the V3 gene for the identi-
fication of bacterial species in milk and milk products.
Methods and Results: DNA obtained from different bacterial species strains
was amplified by PCR using rpoB primers. PCR products of each bacterial spe-
cies were then separated on a DGGE gel. The molecular fingerprints of the bac-
terial species tested were integrated into a database. The DGGE analysis shows
a single band for the rpoB gene amplicons per each bacterial species. Compari-
son of electrophoretic profiles obtained from V3 16S rDNA amplification with
those from this study obtained with rpoB showed that for some bacterial spe-
cies that co-migrated after amplification of the V3 region, distinct bands were
observed on the gel with the amplification products of the rpoB region.
Conclusions: The results obtained in this study show the discriminatory power
of the rpoB gene, indicating that it can be used as an alternative to the V3 16S
rRNA gene for the identification of bacterial species in milk and milk products.
Significance and Impact of the Study: PCR-DGGE targeting the rpoB gene is a
way of discriminating the bacterial species that co-migrated with the amplifica-
tion of the V3 gene and so avoids the sequencing of the co-migrating bands.

masures 1995, Demarigny 1996; Desmasures et al. 1997;

Introduction
Milk and milk products are good cultural media contain-
ing a great variety of micro-organisms. The composition
of the microbiota in raw milk, and the load of and inter-
actions between micro-organisms play an essential role in
the development of the flavour of dairy products. In
addition, the development in the milk of pathogenic or
spoilage micro-organisms depends on the interactions
with the other micro-organisms (antagonist effects and
competition effects). It is important to characterize the
microbial ecosystem of milk and milk products because
the nature of micro-organisms and their interactions
probably influence the shelf life and the organoleptic
qualities of the finished products.
Until recently, the bacterial community in milk and milk
products was described by classical microbiological meth-
ods, which are generally long and tedious, allowing only a
partial inventory of bacterial microbiota (Bazin 1992; Des-
Michel et al. 2001). Molecular approaches based on the
direct analyses of DNA (or RNA) in its environment with-
out microbial enrichment enable more precise descriptions
to be made of identity, diversity and microbial dynamics in
dairy ecosystems. The most developed methods are single-
strand conformational polymorphism (SSCP) (Duthoit
et al. 2003; Feurer et al. 2004), temporal temperature gradi-
ent gel electrophoresis (TTGE) (Ogier et al. 2002; Lafarge
et al. 2004) and denaturing gradient gel electrophoresis
(DGGE) (Dolci et al. 2010; Raats et al. 2011). The PCR-
DGGE technique has already been used to evaluate microbial
diversity in milk and milk products, to study the evolution
of microbial populations during cheese manufacture and
ripening (Randazzo et al. 2002; Casalta et al. 2009) and to
understand the influence of processes such as refrigeration
(Raats et al. 2011) or pasteurization on microbial diversity
(Van Hoorde et al. 2010). After extraction of DNA (or
RNA) from samples, a discriminating region of the genome

No claim to French Government works

Letters in Applied Microbiology ª 2012 The Society for Applied Microbiology 1
Use of the rpoB gene as an alternative to the V3 gene V. Deperrois-Lafarge and T. Meheut

is amplified by PCR. DNA fragments of different sequences Table 1 List of bacterial strains tested in this study
are then separated in denaturing conditions (TTGE, Genus Species (sub-species) Strain number (origin)
DGGE) or not (CE-SSCP).
The 16S rRNA gene sequence is currently used for bac- Acinetobacter johnsonii AN169 (raw milk)
terial species identification from prokaryotes. It possesses Acinetobacter johnsonii AN132 (CIP 64.6T,
duodenum)
conserved regions found in all prokaryotes and numerous
Acinetobacter baumannii AN168 (milk powder)
hyper-variable regions. These variable regions are in most Acinetobacter baumannii AN63 (CIP 70.34T, urine)
cases specific to the species or sometimes to the sub-spe- Acinetobacter lwofii AN33 (raw milk)
cies. In the microbial ecology of foodstuffs, the variable Acinetobacter lwofii AN143 (cheese)
regions V2, V3, V6, V8 are usually used for the bacterial Acinetobacter lwofii AN157 (environment
identification (Randazzo et al. 2002; Ercolini et al. 2004). cheese dairy)
In some cases, species belonging to different or identical Aeromonas AN51 (raw milk)
Alcaligenes faecalis AN65 (CIP 60.80T,
genera cannot be differentiated. The amplified 16S rRNA
not specified)
gene sequences are the same, and ⁄ or Tm values of co- Alcaligenes faecalis AN66 (CIP 102.140,
migrated fragments from these bacteria are also identical faeces)
(Ogier et al. 2004). In addition, some bacterial species are Alcaligenes tolerans AN74 (CIP 55.94, milk)
characterized by two or more bands because of the heter- Bacillus lentus AN26 (pasteurized milk)
ogeneity of the 16S rDNA operon (Nubel et al. 1996; Bacillus licheniformis AN6 (pasteurized milk)
Crosby and Criddle 2003). Bacillus licheniformis AN4 (pasteurized milk)
Buttiauxella agrestis AN18 (raw milk)
The identification of bands is performed after cutting
Buttiauxella agrestis AN19 (raw milk)
the gel, cloning or not in a plasmid and sequencing (Ran- Citrobacter freundii AN17 (raw milk)
dazzo et al. 2002; Cocolin et al. 2004). The sequence Citrobacter freundii AN16 (raw milk)
obtained is compared with those in the international Corynebacterium casei AN113
rDNA sequence banks. (CIP 107.182, cheese)
Ogier et al. (2004) develop an approach to identify rap- Corynebacterium glutamicum AN115 (CIP 82.8, sewage)
idly the bacteria in unknown dairy ecosystems by com- Cronobacter sakazakii AN128 (milk powder)
Cronobacter sakazakii AN102
paring bands with an exhaustive bacterial species database
(CIP 57.33, milk powder)
(c. 170 species) including useful dairy micro-organisms Enterobacter AN164 (raw milk)
(lactic acid bacteria, etc.), spoilage bacteria (Pseudomonas, Enterobacter aerogenes AN43 (raw milk)
Enterobacteriaceae, etc.) and pathogenic bacteria (Listeria Enterobacter aerogenes AN41 (raw milk)
monocytogenes, Staphylococcus aureus, etc.). In this study, Enterobacter amnigenus AN165 (raw milk)
this molecular approach was optimized by adding com- Enterobacter amnigenus AN79 (CIP 103.169T,
plementary information on another gene (rpoB gene) to ground)
Enterobacter cloacae AN42 (raw milk)
discriminate bacterial species that co-migrated with V3
Enterobacter Cloacae AN101 (CIP 60.85T
gene amplification (Ogier et al. 2004). The advantage of subsp. cloacae spinal fluid)
the RNA-polymerase Beta-subunit encoding gene (rpoB) Escherichia coli AN8 (cheese)
is that there is a single copy in the genome so the number Escherichia coli AN7 (cheese)
of bacterial species in a microbial ecosystem is not overes- Escherichia coli AN186 (raw milk)
timated (Dahllof et al. 2000). The rpoB gene has already Escherichia coli AN187 (raw milk)
been used to identify and classify bacterial species and has Escherichia hermannii AN174 (milk powder)
Hafnia alvei AN1 (raw milk)
been shown to be more discriminative than the 16S rRNA
Hafnia alvei AN3 (raw milk)
gene (Blackwood et al. 2004; Da Mota et al. 2004; Dran- Klebsiella pneumoniae AN55 (raw milk)
court et al. 2004; Ki et al. 2009). Klebsiella pneumoniae AN106
In this study, the primers designed by Renouf et al. subsp pneumoniae (CIP 52.145,
(2006) were chosen to identify the spoilage and patho- Not specified)
genic bacteria of milk and milk products. Klebsiella pneumoniae subsp AN97 (CIP 82.91T,
pneumoniae Not specified)
Klebsiella pneumoniae AN56 (raw milk)
Materials and methods Klebsiella oxytoca AN13 (raw milk)
Klebsiella oxytoca AN14 (raw milk)
Selection of bacterial strains Kluyvera cryocrescens AN58 (raw milk)
Kluyvera cryocrescens AN38 (raw milk)
Ninety-one different bacterial species strains (Table 1) Kluyvera ascorbata AN37 (raw milk)
isolated mainly from dairy products were tested, espe-

No claim to French Government works

2 Letters in Applied Microbiology ª 2012 The Society for Applied Microbiology
V. Deperrois-Lafarge and T. Meheut Use of the rpoB gene as an alternative to the V3 gene

Table 1 Continued cially spoilage bacteria (e.g. Pseudomonas and Enterobacte-

Genus Species (sub-species) Strain number (origin)
riaceae) and pathogenic bacteria (e.g. Listeria species and
Staphylococcus species). In most cases, at least two strains
Kluyvera intermedia AN44 (raw milk) from each species group were tested. The isolated bacte-
Kluyvera intermedia AN45 (raw milk) rial strains were characterized by biochemical tests (Gram
Listeria innocua AN27 (environment
stain coloration, mobility, catalase and oxidase tests), the
cheese dairy)
Listeria innocua AN29 (cheese)
API system (Marcy-l’Etoile, France) and sequencing of
Listeria ivanovii AN137 (cheese) 16S rRNA.
Listeria monocytogenes AN28 (environment
cheese dairy)
Listeria monocytogenes AN158 (environment
DNA extraction of bacterial strains
cheese dairy) DNAs were extracted with the FTA card (Whatman,
Pantoea agglomerans AN59 (raw milk)
Maidstone, UK). The protocol was as follows. Character-
Pseudomonas fluorescens AN163 (raw milk)
Pseudomonas fluorescens AN31 (raw milk)
ized bacterial strains were isolated on cultivated TSA-YE
Pseudomonas fluorescens AN76 (CIP 63.47, soil) medium (Biokar Diagnostics, Beauvais, France). After
Pseudomonas fluorescens AN77 (CIP 69.13T, 1 day of incubation at 30C for the Gram-negative bac-
water tank) teria (25C for Pseudomonas) and 1 day of incubation at
Pseudomonas fragi AN150 (cheese) 37C for the Gram-positive bacteria, one colony was
Pseudomonas putida AN12 (raw milk) cultivated on BHI broth (Oxoı̈d, Dardilly, France). The
Pseudomonas AN25 (raw milk)
BHI liquid medium was incubated at 30 or 37C for
Raoultella planticola AN62 (raw milk)
Raoultella planticola AN107 (raw milk)
1 day. Ten to twenty microlitre of the BHI liquid med-
Raoultella terrigena AN21 (raw milk) ium (O.D. at 600 nm: 1Æ8) were placed on an FTA
Raoultella terrigena AN22 (raw milk) card. After drying at ambient temperature for 1 h, the
Raoultella terrigena AN57 (raw milk) DNA extraction was pursued in a PCR tube containing a
Salmonella typhimurium AN123 (cheese) punch from the FTA card and 100 ll of filtered FTA
Salmonella dublin AN124 (cheese) purification medium. The punch from the FTA card
Salmonella enterica AN125 (cheese)
was washed in sterilized water twice.
Salmonella agona AN126 (milk powder)
Serratia liquefaciens AN34 (raw milk)
Serratia liquefaciens AN35 (raw milk) Sequencing of 16S rRNA from bacterial strains
Serratia marcescens AN23 (raw milk)
Serratia marcescens AN24 (raw milk) Primers 1387 (5¢-GGG-CGG-TGT-GTA-CAA-GGC-3¢)
Shigella AN172 (cheese) (Dennis et al. 2003), SP4 (5¢-CTC-GTT-GCG-GGA-
Shigella flexneri AN127 (cheese) CTT-AAC-3¢) (Cibik et al. 2000) and 27 (5¢-AGA-GTT-
Staphylococcus aureus AN170 (cheese)
TGA-TCA-TGG-CTC-AG-3¢) (Frank et al. 2008) were
Staphylococcus aureus AN184 (cheese)
Staphylococcus aureus AN185 (cheese)
used.
Staphylococcus chromogenes AN142 (cheese) PCR amplification was performed in 50 ll of total vol-
Staphylococcus epidermidis ⁄ capitis AN160 (cheese) ume containing a punch from an FTA card, a reaction
Staphylococcus haemolyticus AN141 (cheese) buffer (Tris–HCL 10 mmol l)1, MgCl2 1Æ5 mmol l)1 and
Staphylococcus haemolyticus AN32 (raw milk) KCl 50 mmol l)1) (Roche Diagnostics, Mannheim, Ger-
Staphylococcus haemolyticus AN68 (CIP 81.56, many), 200 lmol l)1 of each dNTP (Roche Diagnostics),
human skin)
0Æ6 lmol l)1 of each primer (Sigma Aldrich, Evry, France)
Staphylococcus vitulinus AN140 (cheese)
Staphylococcus vitulinus AN144 (cheese)
and 2Æ5 U of Taq polymerase 5 U ll)1 (Roche Diagnos-
Stenotrophomonas maltophilia AN10 (raw milk) tics). The samples were amplified in a Veriti thermal
Streptococcus dysgalactiae AN84 cycler (Applied Biosystems, Courtaboeuf, France). The
(CIP 102.913T, cow) sequencing reactions were carried out using the following
Streptococcus agalactiae AN83 (CIP 102.227T, milk) cycling programme: initial denaturation step at 92C for
Streptococcus bovis AN72 (CIP 102.302T, 2 min, followed by 35 cycles of denaturation at 94C for
cow dung)
15 s, annealing at 55C for 30 s and extension at 72C for
Streptococcus uberis AN179 (CIP 105.450,
bovine udder infection)
90 s. A final extension step at 72C for 7 min was then
Streptococcus gallolyticus AN103 (CIP 103.232, performed. The purity and length of the PCR products
milk mastitis) was verified on 2% agarose gels (Euromedex, Mundols-
heim, France) compared with a standard containing DNA
CIP, Collection of the Institute Pasteur (Paris, France).
fragments of defined lengths (DNA molecular weight

No claim to French Government works

Letters in Applied Microbiology ª 2012 The Society for Applied Microbiology 3
Use of the rpoB gene as an alternative to the V3 gene
marker VI; Roche Diagnostics). Sequencing was per-
formed by Eurofins (Eurofins, Ebersberg, Germany).
Sequences obtained were aligned using the site http://
www.ebi.ac.uk/Tools/msa/clustalw2/ and were compared
to sequences in the ribosomal database project (http://
rdp.cme.msu.edu/seqmatch/seqmatch_intro.jsp) to deter-
mine the closest known relatives of the partial 16S rDNA.
The GenBank accession numbers for the sequences depos-
ited are given in Table 2.
Amplification of the rpoB gene
Primers rpoB1 (5¢-ATT-GAC-CAC-TTG-GGT-AAC-CGT-
CG-3¢), rpoB1o (5¢-ATC-GAT-CAC-TTA-GGC-AAT-CG
T-CG-3¢) and rpoB2 (5¢- ACG-ATC-ACG-GGT-CAA-AC
C-ACC-3¢) (Renouf et al. 2006) were used. A GC clamp
(5¢-CGC-CCG-CCG-CGC-GCG-GCG-GGC-GGG-GCG-G
GG-GCA-CGG-GGG-G-3¢) was added to the primer rpoB2
(Couto Motta et al. 2006).
PCR amplification was performed in 50 ll of total vol-
ume containing a punch from an FTA card, a reaction
buffer (Tris–HCL 10 mmol l)1, MgCl2 1Æ5 mmol l)1 and
KCl 50 mmol l)1) (Q-BIOgene, Illkirch, France),
200 lmol l)1 of each dNTP (Q-BIOgene), 60 pmol of
each primer (rpoB1, rpoB2, rpoB1o) (Sigma Aldrich) and
2Æ5 U of Taq polymerase 5 U ll)1 (Q-BIOgène). The
samples were amplified in a Veriti thermal cycler (Applied
Biosystems). The PCR profile started with an initial dena-
turation step at 92C for 2 min, followed by 35 cycles of
denaturing for 15 s at 94C, annealing for 30 s at 55C
and extension for 90 s at 72C. A final extension step at
72C for 7 min was then performed. The purity and
lengths of PCR products of 250 bp were verified on 2%
agarose gels (Euromedex) compared with a standard con-
taining DNA fragments of defined lengths (DNA molecu-
lar weight marker VI; Roche Diagnostics).
Separation of rpoB fragments by DGGE
For DGGE analysis, the Ingeny DGGE system (Ingeny
Phor U, Goes, the Netherlands) was used to separate the
rpoB region PCR products. PCR products (200 lg) quan-
tified with a Qubit fluorometer (Invitrogen, Eugene,
USA) were added to 5 ll of loading buffer (EDTA
100 mmol l)1, bromophenol blue 1Æ5 mg ml)1, sucrose
40%). Samples were electrophoresed on 8% (w ⁄ v) poly-
acrylamide gels containing a denaturing gradient from 25
to 70% urea and formamide (a 100% denaturant corre-
sponds to 7 mol l)1 urea and 40% (v ⁄ v) formamide) in
TAE 1Æ25· running buffer. A marker containing six refer-
ence species (Staphylococcus haemolyticus AN141, Strepto-
coccus agalactiae AN83, Buttiauxella agrestis AN18,
Pantoea agglomerans AN59, Pseudomonas putida AN12
4 Letters in Applied Microbiology ª 2012 The Society for Applied Microbiology
V. Deperrois-Lafarge and T. Meheut
and Escherichia hermannii AN174) was loaded onto every
gel. Migration was performed at 120 V for 16 h, keeping
the running buffer temperature constant at 60C. Gels
were stained, photographed and analysed as below.
Gel analysis and reference database setup
DGGE gels were normalized by including an identifica-
tion ladder made up of six reference species. A reference
database using Bionumerics software (Applied-Maths,
Sint-Martens-Latem, Belgium), a data-processing tool,
was established. For this purpose, the photographed gels
were converted into a file image, which was then analysed
by Bionumerics. The software standardizes DGGE pro-
files to minimize migration differences between gels
(Ogier et al. 2002). The molecular fingerprints of each
bacterial species were integrated into the Bionumerics
database.
Results
The molecular fingerprints of bacterial species tested were
integrated into a database (Fig. 1). On 91 bacterial species
tested with the primers rpoB1, rpoB1o and rpoB2, all bac-
terial species amplified, except for Salmonella, Raoultella
planticola and Raoultella terrigena. For the bacterial spe-
cies tested, amplification with the rpoB1, rpoB1o and
rpoB2 primers showed a single fingerprint. Among the
bacterial species tested in this study, by amplifying the
rpoB region, some species could not be differentiated
(Fig. 1), that is, Enterobacter cloaceae and Enterobacter sp,
Shigella flexneri and Escherichia coli, Kluyvera ascorbata
and Kluyvera cryocrescens, Serratia liquefaciens and Klebsi-
ella oxytoca, and Alcaligenes tolerans and Pseudomonas
fragi. In the case of Ser. liquefaciens and Kl. oxytoca
(Fig. 2) and also for Sh. flexneri and Escherichia coli, and
K. ascorbata and K. cryocrescens, the alignment of partial
sequences of the rpoB gene from these species showed
high similarity between rpoB sequences. For Ent. cloaceae
and Enterobacter sp, the alignment of partial sequences of
rpoB gene showed the same G+C content.
For the bacterial species tested, in most cases several
strains were analysed. The strains isolated from dairy
products had the same migration distance (Fig. 3),
whereas this generally differed when the strains were iso-
lated from other biotopes (Fig. 4). In this study, different
intra-species migration was observed for Pseudomonas flu-
orescens (Fig. 4, lanes 16, 17 and 18), Alcaligenes faecalis
(Fig. 4, lanes 6 and 7), Acinetobacter johnsonii (Fig. 4,
lanes 2 and 3), Enterobacter amnigenus (Fig. 4, lanes 8
and 9), Staphylococcus haemolyticus (Fig. 4, lanes 19 ⁄ 21
and 20) and Enterobacter cloacae (Fig. 4, lanes 11 and 12).
Strains of Staph. haemolyticus (AN141 and AN32) (Fig. 4,
No claim to French Government works
V. Deperrois-Lafarge and T. Meheut Use of the rpoB gene as an alternative to the V3 gene

Table 2 List of bacterial strains included in rpoB reference database

Analysis of the sequence

Strain number Origin Species GenBank no. % identity

AN55 Raw milk Klebsiella pneumoniae EU661374 99Æ6

AN43 Raw milk Enterobacter aerogenes EU047701 97Æ2
AN141 Cheese Staphylococcus haemolyticus D83361 99Æ1
AN14 Raw milk Klebsiella oxytoca AM160653 99Æ1
AN168 Milk powder Acinetobacter baumannii X81667 99Æ6
AN140 Cheese Staphylococcus vitulinus AB009942 99Æ4
AN169 Raw milk Acinetobacter johnsonii DQ911549 98Æ8
AN12 Raw milk Pseudomonas putida AJ276649 97Æ4
AN10 Raw milk Stenotrophomonas maltophilia AF186705 98Æ2
AN51 Raw milk Aeromonas sp AF099027 99Æ2
AN25 Raw milk Pseudomonas sp AY439264 100
AN150 Environment cheese dairy Pseudomonas fragi AF094733 98Æ3
AN34 Raw milk Serratia liquefaciens AJ306725 98Æ2
AN128 Milk powder Cronobacter sakazakii GU122222 99Æ4
AN42 Raw milk Enterobacter cloaceae AB244288 99Æ1
AN6 Pasteurized milk Bacillus licheniformis AJ582721 97Æ6
AN172 Cheese Shigella spp FJ789710 99Æ1
AN58 Raw milk Kluyvera cryocrescens AF310218 100
AN37 Raw milk Kluyvera ascorbata AJ627202 99Æ0
AN164 Raw milk Enterobacter sp EU169681 97Æ3
AN17 Raw milk Citrobacter freundii EU880505 100
AN44 Raw milk Kluyvera intermedia AF310217 99Æ0
AN165 Raw milk Enterobacter amnigenus DQ481471 96Æ5
AN18 Raw milk Buttiauxella agrestis AJ233400 98Æ4
AN23 Raw milk Serratia marcescens AY514433 91Æ6
AN1 Raw milk Hafnia alvei DQ412565 97Æ3
AN26 Pasteurized milk Bacillus sp AF333558 100
AN33 Raw milk Acinetobacter lwofii X81665 99Æ8
AN160 Cheese Staphylococcus epidermidis ⁄ capitis D83362 ⁄ AB233325 99Æ6
AN7 Cheese Escherichia coli EU046498 100
AN142 Cheese Staphylococcus chromogenes D83360 98Æ7
AN137 Cheese Listeria ivanovii Not sequenced
AN28 Environment cheese dairy Listeria monocytogenes FJ160766 99
AN27 Environment cheese dairy Listeria innocua AL596164 99Æ9
AN59 Raw milk Pantoea agglomerans DQ307452 98Æ3
AN163 Raw milk Pseudomonas fluorescens AJ308307 98Æ8
AN174 Milk powder Escherichia hermannii Not sequenced
AN127 Cheese Shigella flexneri Not sequenced
AN184 Cheese Staphylococcus aureus Not sequenced
AN74 (CIP 55.94) Milk Alcaligenes tolerans
AN115 (CIP 82.8) Sewage Corynebacterium glutamicum Sequenced
AN113 (CIP 107182) Cheese Corynebacterium casei
AN84 (CIP 102913T) Cow Streptococcus dysgalactiae Sequenced
AN83 (CIP 102227T) Milk Streptococcus agalactiae Sequenced
AN72 (CIP 102302T) Cow dung Streptococcus bovis Sequenced
AN179 (CIP 105450) Bovine udder infection Streptococcus uberis Sequenced
AN103 (CIP 103232) Milk mastitis Streptococcus gallolyticus Sequenced

CIP, Collection of the Institute Pasteur (Paris, France).

lanes 19 and 21) isolated from dairy products (raw milk different. Conversely, strains of Kl. pneumoniae (Fig. 4,
and cheese) showed the same migration distance, whereas lanes 13, 14 and 15) and Acinetobacter baumannii (Fig. 4,
with another strain, AN68 (CIP 81.56) isolated from lanes 4 and 5) gave the same migration distance, whereas
human skin (Fig. 4, lane 20), the migration distance was these strains were isolated from different biotopes.

No claim to French Government works

Letters in Applied Microbiology ª 2012 The Society for Applied Microbiology 5
Use of the rpoB gene as an alternative to the V3 gene V. Deperrois-Lafarge and T. Meheut

Direction of electrophoresis

Escherichia hermannii AN174

Pseudomonas putida AN12
Stenotrophomonas maltophilia AN10
Aeromonas sp AN51
Pseudomonas spp AN25
Alcaligenes tolerans AN74
Pseudomonas fragi AN150
Serratia liquefaciens AN34
Klebsiella oxytoca AN13
Enterobacter aerogenes AN43
Serratia marcescens AN23
Corynebacterium glutamicum AN115
Cronobacter sakazakii AN 128
Bacillus licheniformis AN6
Corynebacterium casei AN113
Shigella spp AN172
Escherichia coli AN7
Shigella flexneri AN127
Kluyvera cryocrescens AN58
Kluyvera ascorbata AN37
Klebsiella pneumoniae AN55
Pseudomonas fluorescens AN163
Enterobacter cloaceae AN42
Enterobacter sp AN164
Pantoea agglomerans AN59
Citrobacter freundii AN17
Kluyvera intermedia AN44
Enterobacter amnigenus AN165
Buttiauxella agrestis AN18
Hafnia alvei AN1
Streptococcus dysgalactiae AN 84
Bacillus sp AN26
Streptococcus uberis AN179
Streptococcus agalactiae AN83
Streptococcus bovis AN 72
Acinetobacter lwoffii AN33
Acinetobacter johnsonii AN169
Acinetobacter baumanii AN168
Streptococcus gallolyticus AN103
Staphylococcus chromogenes AN142?
Staphylococcus vitulinus AN140
Staphylococcus epidermidis/Staphylococcus capitis AN160
Listeria ivanovii AN137
Listeria innocua AN27
Listeria monocytogenes AN28
Staphylococcus haemolyticus AN141
Staphylococcus aureus AN184

Figure 1 DGGE database of rpoB fragments from pure bacterial strains

AN13_rpoB1 : CGTGTAGGTCTGGTACGTGTTGAGCGTGCGGTGAAAGAACGTCTGTCCCTGGGCGATCTGGATACCCTGATGCCACAGGACATGATCAACGCCAAGCCAATTTCGGCGGCGGTGAAAGAGTTCTTCG
AN14_rpoB1 : CGTGTAGGTCTGGTACGTGTTGAGCGTGCGGTGAAAGAACGTCTGTCCCTGGGCGATCTGGATACCCTGATGCCACAGGACATGATCAACGCCAAGCCAATTTCGGCGGCGGTGAAAGAGTTCTTCG
AN34_rpoB1 : CGTGTAGGTCTGGTACGTGTTGAGCGTGCGGTGAAAGAACGTCTGTCCCTGGGCGATCTGGATACCCTGATGCCACAGGACATGATCAACGCCAAGCCAATTTCGGCGGCGGTGAAAGAGTTCTTCG
AN35_rpoB1 : CGTGTAGGTCTGGTACGTGTTGAGCGTGCGGTGAAAGAACGTCTGTCCCTGGGCGATCTGGATACCCTGATGCCACAGGACATGATCAACGCCAAGCCAATTTCGGCGGCGGTGAAAGAGTTCTTCG

AN13_rpoB1 : GCTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACCCGTTGTCCGAGATCACGCACAAGCGTCGTATCTCTGCATTGGGCCCAGGTGGTTTGACCCGTGATCGTGCCCCCCCGTGCCCCCGCCCCGCCCG
AN14_rpoB1 : GCTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACCCGTTGTCCGAGATCACGCACAAGCGTCGTATCTCTGCATTGGGCCCAGGTGGTTTGACCCGTGATCGTGCCCCCCCGTGCCCCCGCCCCGCCCG
AN34_rpoB1 : GCTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACCCGTTGTCCGAGATCACGCACAAGCGTCGTATCTCTGCATTGGGCCCAGGTGGTTTGACCCGTGATCGTGCCCCCCCGTGCCCCCGCCCCGCCCG
AN35_rpoB1 : GCTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACCCGTTGTCCGAGATCACGCACAAGCGTCGTATCTCTGCATTGGGCCCAGGTGGTTTGACCCGTGATCGTGCCCCCCCGTGCCCCCGCCCCGCCCG

Figure 2 Alignment of the rpoB gene partial sequences of Klebsiella oxytoca (strains: AN 13, AN14) and serratia liquefaciens (strains: AN34,
AN35)

No claim to French Government works

6 Letters in Applied Microbiology ª 2012 The Society for Applied Microbiology
V. Deperrois-Lafarge and T. Meheut Use of the rpoB gene as an alternative to the V3 gene

c
d

e
f

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

Figure 3 DGGE profiles of rpoB gene regions obtained from different bacterial strains. Lane 1, marker. Lane 2, Acinetobacter lwofii AN33. Lane
3, Ac. lwofii AN143. Lane 4, Ac. lwofii AN157. Lane 5, Buttiauxella agrestis AN18. Lane 6, B. agrestis AN19. Lane 7, Citrobacter freundii AN17.
Lane 8, Cit. freundii AN16. Lane 9, Cronobacter sakazakii AN128. Lane 10, Escherichia coli AN8. Lane 11, marker. Lane 12, C. sakazakii AN102.
Lane 13, E. coli AN7. Lane 14, Hafnia alvei AN1. lane 15, H. alvei AN3. lane 16, Kluyvera cryocrescens AN58. Lane 17, K. cryocrescens AN38.
Lane 18, Serratia liquefaciens AN34. Lane 19, Ser. liquefaciens AN35. Lane 20, E. coli AN186. Lane 21, E. coli AN187. Lane 22, marker. Markers
(arrowed): a, Staphylococcus haemolyticus AN141; b, Streptococcus agalactiae AN83; c, B. agrestis AN18; d, Pantoea agglomerans AN59; e, Pseu-
domonas putida AN 12; f, E. hermannii AN174.

Acinetobacter johnsonii, Ent. amnigenus, Staph. haemolyti-

Discussion
This study demonstrated the potential of the rpoB gene
for the identification of the bacterial species which can be
found in milk and milk products.
DGGE analysis of the rpoB gene produces a single band
per species on the gel, in agreement with the results
obtained by Dahllof et al. (2000). The presence of two or
more amplified V3 segments obtained for ‘Bacillus licheni-
formis’, ‘Hafnia alvei’, ‘Ps. fragi’, ‘Staph. haemolyticus’,
‘Kl. pneumoniae’, ‘Citrobacter freundii’ and ‘Ent. amnige-
nus’ (Ogier et al. 2004) is probably due to the heterogene-
ity of the 16S rDNA operon (Coenye and Vandamme
2003). The advantage with the amplification of the rpoB
gene is that the number of bacterial species in a microbial
ecosystem is not overestimated (Dahllof et al. 2000).
However, for some bacterial species, the presence of
co-migrating bands in our database was observed. This
can be explained by identical Tm values of co-migrated
fragments from these bacteria. The same Tm values
between different bacterial species are because of the simi-
larity of the rpoB region or to the same G+C content in
the rpoB region. With the amplification of the rpoB gene,
we also observed the heterogeneity of the sequence within
a species for Pseudomonas fluorescens, Alcaligenes faecalis,
cus and Enterobacter cloaceae. This has already been
observed with the V3 sequence (Ogier et al. 2004) for a
few species, namely Pseudomonas fluorescens, Kl. oxytoca,
Staph. haemolyticus and Brevibacterium linens. The differ-
ence in the rpoB sequence for the same species could also
be explained in this study by differences in ecological ori-
gins (Ogier et al. 2004). As for the database species devel-
oped in a previous study on the V3 sequence (Ogier et al.
2004), only the strains originating from dairy environ-
ments were conserved in the rpoB database species. Con-
cerning the non-amplification of the rpoB gene for some
bacterial species, the determination of the complete rpoB
sequence of these bacterial species as described by Dran-
court et al. (2004) is actually studied to explain this and
to find a consensus with the primers used to amplify all
bacterial species. The major disadvantage in using the
rpoB gene resides in the fact that it is difficult to design
universal primers, contrary to the V3 16S rRNA gene
(Case et al. 2007).
Comparison of TTGE ⁄ DGGE profiles obtained from
V3 16S rRNA amplification (Ogier et al. 2004) with those
of the present study with rpoB showed that for some bac-
terial species that co-migrated after amplification of the
V3 region, that is, ‘Ent. amnigenus and Kl. oxytoca’,

No claim to French Government works

Letters in Applied Microbiology ª 2012 The Society for Applied Microbiology 7
Use of the rpoB gene as an alternative to the V3 gene V. Deperrois-Lafarge and T. Meheut

c
d

e
f

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

Figure 4 DGGE profiles of rpoB gene regions obtained from different bacterial strains. Lane 1, marker. Lane 2, Acinetobacter johnsonii AN169.
Lane 3, Ac. johnsonii AN132. Lane 4, Acinetobacter baumannii AN168. Lane 5, Ac. baumannii AN63. Lane 6, Alcaligenes faecalis AN65. Lane 7,
Alc. faecalis AN66. Lane 8, Enterobacter amnigenus AN165. Lane 9, Ent. amnigenus AN79. Lane 10, marker. Lane 11, Enterobacter cloaceae
AN42. Lane 12, Ent. cloaceae AN101. Lane 13, Klebsiella pneumoniae AN55. Lane 14, Kl. pneumoniae AN97. Lane 15, Kl. pneumoniae AN106.
Lane 16, Pseudomonas fluorescens AN163. Lane 17, Ps. fluorescens AN76. Lane 18, Ps. fluorescens AN77. Lane 19, Staphylococcus haemolyticus
AN141. Lane 20, Staph. haemolyticus AN68. Lane 21, Staph. haemolyticus AN32. Lane 22, marker. Markers (arrowed): a, Staph. haemolyticus
AN141; b, Streptococcus agalactiae AN83; c, Buttiauxella agrestis AN18; d, Pantoea agglomerans AN59; e, Pseudomonas putida AN 12; f, E. her-
mannii AN174.

‘Escherichia coli and Kl. pneumoniae’, ‘Kl. pneumoniae and
B. licheniformis’, ‘Kl. oxytoca and Bacillus sp’, ‘Citrobacter
freundii and Stenotrophomonas maltophilia’, ‘Kl. oxytoca
and Ser. liquefaciens and Enterobacter cloacae’, ‘Cronobact-
er sakazakii and Stenotrophomonas maltophilia’, ‘Staphylo-
coccus capitis and Ps. fragi’, ‘Acinetobacter baumannii and
Staph. haemolyticus’, ‘Ps. fragi and Acinetobacter johnsonii’,
‘Ps. fragi and B. licheniformis’, ‘Streptococcus uberis and
Staphylococcus chromogenes’ and ‘Staphylococcus chromoge-
nes and Streptococcus bovis’, the same bacterial species
gave distinct bands on the gel with the amplification of
the rpoB region except for Kl. oxytoca and Ser. liquefac-
iens. On the bacterial species tested in this study, the
PCR-DGGE targeting this partial rpoB sequence could be
used to discriminate bacterial species co-migrating with
the V3 region. On the same bacterial species tested, fewer
co-migrates with the amplification of the rpoB region
than with the V3 region. Twenty-two species presented a
co-migration with the amplification of the V3 16S rRNA
gene, whereas only 10 did so with the amplification of
the rpoB gene. It can be explained that: (i) with the rpoB
gene, a single band is obtained per bacterial species com-
pared with the V3 16S rRNA gene, which revealed multi-
ple bands for one bacterial species, and ⁄ or (ii) the
discriminatory power is better with the rpoB gene than
with the V3 16S rRNA gene. The comparison of the dis-
criminatory power of the rpoB gene and the 16S rRNA
gene had already previously been demonstrated as part of
the identification of Staphylococcus species (Drancourt
and Raoult 2002), Enterobacteriaceae species (Mollet et al.
1997) or Bacillus species (Ki et al. 2009) and has been
proposed as an alternative to identify problems due to
the 16S rRNA gene, namely the presence of multiple
bands due to the heterogeneity of the 16S rDNA operon
and the high level of conservation of the 16S rRNA gene
compared to the rpoB gene (Dahllof et al. 2000; Walsh
et al. 2004).
In conclusion, PCR-DGGE targeting the rpoB gene is
a way of discriminating the bacterial species that
co-migrated with the amplification of the V3 gene. Fur-
ther developments in the context of this work will focus
on the finalization of the rpoB database with the addition
of other bacterial species isolated from milk and milk
products, and particularly useful bacterial species, and

No claim to French Government works

8 Letters in Applied Microbiology ª 2012 The Society for Applied Microbiology
V. Deperrois-Lafarge and T. Meheut
also the optimization and validation of this molecular
biology tool for the analysis of the bacterial community
in milk and milk products.
Acknowledgement
We are grateful to S. Khelil and C. Chagnot for their par-
ticipation in this project.
References
Bazin, F. (1992) La qualité microbiologique des laits de qualité
super A. Paris, France: Institut d’Etudes Supérieures d’In-
dustrie et d’Economie Laitière.
Blackwood, K.S., Turenne, C.Y., Harmsen, D. and Kabani, A.M.
(2004) Reassessment of sequence-based targets for identifi-
cation of Bacillus species. J Clin Microbiol 42, 1626–1630.
Casalta, E., Sorba, J.M., Aigle, M. and Ogier, J.C. (2009) Diver-
sity and dynamics of the microbial community during the
manufacture of Calenzana, an artisanal Corsican cheese.
Int J Food Microbiol 133, 243–251.
Case, R.J., Boucher, Y., Dahllöf, I., Holmström, C., Doolittle,
W.F. and Kjelleberg, S. (2007) Use of 16S rRNA and rpoB
genes as molecular markers for microbial ecology studies.
Appl Environ Microbiol 73, 278–288.
Cibik, R., Lepage, E. and Tailliez, P. (2000) Molecular diversity
of Leuconostoc mesenteroides and Leuconostoc citreum iso-
lated from traditional French cheeses as revealed by RAPD
fingerprinting, 16S rDNA sequencing and 16S rDNA frag-
ment amplification. Syst Appl Microbiol 23, 267–278.
Cocolin, L., Rantsiou, K., Iacumin, L., Urso, R., Cantoni, C.
and Comi, G. (2004) Study of the ecology of fresh sau-
sages and characterization of populations of lactic acid
bacteria by molecular methods. Appl Environ Microbiol 70,
1883–1894.
Coenye, T. and Vandamme, P. (2003) Intragenomic heteroge-
neity between multiple 16S ribosomal RNA operons in
sequenced bacterial genomes. FEMS Microbiol Lett 228,
45–49.
Couto Motta, F., Soares Rosado, A. and Mendonça Siqueira,
M. (2006) Comparison between denaturing gradient gel
electrophoresis and phylogenetic analysis for characteriza-
tion of A ⁄ H3N2 influenza samples detected during the
1999–2004 epidemics in Brazil. J Virol Methods 135, 76–82.
Crosby, L.D. and Criddle, C.S. (2003) Understanding bias in
microbial community analysis techniques due to rrn
operon copy number heterogeneity. Biotechniques 34, 790–
794.
Da Mota, F.F., Gomes, E.A., Paiva, E., Rosado, A.S. and Seldin,
L. (2004) Use of rpoB gene analysis for identification of
nitrogen-fixing Paenibacillus species as an alternative to the
16S rRNA gene. Lett Appl Microbiol 39, 34–40.
Dahllof, I., Baillie, H. and Kjelleberg, S. (2000) rpoB-based
Microbial community analysis avoids limitations Inherent
No claim to French Government works
Letters in Applied Microbiology ª 2012 The Society for Applied Microbiology
Use of the rpoB gene as an alternative to the V3 gene
in 16S rRNA gene intraspecies heterogeniety. Appl Environ
Microbiol 66, 3376–3380.
Demarigny, Y. (1996) Rôle de la flore du lait cru et des paramè-
tres technologiques sur l’évolution des caractéristiques biologi-
ques, microbiologiques et sensorielles des fromages à pâte
préssée cuite. PhD thesis. ENSBANA, Dijon, France.
Dennis, P., Edwards, E.A., Liss, S.N. and Fulthorpe, R. (2003)
Monitoring gene expression in mixed microbial communi-
ties by using DNA microarrays. Appl Environ Microbiol 69,
769–778.
Desmasures, N. (1995) Etude de laits de haute qualité: caractéri-
sation et aptitudes microbiologiques à la transformation en
camembert au lait cru. PhD thesis. Institute of Biochemis-
try and Applied Biology, University of Caen, Caen, France.
Desmasures, N., Bazin, F. and Gueguen, M. (1997) Microbial
composition of raw milk from selected farms in the Cam-
embert region of Normandy. J Appl Microbiol 83, 53–58.
Dolci, P., Alessandria, V., Rantsiou, K., Bertolino, M. and Coc-
olin, L. (2010) Microbial diversity, dynamics and activity
throughout manufacturing and ripening of Castelmagno
PDO cheese. Int J Food Microbiol 143, 71–75.
Drancourt, M. and Raoult, D. (2002) rpoB gene sequence-
based identification of Staphylococcus species. J Clin Micro-
biol 40, 1333–1338.
Drancourt, M., Roux, V., Fournier, P.E. and Raoult, D. (2004)
rpoB gene sequence-based identification of aerobic gram-
positive cocci of the genera Streptococcus, Enterococcus,
Gemella, Abiotrophia, and Granulicatella. J Clin Microbiol
42, 497–504.
Duthoit, F., Godon, J.J. and Montel, M.C. (2003) Bacteria
community dynamics during production of registered des-
ignation of origin salers cheese as evaluated by 16S rRNA
gene single-strand conformation polymorphism analysis.
Appl Environ Microbiol 69, 3840–3848.
Ercolini, D., Mauriello, G., Blaiotta, G., Moschetti, G. and
Coppola, S. (2004) PCR-DGGE fingerprints of microbial
succession during a manufacture of traditional water buf-
falo mozzarella cheese. J Appl Microbiol 96, 263–270.
Feurer, C., Vallaeys, T., Corrieu, G. and Irlinger, F. (2004)
Does smearing inoculum reflect the bacterial composition
of the smear at the end of the ripening of a french soft,
red-smear cheese. J Dairy Sci 87, 3189–3197.
Frank, J.A., Reich, C.J., Sharma, S., Weisbaum, J.S., Wilson,
B.A. and Olsen, G.J. (2008) Critical evaluation of two
primers commonly used for amplification of bacterial 16S
rRNA genes. Appl Environ Microbiol 74, 2461–2470.
Ki, J.S., Zhang, W. and Qian, P.Y. (2009) Discovery of marine
Bacillus species by 16S rRNA and rpoB comparisons and
their usefulness for species identification. J Microbiol Meth-
ods 77, 48–57.
Lafarge, V., Ogier, J.C., Girard, V., Maladen, V., Leveau, J.Y.,
Gruss, A. and Delacroix-Buchet, A. (2004) Raw cow milk
bacterial population shifts attributable to refrigeration.
Appl Environ Microbiol 70, 5644–5650.
9
Use of the rpoB gene as an alternative to the V3 gene
Michel, V., Hauwuy, A. and Chamba, J.F. (2001) La flore mi-
crobienne de laits crus de vache: diversité et influence des
conditions de production. Lait 81, 575–592.
Mollet, C., Drancourt, M. and Raoult, D. (1997) rpoB
sequence analysis as a novel basis for bacterial identifica-
tion. Mol Microbiol 26, 1005–1011.
Nubel, U., Engelen, B., Felske, A., Snaidr, J., Wieshuber, A.,
Amann, R.I., Ludwig, W. and Backhaus, H. (1996)
Sequence heterogeneities of genes encoding 16S rRNAs in
Paenibacillus polymyxa detected by temperature gradient
gel electrophoresis. J Bacteriol 178, 5636–5643.
Ogier, J.C., Son, O., Gruss, A., Tailliez, P. and Delacroix-Bu-
chet, A. (2002) Identification of the bacterial microflora in
dairy products by temporal temperature gradient gel elec-
trophoresis. Appl Environ Microbiol 68, 3691–3701.
Ogier, J.C., Lafarge, V., Girard, V., Rault, A., Maladen, V.,
Gruss, A., Leveau, J.Y. and Delacroix-Buchet, A. (2004)
Molecular fingerprinting of dairy microbial ecosystems by
use of temporal temperature and denaturing gradient gel
electrophoresis. Appl Environ Microbiol 70, 5628–5643.
Raats, D., Offek, M., Minz, D. and Halpern, M. (2011) Molec-
ular analysis of bacterial communities in raw milk and the
10
V. Deperrois-Lafarge and T. Meheut
impact of refrigeration on its structure and dynamics. Food
Microbiol 28, 465–471.
Randazzo, C.L., Torriani, S., Akkermans, A.D.L., de Vos, W.M.
and Vaughan, E.E. (2002) Diversity, dynamics, and activity
of bacterial communities during production of an artisanal
Sicilian cheese as evaluated by 16S rRNA analysis. Appl
Environ Microbiol 68, 1882–1892.
Renouf, V., Claisse, O., Miot-Sertier, C. and Lonvaud-Funel,
A. (2006) Lactic acid bacteria evolution during winemak-
ing: use of rpoB gene as a target for PCR-DGGE analysis.
Food Microbiol 23, 136–145.
Van Hoorde, K., Heyndrickx, M., Vandamme, P. and Huys, G.
(2010) Influence of pasteurization, brining conditions and
production environment on the microbiota of artisan
Gouda-type cheeses. Food Microbiol 27, 425–433.
Walsh, D.A., Bapteste, E., Kamekura, M. and Doolittle, W.F.
(2004) Evolution of the RNA polymerase B’ subunit gene
(rpoB’) in Halobacteriales: a complementary molecular
marker to the SSU rRNA gene. Mol Biol Evol 21, 2340–
2351.
No claim to French Government works
Letters in Applied Microbiology ª 2012 The Society for Applied Microbiology