Ecotoxicology and Environmental Safety 228 (2021) 113015

Contents lists available at ScienceDirect

Ecotoxicology and Environmental Safety

journal homepage: www.elsevier.com/locate/ecoenv

Cadmium exposure activates the PI3K/AKT signaling pathway through

miRNA-21, induces an increase in M1 polarization of macrophages, and
leads to fibrosis of pig liver tissue
Wei Cui a, Sitong Zhou b, YuLin Wang a, Xu Shi a, Honggui Liu b, *
a
College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030, PR China
b
College of Animal Science and Technology, Northeast Agricultural University, Harbin 150030, PR China

A R T I C L E I N F O A B S T R A C T

Edited by: Dr Yong Liang Cadmium (Cd) is a toxic substance that pollutes the environment with multiple organs. Long-term exposure to Cd
can cause fibrosis in the lungs and other organs of animal body. This article explored the effects of subacute Cd
Keywords: exposure on pig liver fibrosis, as well as the polarization of microRNA (miRNA) and M1/M2 macrophages during
Cadmium this process. Based on the establishment of the pig subacute CdCl2 exposure model, we used immunofluorescence
Pig Liver
staining, Masson staining, qRT-PCR and western blotting to conduct further research. The results showed that Cd
M1/M2 imbalance
exposure can increase the expression of miRNA-21, decrease the expression of TGF-β and SMAD7, increase the
TGF-β/PI3K/AKT
Fibrosis expression of PI3K/AKT signaling pathway, cause the M1/M2 imbalance and the increase of M1 polarization.
Meantime, it causes the secretion of inflammatory cytokines (TNF-α, IL-1β, and IL-6), and causes an imbalance in
the expression of TIMP1, MMP2, and MMP9, which are related to the degree of fibrosis. And the expression of
α-SMA, COL1 and COL3 were up-regulated. In the pig, these results indicate that liver fibrosis caused by subacute
CdCl2 exposure is induced by the M1 polarization of macrophages through the PI3K/AKT signaling pathway
activated by miRNA-21 signaling pathway. These research results not only enrich the theoretical basis and
reference value of Cd toxicology research, but also provide new references and new research ideas for
comparative medicine.

1. Introduction recommended content standard (Sigarini et al., 2017). Similarly, in

The heavy metal cadmium (Cd) is recognized by the World Health
Organization (WHO) as one of the top ten toxic chemicals that are the
most harmful to human health (Nations, 2009). Cd is not easily degraded
and has a long biological half-life, which can reach more than 10 years in
animals. In addition to increasing the lipid content, it also increases the
autophagy of hepatocytes and exacerbates the hyperlipidemia of the
hepatocytes overloaded with cholesterol (Rosales-Cruz et al., 2018;
Reyes-Hinojosa et al., 2019). Cadmium pollution mainly comes from
industrial waste gas, wastewater, and waste residues. A Jamaican study
reported the bioaccumulation of cadmium in potato tubers grown on
soils with high levels of cadmium (Sanderson et al., 2019). In China,
there are similar reports of soil cadmium pollution causing excessive
cadmium content in food crops (Feng et al., 2020). The research report
from Brazil also pointed out that the cadmium content in mineral feed
and cattle feed produced in Mato Grosso State is higher than the EU
Belgium, the environmental pollution has caused the eggs of private
owners to be contaminated by Cd (Waegeneers et al., 2009). Many
studies have shown that excessive cadmium accumulates in vital tissues
and organs of organisms by entering the food chain, and exhibits
destructive effects. Including reproductive toxicity, nephrontoxicity and
liver toxicity and other injuries (Kumar and Sharma, 2019; Zhang et al.,
2020; Wang et al., 2021b). Cd exposure can induce autophagy in duck
renal tubular epithelial cells(Zhang et al., 2021). Cd can also induce
oxidative stress and regulate the PI3K/AKT/HIF-1α signal transduction
pathway, causing mitochondrial dynamics disorder, leading to porcine
lymph node apoptosis (Yiming et al., 2021). Cd exposure can also acti­
vate the PI3K/AKT pathway by mediating the overexpression of iNOS,
and can also directly activate Caspase-3A to cause kidney and liver
apoptosis in chickens and fish, respectively (Gao et al., 2013; Bao et al.,
2017). Fibrosis is also a pathological damage caused by cadmium
exposure. Low-dose cadmium exposure induces peribronchial fibrosis in

* Corresponding author.
E-mail address: liuhonggui1312@163.com (H. Liu).

https://doi.org/10.1016/j.ecoenv.2021.113015
Received 6 September 2021; Received in revised form 2 November 2021; Accepted 17 November 2021
Available online 22 November 2021
0147-6513/© 2021 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
W. Cui et al.
mouse through site-specific phosphorylation of vimentin (Li et al.,
2017). Cadmium exposure can also stimulate mouse fibroblast differ­
entiation and lung fibrosis by activating SMAD2/3/4 signaling pathway
(Hu et al., 2017).
Fibrosis is a common pathological process. The morbidity and death
caused by the formation of fibrosis in tissues and organs account for 45%
of all deaths in the United States (Jeganathan et al., 2021). The forma­
tion of fibrosis is mainly affected by the deposition of extracellular
matrix (ECM), which is mainly regulated by the matrix metal­
loproteinase inhibitor TIMP and matrix metalloproteinase (MMPS)
(Robert et al., 2016). The occurrence and development of fibrosis are
often related to inflammation. Inflammatory cytokines such as TNF-α,
IL-1β and IL-6 have been reported to cause liver fibrosis and promote the
development of fibrosis (Robert et al., 2016). In addition, the classic
signaling pathway PI3K/AKT has also been reported to be able to
regulate lung epithelial-mesenchymal transition by inducing inflam­
mation, leading to pulmonary fibrosis in rats (Zhang et al., 2016b).
Macrophage polarization imbalance is also involved in the pathological
process of fibrosis, N-acetylcysteine can improve aortic fibrosis by pro­
moting the polarization of mouse M2 macrophages (Zhu et al., 2021).
Iron (Fe) can cause steatohepatitis and fibrosis in mice by changing the
polarization state of macrophages (Handa et al., 2019).
Colchicine-containing nanoparticles can also reduce acute myocardial
infarction injury by improving macrophage M1/M2 imbalance and
inhibiting inflammation (Wang et al., 2021a). There are also reports that
miRNAs are also closely related to fibrosis and macrophage polarization.
For example, miRNA-21 plays a role in idiopathic pulmonary fibrosis by
regulating ADAR1 and ADAR2 (Díaz-Piña et al., 2018); miR-200c/PAI-2
can induce the progression of triple-negative breast cancer by regulating
the M1/M2 polarization of macrophages (Meng et al., 2020); It can be
seen that fibrosis is often caused by the imbalance of M1/M2 polariza­
tion of macrophages, and miRNAs are often involved in the regulation of
this.
Subacute cadmium exposure can cause an imbalance of M1/M2
macrophages in pig lung tissue and adrenal tissue (Xu et al., 2021; Yao
et al., 2021). It can also cause inflammation and immunosuppressive
damage by regulating the expression of different miRNAs (Chen et al.,
2020). However, it is not clear whether subacute exposure to cadmium
causes fibrosis of pig liver tissue, and whether the imbalance of miRNA
and macrophages M1/M2 is involved in liver fibrosis. This experiment
uses Masson staining, immunofluorescence, real-time quantitative PCR
(qRT-PCR). Western Blot and other methods on the basis of replicating
the pig subacute cadmium exposure model, We detect the expression of
macrophage M1/M2 polarization surface markers, inflammation-related
cytokines, fibrosis-related indicators, and the expression level of
miRNA-21. This is to confirm that subacute cadmium exposure can
cause fibrosis in pig liver tissue, and to clarify the role of M1/M2 po­
larization imbalance in fibrosis. This result not only enriches the
research data of cadmium toxicology, but also provides a basis for
comparative medicine to explore the mechanism of cadmium exposure
on the body damage.
2. Materials and methods
2.1. Establishment of animal model
This experiment has been approved by the Animal Protection and
Utilization Committee of Northeast Agricultural University (SRM-06).
We selected 10 six-week-old pigs and randomly divided them into the
control group (C group) (n = 5) and the Cd exposure group (Cd group)
(n = 5). We added 20 mg/kg of CdCl2 to the daily diet of pig in the Cd
group for 40 days. The control group was fed with the regular diet and
the two groups were fed with free drinking water. During the entire
experiment, the temperature, the relative humidity and light time were
the same. After 40 days, we euthanized the two groups of experimental
pig. A proper amount of liver tissues was fixed in 10% formalin and
2
Ecotoxicology and Environmental Safety 228 (2021) 113015
embedded in paraffin for Masson staining experiment and immunoflu­
orescence experiment. And then we took an appropriate amount of liver
tissues and stored it at − 80 ◦ C for future use.
2.2. Masson staining
Take the liver tissue block fixed in 10% formalin, trim the tissue to a
size of 0.5 cm × 0.5 cm × 0.5 cm for paraffin embedding, then depar­
affinize the section and wash it with distilled water. The tissues were
stained with Hematoxylin dye (Beyotime, China) for 5–10 min, and then
washed thoroughly with distilled water. Use Masson Ponceau acid
redness solution for 5–10 min, and then soak for a while with 2% glacial
acetic acid (Beyotime, China) aqueous solution. The 1% phosphomo­
lybdic acid (Beyotime, China) aqueous solution is differentiated for 3–5
min. After drying, it was directly washed with aniline blue solution for 5
min. After incubating for 1 min in 0.2% glacial acetic acid, it is quickly
washed and dehydrated with 95% ethanol and absolute ethanol. Finally,
infiltrate with xylene, dry, and seal the slices with neutral glue. Observe
the section under a microscope (Leica, German). We use Image J (v1.48,
NIH) imaging software to analyze Masson’s results graph and quantify
the level of collagen expression in each high-power field.
2.3. Immunofluorescence experiment
First place the paraffin sections at room temperature for 60 min, then
place them in xylene I for 15 min, xylene II for 15 min, anhydrous
ethanol I for 5 min, anhydrous ethanol II for 5 min, 85% alcohol for 5
min, and 75% alcohol for 5 min. Wash with distilled water for dewaxing.
After that, we put the tissue section in a repair box filled with EDTA
antigen retrieval buffer (pH 8.0) and placed it in a microwave oven for
antigen retrieval. Start with a medium heat for 8 min to boiling, then
stop the fire for 8 min, and then switch to a medium-low heat for 7 min.
During this process, the buffer should be prevented from over-
evaporating to prevent the slices from drying out. After natural cool­
ing, the slides were placed in PBS (pH 7.4) and washed 3 times with
shaking on a shaker for 5 min each time. Then proceed to circle serum
sealing, after the section is dried slightly, draw circles around the tissue
with a histochemical pen (to prevent the antibody from flowing away),
after drying the PBS, add BSA (3%) dropwise, and block for 30 min.
Then add the primary antibody, gently shake off the blocking solution,
drop a certain ratio of PBS on the slice with the primary antibody, and
place the slice flat in a humidified box at 4 ◦ C and incubate overnight.
Add a small amount of water in the wet box to prevent the antibody from
evaporating. Then add the secondary antibody, place the slide in PBS
(pH 7.4) on a shaker and wash 3 times, 5 min each. After the sections
were dried slightly, the secondary antibody corresponding to the pri­
mary antibody was added dropwise to cover the tissue in the circle, and
incubated at room temperature in the dark for 50 min. Afterwards, DAPI
counterstain the nuclei, place the slides in PBS (pH 7.4) and wash them 3
times with shaking on a shaker, each time for 5 min. After the sections
were shaken dry a little, DAPI staining solution was added dropwise to
the circle, and incubated for 10 min at room temperature in the dark.
Afterwards, quench the tissue autofluorescence, place the slides in PBS
(pH 7.4) and wash them 3 times with shaking on a shaker, each time for
5 min. Add autofluorescence quencher to the circle for 5 min and rinse
with running water for 10 min. Afterwards, mount the slide, after the
section is spin-dried, the slide is mounted with an anti-fluorescence
quenching mount. Finally, perform microscopic examination and take
pictures, the slices are observed under a fluorescence microscope and
images are collected. (DAPI ultraviolet excitation wavelength 330–380
nm, emission wavelength 420 nm, emitting blue light; FITC excitation
wavelength 465–495 nm, emission wavelength 515–555 nm, emitting
green light; CY3 excitation wavelength 510–560 nm, emission wave­
length 590 nm, emitting red light).
W. Cui et al. Ecotoxicology and Environmental Safety 228 (2021) 113015

2.4. qRT-PCR analysis Table 2

Antibody information used in Western blot.
Trizol reagent (Invitrogen, Carlsbad, CA, USA) was used to isolate Antibody Dilution Reagent Company Molecular
total RNA from liver tissue (Li et al., 2021), and qRT-PCR method was name times weight
used to quantify the mRNA levels of target genes (Liu et al., 2021). The TGF-β 1:1000 Bioss, China 44KDa
microRNA first-strand cDNA synthesis kit (Beijing Tianjian Biotech­ SMAD7 1:500 Wanleibio, China 46KDa
nology Co. Ltd., Beijing) and the BioRT Master HiSensi cDNA first-strand PI3K 1:500 Wanleibio, China 85KDa
synthesis kit (Bioer Technology Co. Ltd., Hangzhou) were used for AKT 1:500 Wanleibio, China 60KDa
SMAD2/3 1:500 Wanleibio, China 52KDa
reverse transcription. qRT-PCR uses QuantStudio 3 (Thermo Fisher P-PI3K 1:1000 Cell Signaling Technology, 110KDa
Scientific, Vilnius, Lithuania) and BioRT real-time RT-PCR kit (Bioer U.S
Technology Co. Ltd.) or miRcute Plus miRNA qRT-PCR kit (Tiangen P-AKT 1:1000 Cell Signaling Technology, 60KDa
Biotech Co. Ltd.). The gene primers used in qRT-PCR were all from U.S
P-SMAD2/3 1:500 Wanleibio, China 60KDa
(Tsingke Biotech Co. Ltd.) (http://www.tsingke.net). As shown in
α-SMA 1:500 Wanleibio, China 43KDa
Table 1, β-actin or U6 is the internal reference. The relative mRNA level COL1 1:500 Wanleibio, China 130KDa
was calculated according to the 2-△△CT method. COL3 1:300 Wanleibio, China 110KDa
TIMP1 1:1000 Wanleibio, China 23KDa
MMP2 1:500 Wanleibio, China 72KDa
2.5. Determination of protein content MMP9 1:1000 Wanleibio, China 78KDa
β-actin 1:10000 Bioss, China 42KDa
According to the kit instructions, we use the BCA protein detection
kit (Solarbio, China) to detect the protein concentration.
(National Institutes of Health, Bethesda, MD) to quantify the band
density.
2.6. Western blot detection of protein levels
2.7. Statistical analysis
Our used RIPA extracts total protein from tissues and heats them to
denature. Then, the protein was detected by sds-polyacrylamide gel
Statistical analyses of all data were performed using GraphPad Prism
electrophoresis under 12% reducing conditions (Ding et al., 2021).
(version 8.0, GraphPad Software Inc., San Diego, CA, USA). The signif­
Then, use the tank transfer system to transfer the gel to the nitrocellulose
icant value (p < 0.05) was obtained by t-test. All data showed a normal
membrane in 200 mA Tris-glycine buffer at 4 ◦ C for 50–70 min. Then
distribution and passed the homogeneity of variance tests. Quantitative
seal the membrane with 5% skimmed milk at 37 ◦ C for 90 min. Then
data were shown as the mean ± SD.
immerse the nitrocellulose membrane in the target protein antibody
diluted with 5% BSA and incubate overnight. The dilution concentration
3. Results
of the target antibody is the recommended ratio in the instruction
manual. For their detailed information (target antibody source, protein
3.1. Cadmium exposure causes liver fibrosis in porcine
molecular weight and dilution ratio) As shown in Table 2; then wash 3
times with TBST, and then use the anti-rabbit IgG peroxidase combined
First, we used Masson staining to evaluate the effect of Cd exposure
with secondary antibody (1:10000, Immunoway Suzhou, China) was
on porcine liver fibrosis. Compared with the control group, a large
incubated for one and a half hours. We use β-actin as an internal refer­
amount of extracellular matrix was deposited in the Cd group, and there
ence for the analysis. We use X-ray film (TransGen Biotech Co., Beijing,
was obvious blue fibrosis in Fig. 1A. At the same time, we use Image J
China) to detect protein signals. We used Image J (v1.48, NIH) software
(v1.48, NIH) to quantitatively analyze the results of Masson staining. As
shown in Fig. 1B, the degree of liver fibrosis (CVF) in the Cd group was
Table 1 significantly higher than that in the control group (p < 0.05).
Gene-special primers used in the real-time quantitative PCR (qRT-PCR).
In order to further verify the deposition of extracellular matrix in Cd-
Gene Forward Primer (Five’-Three’) Reverse Primer (Five’-Three’) exposed pig liver tissue, we used qRT-PCR and western blot to detect
miRNA- CCGCGCGCGAGTTGTAGTCAGAC metalloproteinase inhibitor-1 (TIMP1), matrix metalloproteinase-2
21 (MMP2), matrix metalloproteinase-9 (MMP9), collagen I (COL1),
U6 CACGCAAATTCGTGAAGCGCCTTA collagen III (COL3) and α-smooth muscle actin (α-SMA) mRNA and
AATCCTGCGGCATCCACGAAAC CAGCACCGTGTTGGCGTAGAG
protein expression levels, as shown in Fig. 1C and D. Compared with the
β-actin
TGF-β CTGGAAAGCGGCAACCAAAT GCCCGAGAGAGCAATACAGG
SMAD7 CAGGCATTCCTCGGAAGTCA CACAGCATCTGGACAGTCAGT control group, the mRNA and protein expression levels of TIMP1, COL1
SMAD2 TCCGCCAGTTGTGAAGAGAC ACTGTGAAGATCAGGCCAGC and COL3 increased, the protein expression levels of α-SMA increased,
SMAD3 CTGGGCTGGAAGAAGGGTG CATCCAGGGACCTGGGGA especially the expression of COL1, TIMP1 increased significantly
PI3K ACTGGCAACCCAGAACTGATA CCGAGACACCACAGCTGAAT
(p < 0.05), while the expression of MMP2 decreased (p < 0.05), and the
AKT GCTGCACAAACGAGGCGAG ATGATGAAGGTGTTGGGCCG
IL-1β GCCAGTCTTCATTGTTCAGGTTT CCAAGGTCCAGGTTTTGGGT
level of MMP9 mRNA decreased significantly (p < 0.05), the protein
IL-6 CGGATGCTTCCAATCTGGGT CAGGTGCCCCAGCTACATTA expression level is not significantly reduced. The above results indicate
IL-4 CTCCCAACTGATCCCAACCC TGCACGAGTTCTTTCTCGCT that Cd exposure can cause liver fibrosis in pigs. At the same time, this
IL-13 CTCCTCACTCCTCCTGTGCT TTGCATAGGGGTGTCTTCTGG also shows that we have successfully established a pig liver fibrosis
IL-12 GCCAGGATGGTGCTGAGATA GGGCATAGGCATGACTCGAA
model caused by cadmium exposure.
IL-10 CCACAAGTCCGACTCAACGA TCTCAGGGGAGAGGTACAGC
IL-23 CCTGGACTGCACATCTACCAA ATCCTTTGCAAGCAGGACTGA
TNF-α GCCCTTCCACCAACGTTTTC CAAGGGCTCTTGATGGCAGA 3.2. Cadmium exposure causes M1/M2 imbalance in porcine liver
COL1 GTCCCCTGCTGCCTTTACAT GTGGCCGTGGAACTGTAAGA
COL3 TCTACGACGCTGTAGGTCCA TCTACGACGCTGTAGGTCCA
Macrophage homeostasis plays an important role in the occurrence
MMP2 CTCCTTCAACGGCAAGGAGT AGCTGTTGTAGGATGTGCCC
MMP9 ACTTCGGAAACGCAAAAGGC AAGAGTCTCTCGCGCTAGGGCA of tissue fibrosis. In order to evaluate the role of M1/M2 balance in liver
NF-κB GGCACCGGATTGAGGAGAAA GCCTCTGTCAGTGTCCCTTC fibrosis caused by Cd exposure, we used immunofluorescence to detect
NOS2 TTGAATCTGGGTGAAAAGAGCCC TTGTCCCTGGGTCCTATGGT the M1 surface marker CD16 (Red) and M2 surface marker CD163
Arg1 CACCTGACTGTGTCTTCCGT GACCTCCATGGACTGGTGTG (Green). As shown in Fig. 2A, we found that in different fields of view,
TIMP1 GCGGATACTTCCACAGGTCC GCAGGGAAACACTGTGCATT
compared with the C group, the M1 macrophage surface marker CD16

3
W. Cui et al. Ecotoxicology and Environmental Safety 228 (2021) 113015

Fig. 1. Cadmium exposure affects liver fibrosis in pig. A. Use Masson staining method (10 × or 40 ×) to detect liver fibrosis in the control group and Cd group. B.
Using Image J (v1.48, NIH) to scan the collagen volume fraction (CVF) at 40x the field of view. C, D. The effect of Cd exposure on the mRNA and protein expression of
fibrosis-related cytokines. T-tests were conducted, and results were represented in the formant of mean ± standard deviation (M ± SD), n = 3. The bar represents the
mean ± SD of three replicates, * is significantly different from the corresponding control group (p < 0.05); ** is significantly different from the corresponding control
group (p < 0.005); *** is significantly different from the corresponding control group (p < 0.001); **** is significantly different from the corresponding control
group (p < 0.0001).

Fig. 2. Effect of Cd exposure on the polarization of macrophages. A. Use immunofluorescence staining (10 × or 40 ×) to detect the M1 (Red) and M2 (Green)
polarization of the macrophages in the liver of the control group and the Cd group. B. The mRNA expression levels of the M1 macrophage surface markers IL-1β, IL-6,
IL-12, iNOS in the control group and the Cd group. C. The mRNA expression levels of the M2 macrophage surface markers IL-4, IL-10, IL-13, and Arg1 in the control
group and the Cd group. T-tests were conducted, and results were represented in the formant of mean ± standard deviation (M ± SD), n = 3.

4
W. Cui et al.
(Red) in the liver tissue of the Cd group were significantly increased
(p < 0.05), and the surface marker CD163 (Green) of M2 macrophages
were significantly decreased (p < 0.05). The results show that Cd
exposure cause the M1/M2 imbalance, and the macrophages transform
to M1 type.
In order to more accurately understand the imbalance of M1/M2
macrophage, we used qRT-PCR method to analyze the M1 macrophage
surface markers (IL-1, IL-6, IL-12, iNOS) and M2 macrophage surface
markers (IL-4, IL-10, IL-13, Arg1) were further detected. The results
showed that, as shown in Fig. 2B and C, the mRNA expression levels of
IL-1, IL-6, IL-12, and iNOS were significantly increased (p < 0.05), while
the mRNA levels of IL-4, IL-10 (p < 0.0001), IL-13 and Arg1 (p < 0.001)
were significantly reduced. This result also further indicates that the
subacute Cd exposure-induced porcine liver fibrosis is caused by the
imbalance of M1/M2.
3.3. Cadmium exposure regulates the low expression of TGF-β and
SMAD7 through miRNA-21 targeting
In view of the important role of miRNA-21 in fibrotic tissues, we
tested the expression level of miRNA-21 in the liver tissues of Cd-
exposed pig. The results showed that, compared with the C group, the
expression level of miRNA-21 was significantly increased in Cd group
(p < 0.05). We predicted the targeted regulatory genes of miRNA-21 in
the different species. The results showed that TGF-β and SMAD7 were in
different species as shown in Fig. 3A and B. The nucleotide sequence was
highly conserved, and there was a common binding site for miRNA-21. It
is preliminarily speculated that miRNA-21 can regulate the expression of
TGF-β and SMAD7 in pig liver. We used qRT-PCR and Western Blot
methods to verify this. As shown in Fig. 3C and D, the results were as
predicted. Compared with the C group, the mRNA and protein expres­
sion levels of TGF-β and SMAD7 in the Cd group decreased (p < 0.05).
The expression levels of TGF-β and SMAD7 were negatively correlated
with the expression of miRNA-21. The above results indicate that Cd
exposure regulates TGF-β and SMAD7 through miRNA-21 targeting.
Fig. 3. TGF-β and SMAD7 are the targeted binding sites of miRNA-21. A.C. The predicted binding site between miR-21 and TGF-β, SMAD7. B. The mRNA expression
levels of TGF-β and SMAD7 in the liver tissues of the control group and the Cd group. D. The protein expression levels of TGF-β and SMAD7 in the liver tissues of the
control group and the Cd group. T-tests were conducted, and results were represented in the formant of mean ± standard deviation (M ± SD), n = 3.
5
Ecotoxicology and Environmental Safety 228 (2021) 113015
3.4. PI3K/AKT and SMAD7 pathways mediate the imbalance of M1/M2
macrophages
Studies have found that PI3K/AKT and SMAD2/3 can induce M1/M2
imbalance. In order to further clarify the relationship among TGF-β,
SMAD7 and M1/M2 imbalance, we detected the expression levels of
PI3K/AKT and SMAD2/3 by qRT-PCR and western blot methods. The
results showed that, as shown in Fig. 4A and B, the mRNA and protein
expression levels of PI3K and AKT were significantly increased
(p < 0.001), consistent with our predicted results. The mRNA and pro­
tein expression levels of SMAD2/3 also were increased (p < 0.001).
Moreover, we also tested p-PI3K/p-AKT and p-SMAD2/3 protein
expression levels as shown in Fig. 4C and D. The results showed that the
p-PI3K/p-AKT in the liver tissue of pig in the Cd group were increased
(p < 0.001). The total protein level of SMAD2/3 increased, but the
protein expression level of p-SMAD2/3 decreased significantly
(p < 0.005). Therefore, TGF-β and SMAD7 induce M1/M2 imbalance
through PI3K/AKT and SMAD2/3, respectively.
3.5. Cadmium exposure induces the deposition of extracellular matrix by
promoting the secretion of inflammatory cytokines
In order to evaluate the effect of Cd exposure on the levels of in­
flammatory cytokines in pig liver, we tested the levels of TNF-α, IL-1β,
IL-6 and IL-12 in Fig. 4D. Compared with the C group, the mRNA
expression levels of pro-inflammatory substances IL-1β (p < 0.05) and
TNF-α (p < 0.01) increased. This result shows that our speculation is
correct. The deposition of extracellular matrix (ECM) in the liver tissues
of pigs exposed to Cd caused by the imbalance of metalloproteinase
inhibitor TIMP1 and metalloproteinases MMP2 and MMP9, that is, the
increased expression of COL1, COL3 and α-SMA is due to pro-
inflammatory substances IL-1β, IL-6, IL-12 and TNF-α stimulate liver
cells. Therefore, the above results indicate that the M1 macrophage
polarization stimulates the deposition of ECM by IL-1β and TNF-α, which
leads to fibrosis in the liver tissue of pig exposed to Cd.
W. Cui et al.
Fig. 4. The expression of TGF-β and SMAD7 downstream pathways. A. The mRNA levels of PI3K, AKT, SMAD2, SMAD3 in the control group and the Cd group. B. The
protein expression levels of PI3K, AKT and SMAD2/3 in the control group and the Cd group. C. The protein expression levels of p-PI3K, p-AKT, and p-SMAD2/3 in the
C group and the Cd group. D. The mRNA expression levels of TNF-α, IL-1β, IL-6 and IL-12 in the control group and the Cd group. T-tests were conducted, and results
were represented in the formant of mean ± standard deviation (M ± SD), n = 3.
4. Discussion
Studies have shown that exposure to Cd can cause an imbalance in
mouse M1/M2 macrophages and increase the secretion of inflammatory
cytokines (Låg et al., 2010), M1/M2 polarization can synergistically
promote the occurrence and development of renal fibrosis in rats
(Nakagawa et al., 2021). Among them, M1 type macrophages are in­
flammatory cells, which mostly appear in the early stage of fibrosis. M2
macrophages are anti-inflammatory cells, mainly appearing in the
middle and late stages of fibrosis (Jiang et al., 2017; Cai et al., 2019).
The study evaluated the effects of subacute CdCl2 exposure on pig liver,
and the role of M1/M2 and miRNA-21 in fibrotic liver. The results
showed that subacute cadmium exposure can cause liver fibrosis in pigs.
The expression of miRNA-21 increased, and the expression of TGF-β and
SMAD7 decreased. At the same time, it causes an imbalance of M1/M2,
leading to increased levels of pro-inflammatory cytokines (TNF-α, IL-1β,
IL-6, IL-12), which are closely related to the degree of inflammation. The
imbalance of TIMP1, MMP2 and MMP9 expression leads to EMC depo­
sition in the liver tissues of cadmium-exposed pigs, and the expression of
α-SMA, COL1 and COL3 increase.
MiRNA-21 plays an important role in tissue fibrosis (Tong et al.,
2015). MiRNA-21 can target PTEN to cause lung fibrosis in mice (Liu
et al., 2019). It may also affect liver fibrosis in Indonesian BA patients
(Makhmudi et al., 2019). Studies have found that Cd load can increase
the expression of miRNA-21 in cancerous tissues and adjacent
non-cancerous tissues of Egyptian bladder cancer patients. At the same
time, miRNA-21 is also highly expressed in the occurrence and devel­
opment of liver cirrhosis and cancer (Deng and Hui, 2014; Zhou et al.,
2018). And there are many reports showing that there are also studies
that have found that miRNA-21 can target the expression of TGF-β and
SMAD7 in pigs (Bai et al., 2015; Hua et al., 2016). We predicted through
the Targetscan (http://www.targetscan.org/vert_71/) website that
TGF-β and SMAD7 have the same miRNA-21 binding site in pigs,
humans, mice and other species. The results of this experiment also
6
Ecotoxicology and Environmental Safety 228 (2021) 113015
found that cadmium exposure can cause a significant increase in the
expression of miRNA-21 in pig liver tissues, and a significant decrease in
the expression levels of TGF-β and SMAD7. The above results indicate
that cadmium exposure can regulate the expression of TGF-β and
SMAD7 through miRNA-21 dual targeting. Studies have shown that
TGF-β and SMAD7 can induce polarization of M1 macrophages and
SMAD2/3 can induce M2 macrophages through the classical inflam­
matory PI3K/AKT signaling pathway, respectively (Hu et al., 2012;
Zhang et al., 2016a). Phosphorylation of PI3K/AKT signaling pathway
and activation of SMAD2/3 phosphorylation play a role in inducing the
polarization of M1 and M2 macrophages. After qRT-PCR and Western
Blot detection, the detection results are consistent with our speculation,
the expression level of p-PI3K and p-AKT protein increased significantly,
while the expression level of p-SMAD2/3 protein decreased signifi­
cantly. The above results indicate that miRNA-21 regulates p-PI3K/­
p-AKT and p-SMD2/3 by targeting TGF-β and SMAD7, and increases the
expression of M1 macrophages. M1 type macrophages can secrete
pro-inflammatory cytokines TNF-α, IL-1β and IL-6, and increase the
expression of TIMP1 (Tiboc Schnell et al., 2021). Selenium deficiency
also releases TNF-α, IL-1β, IL-6 and aggravates heat stress pneumonia in
chickens by disrupting the balance of M1/M2 (Yin et al., 2021). TNF-α,
IL-1β, IL-6 and IL-12 also increased the expression of TIMP1 and α-SMA
in liver fibrosis caused by high-fat diet and aging in mice (Zhang et al.,
2019). And TNF-α, IL-1β and IL-6 also promote the process of chronic
hepatitis and liver fibrosis (Tan et al., 2016). Our study also confirmed
that Cd exposure caused the M1 polarization of macrophages to in­
crease, and the mRNA expression levels of IL-1β, TNF-α, IL-6 and IL-12
increased significantly. TNF-α, IL-1β, IL-6 and IL-12 can increase
TIMP1, decrease MMP2 and MMP9, promote ECM deposition, that is,
increase the expression of α-SMA, COL1 and COL3 (Phillips et al., 2003).
Based on this, we detected the mRNA and protein levels of TIMP1,
MMP2, MMP9, α-SMA, COL1 and COL3 in Cd-exposed porcine liver
fibrosis tissues. The results showed that our results were in line with
expectations. In pig liver fibrotic tissues exposed to cadmium, TIMP1
W. Cui et al.
mRNA and protein expression levels increased significantly, MMP2 and
MMP9 mRNA and protein expression levels decreased, and α-SMA,
COL1 and COL3 mRNA and protein expression levels reduce. This in­
dicates that the fibrosis of pig liver tissue caused by subacute cadmium
exposure may be caused by TNF-α, IL-1β, IL-6, and IL-12 among the
inflammatory cytokines secreted by M1 type macrophages, and these
Inflammatory cytokines Sex cytokines cause ECM deposition in the liver
tissue of cadmium-exposed pigs and lead to liver fibrosis.
In summary, acute cadmium exposure can increase the expression of
miRNA-21 in pig liver tissue, and target to decrease the expression of TGF-β
and SMAD7, Mediate p-PI3K/p-AKT and p-SMAD2/3 signaling pathways
to cause the increase of M1 type macrophages. This causes an increase in
the secretion of TNF-α, IL-1β, IL-6 and IL-12, which in turn induces an
increase in the expression of TIMP1, a decrease in the expression of MMP2
and MMP9, and an increase in the expression of α-SMA, COL1 and COL3,
leading to pig liver fibrosis. The above results indicate that subacute cad­
mium exposure promotes the polarization of M1 macrophages through
miRNA-21 dual-targeting TGF-β and SMAD7, causing porcine liver fibrosis.
This result not only enriches the toxicology of Cd, but also provides more
references for comparative medicine.
CRediT authorship contribution statement
Wei Cui: Investigation, Formal analysis, Writing − original draft.
Sitong Zhou: Visualization. Yulin Wang: Software, Investigation. Xu
Shi: Software, Investigation. Liu Honggui: Conceptualization, Re­
sources, Supervision, Validation, Writing − review & editing.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgments
This research did not receive any specific grant from funding
agencies in the public, commercial, or not-for-profit sectors. The authors
extend their sincere thanks to the members of the veterinary internal
medicine laboratory and key Laboratory for Laboratory Animals at the
College of Veterinary Medicine, Northeast Agricultural University.
References
Bai, L., Liang, R., Yang, Y., Hou, X., Wang, Z., Zhu, S., Wang, C., Tang, Z., Li, K., 2015.
MicroRNA-21 regulates PI3K/Akt/mTOR signaling by targeting TGFβI during
skeletal muscle development in pigs. PloS One 10, e0119396.
Bao, R., Zheng, S., Wang, X., 2017. Selenium protects against cadmium-induced kidney
apoptosis in chickens by activating the PI3K/AKT/Bcl-2 signaling pathway. Environ.
Sci. Pollut. Res. Int. 24, 20342–20353.
Cai, S., Nie, L., Chen, J., 2019. C-reactive protein/serum amyloid P promotes pro-
inflammatory function and induces M1-type polarization of monocytes/
macrophages in mudskipper, Boleophthalmus pectinirostris. Fish. Shellfish
Immunol. 94, 318–326.
Chen, J., Zhang, S., Tong, J., Teng, X., Zhang, Z., Li, S., Teng, X., 2020. Whole
transcriptome-based miRNA-mRNA network analysis revealed the mechanism of
inflammation-immunosuppressive damage caused by cadmium in common carp
spleens. The. Sci. Total Environ. 717, 137081.
Deng, Y.Z., Hui, X.U., 2014. Abnormal expression of MiRNA-21 in cirrhosis and its
significance. China J. Mod. Med.
Díaz-Piña, G., Ordoñez-Razo, R., Montes, E., Páramo, I., Becerril, C., Salgado, A.,
Santibañez-Salgado, J., Maldonado, M., Ruiz, V., 2018. The Role of ADAR1 and
ADAR2 in the Regulation of miRNA-21 in Idiopathic Pulmonary Fibrosis. Lung 196,
393–400.
Ding, C., Shi, X., Guan, Y.L., Li, X.J., 2021. Deoxynivalenol induces carp neutrophil
apoptosis and necroptosis via CYP450s/ROS/PI3K/AKT pathway*. Aquaculture 545.
Feng, L., Yan, H., Dai, C., Xu, W., Gu, F., Zhang, F., Li, T., Xian, J., He, X., Yu, Y., et al.,
2020. The systematic exploration of cadmium-accumulation characteristics of maize
kernel in acidic soil with different pollution levels in China. Sci. Total Environ. 729,
138972.
7
Ecotoxicology and Environmental Safety 228 (2021) 113015
Gao, D., Xu, Z., Qiao, P., Liu, S., Zhang, L., He, P., Zhang, X., Wang, Y., Min, W., 2013.
Cadmium induces liver cell apoptosis through caspase-3A activation in purse red
common carp (Cyprinus carpio). PloS One 8, e83423.
Handa, P., Thomas, S., Morgan-Stevenson, V., Maliken, B., Gochanour, E., Boukhar, S.,
Yeh, M., Kowdley, K., 2019. Iron alters macrophage polarization status and leads to
steatohepatitis and fibrogenesis. J. Leukoc. Biol. 105, 1015–1026.
Hu, W., Jiang, Z., Zhang, Y., Liu, Q., Fan, J., Luo, N., Dong, X., Yu, X., 2012.
Characterization of infiltrating macrophages in high glucose-induced peritoneal
fibrosis in rats. Mol. Med. Rep. 6, 93–99.
Hu, X., Fernandes, J., Jones, D., Go, Y., 2017. Cadmium stimulates myofibroblast
differentiation and mouse lung fibrosis. Toxicology 383, 50–56.
Hua, C., Wang, Z., Zhang, J., Peng, X., Hou, X., Yang, Y., Li, K., Tang, Z., 2016. SMAD7,
an antagonist of TGF-beta signaling, is a candidate of prenatal skeletal muscle
development and weaning weight in pigs. Mol. Biol. Rep. 43, 241–251.
Jeganathan, N., Smith, R., Sathananthan, M., 2021. Mortality trends of idiopathic
pulmonary fibrosis in the United States from 2004 through 2017. Chest 159,
228–238.
Jiang, K., Weaver, J., Li, Y., Chen, X., Liang, J., Stabler, C., 2017. Local release of
dexamethasone from macroporous scaffolds accelerates islet transplant engraftment
by promotion of anti-inflammatory M2 macrophages. Biomaterials 114, 71–81.
Kumar, S., Sharma, A., 2019. Cadmium toxicity: effects on human reproduction and
fertility. Rev. Environ. Health 34, 327–338.
Låg, M., Rodionov, D., Ovrevik, J., Bakke, O., Schwarze, P., Refsnes, M., 2010. Cadmium-
induced inflammatory responses in cells relevant for lung toxicity: Expression and
release of cytokines in fibroblasts, epithelial cells and macrophages. Toxicol. Lett.
193, 252–260.
Li, F., Surolia, R., Li, H., Wang, Z., Liu, G., Liu, R., Mirov, S., Athar, M., Thannickal, V.,
Antony, V., 2017. Low-dose cadmium exposure induces peribronchiolar fibrosis
through site-specific phosphorylation of vimentin. Am. J. Physiol. Lung Cell. Mol.
Physiol. 313, L80–L91.
Li, X., Zhao, X., Yao, Y., Guo, M., Li, S., 2021. New insights into crosstalk between
apoptosis and necroptosis co-induced by chlorothalonil and imidacloprid in
Ctenopharyngodon idellus kidney cells. Sci. Total Environ. 780, 146591.
Liu, J., Dong, C., Zhai, Z., Tang, L., Wang, L., 2021. Glyphosate-induced lipid metabolism
disorder contributes to hepatotoxicity in juvenile common carp. Environ. Pollut.
(Barking, Essex: 1987) 269, 116186.
Liu, Z., Liang, X., Li, X., Liu, X., Zhu, M., Gu, Y., Zhou, P., 2019. MiRNA-21 functions in
ionizing radiation-induced epithelium-to-mesenchymal transition (EMT) by
downregulating PTEN. Toxicol. Res. 8, 328–340.
Makhmudi, A., Kalim, A., Gunadi, 2019. microRNA-21 expressions impact on liver
fibrosis in biliary atresia patients. BMC Res. Notes 12, 189.
Meng, Z., Zhang, R., Wang, Y., Zhu, G., Jin, T., Li, C., Zhang, S., 2020. miR-200c/PAI-2
promotes the progression of triple negative breast cancer via M1/M2 polarization
induction of macrophage. Int. Immunopharmacol. 81, 106028.
Nakagawa, M., Karim, M., Izawa, T., Kuwamura, M., Yamate, J., 2021.
Immunophenotypical Characterization of M1/M2 Macrophages and Lymphocytes in
Cisplatin-Induced Rat Progressive Renal Fibrosis. Cells 10.
Nations, F., 2009. Enhancing Participation in Codex Activities. World Health
Organization, Geneva.
Phillips, P., McCarroll, J., Park, S., Wu, M., Pirola, R., Korsten, M., Wilson, J., Apte, M.,
2003. Rat pancreatic stellate cells secrete matrix metalloproteinases: implications for
extracellular matrix turnover. Gut 52, 275–282.
Reyes-Hinojosa, D., Lozada-Pérez, C., Zamudio Cuevas, Y., López-Reyes, A., Martínez-
Nava, G., Fernández-Torres, J., Olivos-Meza, A., Landa-Solis, C., Gutiérrez-Ruiz, M.,
Rojas Del Castillo, E., et al., 2019. Toxicity of cadmium in musculoskeletal diseases.
Environ. Toxicol. Pharmacol. 72, 103219.
Robert, S., Gicquel, T., Victoni, T., Valença, S., Barreto, E., Bailly-Maître, B., Boichot, E.,
Lagente, V., 2016. Involvement of matrix metalloproteinases (MMPs) and
inflammasome pathway in molecular mechanisms of fibrosis. Biosci. Rep. 36.
Rosales-Cruz, P., Domínguez-Pérez, M., Reyes-Zárate, E., Bello-Monroy, O., Enríquez-
Cortina, C., Miranda-Labra, R., Bucio, L., Gómez-Quiroz, L., Rojas-Del Castillo, E.,
Gutiérrez-Ruíz, M., et al., 2018. Cadmium exposure exacerbates hyperlipidemia in
cholesterol-overloaded hepatocytes via autophagy dysregulation. Toxicology.
https://doi.org/10.1016/j.tox.2018.02.007:41-51.
Sanderson, D., Voutchkov, M., Benkeblia, N., 2019. Bioaccumulation of cadmium in
potato tuber grown on naturally high levels cadmium soils in Jamaica. Sci. Total
Environ. 649, 909–915.
Sigarini, K., de Oliveira, A., Martins, D., Brasil, A., de Oliveira, K., Villa, R., 2017.
Determination of the Lead, Cadmium, and Chromium Concentration in Mineral
Feeds and Supplements for Cattle Produced in the Mato Grosso State, Brazil. Biol.
Trace Elem. Res. 177, 209–214.
Tan, H., He, Q., Li, R., Lei, F., Lei, X., 2016. Trillin reduces liver chronic inflammation
and fibrosis in carbon tetrachloride (CCl4) induced liver injury in mice. Immunol.
Investig. 45, 371–382.
Tiboc Schnell, C., Filip, G., Decea, N., Moldovan, R., Opris, R., Man, S., Moldovan, B.,
David, L., Tabaran, F., Olteanu, D., et al., 2021. The impact of Sambucus nigra L.
extract on inflammation, oxidative stress and tissue remodeling in a rat model of
lipopolysaccharide-induced subacute rhinosinusitis. Inflammopharmacology 29,
753–769.
Tong, B., Xiao, M., Zeng, J., Xiong, W., 2015. MiRNA-21 promotes fibrosis in orbital
fibroblasts from thyroid-associated ophthalmopathy. Mol. Vis. 21, 324–334.
Waegeneers, N., Hoenig, M., Goeyens, L., De Temmerman, L., 2009. Trace elements in
home-produced eggs in Belgium: levels and spatiotemporal distribution. The. Sci.
Total Environ. 407, 4397–4402.
Wang, L., Peng, Y., Song, L., Xia, D., Li, C., Li, Z., Li, Q., Yu, A., Lu, C., Wang, Y., 2021a.
Colchicine-containing nanoparticles attenuates acute myocardial infarction injury by
W. Cui et al.
inhibiting inflammation. Cardiovasc. Drugs Ther. https://doi.org/10.1007/s10557-
021-07239-2.
Wang, X., Bin, W., Zhou, M., Xiao, L., Xu, T., Yang, S., Nie, X., Xie, L., Yu, L., Mu, G.,
et al., 2021b. Systemic inflammation mediates the association of heavy metal
exposures with liver injury: A study in general Chinese urban adults. J. Hazard.
Mater. 419, 126497.
Xu, S., Xiaojing, L., Xinyue, S., Wei, C., Honggui, L., Shiwen, X., 2021. Pig lung fibrosis is
active in the subacute CdCl exposure model and exerts cumulative toxicity through
the M1/M2 imbalance. Ecotoxicol. Environ. Saf. 225, 112757.
Yao, Y., Zhao, X., Zheng, S., Wang, S., Liu, H., Xu, S., 2021. Subacute cadmium exposure
promotes M1 macrophage polarization through oxidative stress-evoked
inflammatory response and induces porcine adrenal fibrosis. Toxicology, 152899.
https://doi.org/10.1016/j.tox.2021.152899:.
Yiming, L., Yanfei, H., Hang, Y., Yimei, C., Guangliang, S., Shu, L., 2021. Cadmium
induces apoptosis of pig lymph nodes by regulating the PI3K/AKT/HIF-1α pathway.
Toxicology 451, 152694.
Yin, Y., Guo, J., Liu, Z., Xu, S., Zheng, S., 2021. Selenium deficiency aggravates heat
stress pneumonia in chickens by disrupting the M1/M2 balance. Biol. Trace Elem.
Res. https://doi.org/10.1007/s12011-021-02905-w.
Zhang, C., Hu, Z., Hu, R., Pi, S., Wei, Z., Wang, C., Yang, F., Xing, C., Nie, G., Hu, G.,
2021. New insights into crosstalk between pyroptosis and autophagy co-induced by
molybdenum and cadmium in duck renal tubular epithelial cells. J. Hazard. Mater.
416, 126138.
Ecotoxicology and Environmental Safety 228 (2021) 113015
Zhang, F., Wang, H., Wang, X., Jiang, G., Liu, H., Zhang, G., Wang, H., Fang, R., Bu, X.,
Cai, S., et al., 2016a. TGF-β induces M2-like macrophage polarization via SNAIL-
mediated suppression of a pro-inflammatory phenotype. Oncotarget 7,
52294–52306.
Zhang, F., Zhou, Y., Yang, X., Xiong, A., Wang, Z., Yang, L., 2019. Gynura Rhizoma
containing pyrrolizidine alkaloids induces the hepatic sinusoidal obstruction
syndrome in mice via upregulating fibrosis-related factors. Acta Pharmacol. Sin. 40,
781–789.
Zhang, X., Xing, R., Chen, L., Liu, C., Miao, Z., 2016b. PI3K/Akt signaling is involved in
the pathogenesis of bleomycin‑induced pulmonary fibrosis via regulation of
epithelial‑mesenchymal transition. Mol. Med. Rep. 14, 5699–5706.
Zhang, Y., Liu, Q., Yin, H., Li, S., 2020. Cadmium exposure induces pyroptosis of
lymphocytes in carp pronephros and spleens by activating NLRP3. Ecotoxicol.
Environ. Saf. 202, 110903.
Zhou, Y., Ren, H., Dai, B., Li, J., Shang, L., Huang, J., Shi, X., 2018. Hepatocellular
carcinoma-derived exosomal miRNA-21 contributes to tumor progression by
converting hepatocyte stellate cells to cancer-associated fibroblasts. J. Exp. Clin.
Cancer Res.: CR 37, 324.
Zhu, Q., Tai, S., Tang, L., Xiao, Y., Tang, J., Chen, Y., Shen, L., He, J., Ouyang, M.,
Zhou, S., 2021. N-acetyl cysteine ameliorates aortic fibrosis by promoting M2
macrophage polarization in aging mice. Redox Rep.: Commun. Free Radic. Res. 26,
170–175.