Microbial Pathogenesis 121 (2018) 283–292

Contents lists available at ScienceDirect

Microbial Pathogenesis
journal homepage: www.elsevier.com/locate/micpath

Genetic modifications of cytokine genes and Toxoplasma gondii infections in T

pregnant women
Wioletta Wujcickaa,b,∗, Jan Wilczyńskic, Ewa Śpiewakd, Dorota Nowakowskae
a
Scientific Laboratory of the Center of Medical Laboratory Diagnostics and Screening, Polish Mother's Memorial Hospital - Research Institute, Lodz, Poland
b
Department of Obstetrics, Perinatology and Gynecology, Polish Mother's Memorial Hospital - Research Institute, Lodz, Poland
c
2nd Chair of Obstetrics and Gynecology, Duchess Anna Mazowiecka Public Teaching Hospital, Warsaw, Poland
d
Laboratory of Microbiology with Parasitology of the Center of Medical Laboratory Diagnostics and Screening, Polish Mother's Memorial Hospital - Research Institute,
Lodz, Poland
e
Department of Foeto-Maternal Medicine and Obstetrics, University of Warmia and Mazury in Olsztyn, Municipal Polyclinical Hospital in Olsztyn, Poland

A R T I C LE I N FO A B S T R A C T

Keywords: Purpose: Toxoplasma gondii causes one of the most common intrauterine infections worldwide, thus being a
Toxoplasma gondii severe threat during pregnancy. IL1, IL6, IL10, IL12, and TNF-α cytokines were reported to be involved in
Interleukins immune responses to infections with T. gondii. The research was aimed to reveal relationships between genetic
Cytokines changes within the polymorphisms of these cytokine genes and the incidence of T. gondii infection among
Single nucleotide polymorphisms (SNPs)
pregnant women, as well as congenital transmission of the parasite to the foetuses of their infected mothers.
Toxoplasmosis
Pregnant women
Methods: The primary study was performed in 148 Polish pregnant women, including 74 T. gondii-infected
Genetic susceptibility patients and 74 age-matched uninfected individuals; and further analysis – among the additional 142 pregnant
women. Genotypes within IL1A −889 C > T, IL1B +3954 C > T, IL6 -174 G > C, IL10 -1082 G > A, IL12B
−1188 A > C and TNFA -308 G > A single nucleotide polymorphisms (SNPs) were determined, using self-de-
signed nested PCR-RFLP assays. Randomly selected PCR products, representing distinct genotypes in the ana-
lyzed polymorphisms, were confirmed by sequencing, using the Sanger method. A statistical analysis was carried
out of relationships between genetic alterations within studied SNPs and the occurrence of T. gondii infection,
using the following tools: cross-tabulation, Pearson's Chi-square test and the logistic regression model to estimate
genetic models of inheritance. A power analysis of statistically significant outcomes was performed by Cramér's
V test.
Results: A multiple-SNP analysis showed TC haplotype for IL1A and IL1B SNPs to be significantly associated with
a decreased risk of the parasitic infection (OR 0.41, P≤0.050). The association remained important after power
analysis (Cramér's V = 0.39, χ2 = 7.73, P≤0.050), and the additional analysis with larger groups of patients
(OR 0.47, P≤0.050). Moreover, the CCCAGA complex variants were for all the studied polymorphisms at an
increased risk of T. gondii infection (OR 8.14, P≤0.050), although this strong relationship was not significant in
the further analysis (Cramér's V = 0.76, χ2 = 26.81, P = 0.310). Regarding the susceptibility to congenital
transmission of T. gondii from mothers to their foetuses among the infected pregnant women, the presence of GA
heterozygotic status within IL10 polymorphism significantly increased the risk of parasitic transmission (OR 5.73
in the codominant model and OR 5.18 in the overdominant model; P≤0.050). The correlation stayed important
in the power analysis (Cramér's V = 0.29, χ2 = 6.03, P≤0.050), although it was non-significant in larger groups
of patients. Important relationships specific for the first study cohort remained non-significant in the second
group of studied pregnant women.
Conclusions: Within the analyzed cohort of Polish pregnant women, the genetic modifications from SNPs of
genes, encoding both the proinflammatory IL1α, IL1β, IL6, IL12 and TNF-α, and anti-inflammatory IL10 cyto-
kines, may have been associated with susceptibility to T. gondii infection. It is the first study on the contribution
of cytokine genes polymorphisms to the occurrence of T. gondii infection during pregnancy. Further studies for

∗
Corresponding author. Scientific Laboratory of the Center of Medical Laboratory Diagnostics and Screening, Department of Obstetrics, Perinatology and Gynecology; Polish Mother's
Memorial Hospital - Research Institute, 281/289 Rzgowska Street, Lodz 93-338 Poland.
E-mail addresses: wwujcicka@yahoo.com (W. Wujcicka), janszczesnywilczynski@gmail.com (J. Wilczyński), espie@poczta.onet.pl (E. Śpiewak),
dnowakowska@yahoo.com (D. Nowakowska).

https://doi.org/10.1016/j.micpath.2018.05.048
Received 26 April 2017; Received in revised form 17 May 2018; Accepted 28 May 2018
Available online 31 May 2018
0882-4010/ © 2018 Elsevier Ltd. All rights reserved.
W. Wujcicka et al.
other populations of pregnant women would be justified to reveal a detailed role of the analyzed polymorphisms
for the occurrence of T. gondii infections during pregnancy.
1. Introduction
Toxoplasma gondii obligate protozoan parasite causes one of the
most common intrauterine infections worldwide, thus being a severe
threat during pregnancy [1–4]. Seroprevalence rates of T. gondii have
been reported from 4% to 100% in pregnant women worldwide, pre-
senting intra- and international variations, depending on both region
and ethnicity [5,6]. In Polish women at childbearing age, the pre-
valence rate of approximately 41% was shown to be still high as
compared to other European populations, with values of 9% in the UK,
12% in Eastern Spain, 21% in Italy, and 24% in the North of Portugal
[4,6–9]. Primary infections of pregnant women are particularly dan-
gerous, since the infecting parasite may permeate through the placenta
to the foetus, resulting in congenital toxoplasmosis with a severe,
sometimes fatal course [3,10–12].
Proinflammatory cytokines, including IL1, IL6, IL12, and TNF-α, as
well as anti-inflammatory cytokine IL10, were reported to be involved
in the development of immune responses after infection with T. gondii
[13–16]. In mice with toxoplasmic encephalitis, increased levels of
IL1β, IL6, and TNF-α were determined in microglial cells [16]. Con-
sidering congenital toxoplasmosis, TNF-α was found among infants
with active retinochoroidal lesions during early and late immunological
events, while a robust monocyte-derived IL10-mediated profile was
identified in patients with cicatricial ocular lesions [14]. In turn,
treatment of BeWo trophoblast cells with IL10 and TGFB1, favoured T.
gondii proliferation, as well as down-modulated TNF-α and IL6 synth-
esis [13]. A study, performed for peripheral blood mononuclear cells
from parturient and non-pregnant women, exposed to live tachyzoites
of T. gondii, reported the cells from T. gondii-seronegative non-pregnant
women to produce significantly higher levels of TNF-α and IL12 cyto-
kines, when compared to those from parturient women [17]. It sug-
gested the immunomodulation, observed during pregnancy, to be in-
volved in the escape of T. gondii from the immune response [17]. A
study with co-cultured decidual dendritic cells (dDCs) and dNK cells,
either infected with T. gondii or non-infected ones, showed IL12 se-
cretion during parasitic infection to be associated with enhanced dNK
cell IFN-γ production and NKG2D expression and with increased cyto-
toxicity of dNK cells [15]. In consequence, the elevated cytotoxicity of
dNKcells, was reported to be possibly involved in abnormal pregnancy
outcomes related to T. gondii infections in early gestation periods [15].
Considering genetic alterations located within genes encoding cy-
tokines, IL6 -174 G > C and IL10 -1082 G > A single nucleotide poly-
morphisms (SNPs) were reported to be associated with toxoplasmic
retinochoroiditis (TR) [18,19]. Moreover, the GC heterozygotic status
within IL6 −174 G > C SNP, as well as the presence of C alleles in IL6
and IL1B +3954 C > T polymorphisms, were reported to be associated
with congenital toxoplasmosis [11]. In turn, IL1A −889 C > T, IL1B
C > T, and TNFA -308 G > A polymorphisms were not correlated with
TR, although distinct genotype and allele distributions in the range of
IL1A −889 C > T region were determined in patients with and without
recurrent episodes of the disease [20,21]. Additionally, specific re-
striction fragment length polymorphisms (RFLPs) and microsatellite
variants within TNFA gene were demonstrated to be associated with
resistance to toxoplasmic encephalitis in inbred mice [22]. Un-
fortunately, no previous study has been performed to reveal possible
involvement of genetic alterations from IL12 gene in toxoplasmosis
development. Nevertheless, the contribution of IL12 SNPs to various
infectious diseases was reported, including subacute sclerosing pa-
nencephalitis, brucellosis, salmonellosis, tuberculosis and severe ma-
laria [23–27].
284
Microbial Pathogenesis 121 (2018) 283–292
So far, no study has shown any possible role of genetic modifications
from the mentioned cytokine genes in the development of T. gondii
infections during pregnancy. In the presented paper, we raised research
to reveal further data, regarding genetic changes, on the contribution of
IL1, IL6, IL10, IL12, and TNF-α cytokines, to the immunity against
parasite. Therefore, the current study was aimed for the first time, to
determine a possible role of different SNPs, located within IL1A, IL1B,
IL6, IL10, IL12B and TNFA genes, in the occurrence of T. gondii infec-
tions in pregnant women. Additionally, we analyzed the influence of
those polymorphisms to congenital transmission of the parasite to the
foetuses of their infected mothers.
2. Materials and methods
The study was primarily performed with participation of 148 Polish
pregnant women, including 74 patients infected with Toxoplasma gondii
during pregnancy, and 74 age-matched uninfected individuals. The
pregnant women were qualified to the study from the patients treated at
the Department of Foeto-Maternal Medicine and Gynaecology at the
Polish Mother's Memorial Hospital – Research Institute in Lodz, be-
tween the years 2002 and 2015. The selected pregnant women were
between 18 and 41 years old (the mean age 28.7 years), and their ge-
stational age was from 2 to 40 weeks (the mean gestational age 23.2
weeks). The mean age of the infected pregnant women was
28.34 ± 4.73 years, and of the uninfected individuals – 28.83 ± 4.81
years (see Table 1). Considering the gestational age, the mean values
were 23.54 ± 8.80 years for the infected pregnant women and
22.92 ± 10.01 years for the uninfected individuals. Further analysis
with other 142 Polish pregnant women between the ages of 16 and 41
years, was performed to verify the primary outcomes, as well. This
additional study group included 66 pregnant women infected with T.
gondii (the mean age 28.47 ± 3.99 years, the mean gestational age
23.0 ± 11.6 weeks), and 76 uninfected individuals (the mean age
30.25 ± 4.60 years, the mean gestational age 21.0 ± 11.7 weeks),
treated at the Polish Mother's Memorial Hospital – Research Institute in
Lodz, between the years 2006 and 2017. The classification of pregnant
women to the study was based on their serological status towards anti-
T. gondii antibodies in serum specimens, suggestive of recent T. gondii
infection. The intrauterine infections with T. gondii were diagnosed in
the foetuses of the studied pregnant women, both by congenital tox-
oplasmosis-related ultrasound markers, as well as by the presence of
Table 1
Characteristics of pregnant women infected with T. gondii and of healthy con-
trols.
Characteristics Infected cases Healthy controls
Examined pregnant women; n (%) a
74 (50.0) 74 (50.0)
Mean age ± SDb (years) 28.34 ± 4.73 28.83 ± 4.81
Mean gestational age ± SD (weeks) 23.54 ± 8.80 22.92 ± 10.01
Anti-T. gondii serological status; n (%)c
IgG seropositivity 66 (98.51)
IgM seropositivity 64 (95.52)
Ultrasound abnormalities; n (%)d
Hydrocephalus/ IUGR 4 (5.41)
Ventriculomegaly/ Defects of the CNS 2 (2.70)
Foetal or neonatal death 3 (4.05)
a
n, the number of examined pregnant women.
b
SD, standard deviation.
c
In case of T. gondii-infected pregnant women, the serological status was
obtained for 67 individuals.
d
n, number of the offsprings was 74.
W. Wujcicka et al. Microbial Pathogenesis 121 (2018) 283–292

parasitic DNA in foetal amniotic fluid. The foetuses were included into
the study, based on the availability of clinical specimens. The symp-
toms, associated with congenital disease, including hydrocephalus,
defects of the central nervous system (CNS), ventriculomegaly, in-
trauterine growth retardation (IUGR) or foetal death, were confirmed in
the foetuses of 14.86% (11/74) of the studied T. gondii-infected preg-
nant women (see Table 1). The asymptomatic congenital toxoplasmosis
was determined in the offsprings of 2.70% (2/74) of the infected mo-
thers. Considering the additional cohort of pregnant women infected
with T. gondii, parasitic infection was confirmed for foetuses of 4.55%
(3/66) of the analyzed individuals. The study was approved by the
Research Ethics Committee at the Polish Mother's Memorial Hospital -
Research Institute. All the samples, previously collected for diagnostic
purposes, were anonymised in the current research. Informed consent
forms were signed by the pregnant women, enrolled into the study, and
the consent procedure was accepted by the Research Ethics Committee.
2.1. Serological screening
The presence of T. gondii IgG antibodies was determined, using the
enzyme-linked fluorescent assay (ELFA) VIDAS TOXO IgG II
(bioMérieux), and of IgM antibodies – using an ELFA assay VIDAS
TOXO IgM (bioMérieux), according to the manufacturer's guidelines. T.
gondii IgG avidity was estimated by an ELFA assay VIDAS TOXO IgG
AVIDITY assay (bioMérieux). The recent T. gondii infection in preg-
nancy was determined in case of IgG seroconversion and/ or of the
seropositivity of IgM and low IgG avidity index. IgG seropositivity was
determined in 98.51% (66/67) of T. gondii-infected pregnant women,
while IgM antibodies, suggestive of recent infection, were observed in
95.52% (64/67) of the infected individuals (see Table 1). The pregnant
women were qualified into the control group in case of seronegativity
for both IgG and IgM antibodies against the parasite.

Fig. 1. Electropherograms with nested PCR-RFLP products for IL1A −889 C > T (A), IL1B +3954 C > T (B), IL6 -174 G > C (C), IL10 -1082 G > A (D), IL12B −1188
A > C (E) and TNF -308 G > A (F) polymorphisms. Products digested with appropriate endonucleases (NcoI, TaqI, Hsp92II, or XagI) were resolved in 2% agarose
gels, stained with ethidium bromide. The numbers on the right side of pictures present the sizes of separated DNA fragments. M − 50 bp DNA marker; Ud –
undigested PCR product; AA, AC, CC, CT, GA, GC, GG, or TT – genotypes within the analyzed polymorphisms.

285
W. Wujcicka et al. Microbial Pathogenesis 121 (2018) 283–292

2.2. DNA extraction Table 3

Restriction enzymes and genotypic profiles obtained in PCR-RFLP assays.
Genomic DNA of the pregnant women was extracted from 200 μl of Polymorphism Restriction enzyme Profile (bps)a
whole blood or from 500 μl of serum specimens, using a QIAamp DNA
Mini Kit (QIAGEN, Hilden, Germany). The obtained DNA was diluted in IL1A 889 C > T NcoI CC: 266, 43
CT: 309, 266, 43
100 μl of elution buffer and stored at −20 °C until further genetic
TT: 309
analyses. IL1B +3954 C > T TaqI CC: 135, 114
CT: 249, 135, 114
TT: 249
2.3. SNPs genotyping in cytokine genes IL6 -174 G > C Hsp92II GG: 229, 173, 29
GC: 229, 173, 122, 51, 29
CC: 229, 122, 51, 29, 29
Genotypes within IL1A −889 C > T, IL1B +3954 C > T, IL6 IL10 -1082 G > A XagI GG: 253, 97, 27
-174 G > C, IL12B −1188 A > C and TNFA -308 G > A polymorphic GA: 280, 253, 97, 27
sites of the proinflammatory cytokine genes and IL10 -1082 G > A AA: 280, 97
polymorphism of the anti-inflammatory cytokine gene were de- IL12B 1188 A > C TaqI AA: 243
AC: 243, 173, 70
termined, using self-designed nested PCR-RFLP assays. Oligonucleotide
CC: 173, 70
sequences and conditions of the PCR assays are shown in Table 1. The TNFA 308 G > A NcoI GG: 87, 20
external oligonucleotides were designed, using the Vector NTI Suite 5.5 GA: 107, 87, 20
software, and the internal primers were obtained from the literature AA: 107
[18,19,21,28–31]. Nested PCR products were resolved on 1% agarose a
bps, base pairs.
gels, stained with ethidium bromide and then digested overnight with
NcoI, TaqI, Hsp92II, and XagI endonucleases to determine genotypes in
chromatograms for genotypes from IL6, IL12B, and TNFA SNPs are
IL1A and TNFA, IL1B and IL12B, IL6, and IL10 polymorphisms, re-
presented in Fig. S1. The sequences of the chromatograms were ana-
spectively. Genotypic profiles were determined, based on the length of
lyzed by the Sequence Scanner 1.0 (Applied Biosystems) program.
restriction fragments, resolved on 2% agarose gels (see Fig. 1 Tables 2
and 3). Randomly selected PCR products, representing distinct geno-
types in the analyzed SNPs, were then sequenced by the Sanger method 2.4. Statistical analysis
at the Genomed Joint-Stock Company (Warsaw, Poland), to confirm
nested PCR-RFLP outcomes. Sequencing was performed for 85 CC Distribution of the single genotypes and alleles in the range of all
homozygotes, 51 CT heterozygotes and 17 TT homozygotes in IL1A the analyzed polymorphisms, as well as of the haplotypes within IL1A
SNP, for 76 CC homozygotes, 42 CT heterozygotes and 11 TT homo- and IL1B SNPs, and multiple-SNP distinct variants including alleles
zygotes in IL1B polymorphism, for 52 GG homozygotes, 20 GC hetero- from three to all of the studied polymorphisms, between T. gondii-in-
zygotes and 35 CC homozygotes in IL6 polymorphism, for 32 GG, 60 GA fected and uninfected pregnant women, was determined by means of
and 51 AA genotypes in IL10 SNP, for 37 AA, 15 AC and five CC geno- descriptive statistics, using the SNPStats software (http://bioinfo.
types in IL12B SNP, as well as for 119 GG, 35 GA, and four AA geno- iconcologia.net/en/SNPStats_web). Genotypes in the analyzed poly-
types in TNFA polymorphism. See Fig. 2 for examples of chromato- morphisms were studied for the Hardy-Weinberg (H-W) equilibrium,
grams, illustrating the genotypes in IL1A, IL1B and IL10 SNPs. The and, in case of IL1A and IL1B SNPs – for the linkage disequilibrium as

Table 2
Conditions of nested PCR assays for genotyping of the polymorphisms located within IL1A, IL1B, IL6, IL10, IL12B and TNFA genes.
Gene GenBank Accession SNPb name Primer sequences (5′-3′) Annealing temperature Amplicon length
No.a [oC] (bps)c

IL1A NC_000002 −889 C > T (rs1800587) External For: AAACAGGAACAGAGGGAATACTT 52 485

Rev: CTGTAGAAGAAGGTGTGTGCAAG
Internal For:GGGGGCTTCACTATGTTGCCCACACTGGACTAA 57 309
Rev:GAAGGCATGGATTTTTACATATGACCTTCCATG
IL1B NC_000002 +3954 C > T External For: GTAATAGACCTGAAGCTGGAACC 52 383
(rs1143634) Rev: CCATTTACCTTGTTGCTCCATA
Internal For: GTTGTCATCAGACTTTGACC 59 249
Rev: TTCAGTTCATATGGACCAGA
IL6 NC_000007 −174 G > C (rs1800795) External For: GAAGTAACTGCACGAAATTTGAG 52 543
Rev: GATAAATCTTTGTTGGAGGGTGA
Internal For: CAGAAGAACTCAGATGACTG 58 431
Rev: GTGGGGCTGATTGGAAACC
IL10 AF295024.1 −1082 G > A External For: TGAAGGCTCAATCAAAGGATC 52 632
(rs1800896) Rev: CATGTTTCCACCTCTTCAGCT
Internal For: CCAAGACAACACTACTAAGGCTCCTTT 60 377
Rev: GCTTCTTATATGCTAGTCAGGTA
IL12B AY008847 −1188 A > C External For: CTGGCATGAAATCCCTGAA 52 421
(rs3212227) Rev: CATCCTGGCAGACAAACGTTA
Internal For: GGCATTCTCTTCCAGGTTCTG 56 243
Rev: CCATGGCAACTTGAGAGCTG
TNFA NC_000006 −308 G > A (rs1800629) External For: TCAGCTTTCTGAAGCCCCT 52 266
Rev: GGGATTTGGAAAGTTGGGG
Internal For: AGGCAATAGGTTTTGAGGGCCAT 56 107
Rev: TCCTCCCTGCTCCGATTCCG

a
No., number.
b
SNP, single nucleotide polymorphism.
c
bps, base pairs.

286
W. Wujcicka et al. Microbial Pathogenesis 121 (2018) 283–292

Fig. 2. Chromatograms with DNA fragments, containing IL1A −889 C > T (A–C), IL1B +3954 C > T (D–F), and IL10 -1082 G > A (G–I) polymorphic sites. DNA
forward strands were analyzed for IL1 SNPs, and the reverse strands – for IL10 SNP. AA, CC, CT, GA, GG, or TT – genotypes in presented polymorphisms.

287
W. Wujcicka et al. Microbial Pathogenesis 121 (2018) 283–292

Table 4 respectively. Taking into account IL12B −1188 A > C SNP, AA, AC and
Associations of haplotypes for IL1A and IL1B polymorphisms with the occur- CC genotypes were observed in 68.1% (49/72), 26.4% (19/72), and
rence of T. gondii infections in pregnant women. 5.6% (4/72) of the infected patients, respectively. In case of TNFA
Alleles in IL1 SNPsa Haplotype prevalence ORb (95% P-valued -308 G > A polymorphism, GG, and GA genotypes were found in 77.5%
CIc) (55/71) and 22.5% (16/71) of the infected women, respectively.
IL1A IL1B + Infected Uninfected In the uninfected control group of pregnant women, CC, CT and TT
-889 C > T 3954 C > T cases controls
genotypes, in the range of IL1A SNP, were seen in 54.8% (40/73),
C C 0.700 0.625 1.00 26.0% (19/73), and 19.2% (14/73) of the studied patients, respec-
T T 0.213 0.186 1.06 0.830 tively. In the range of IL1B polymorphism, CC, CT, and TT variants were
(0.62–1.82) determined in 57.5% (42/73), 37.0% (27/73) and in 5.5% (4/73) of the
T C 0.057 0.136 0.41 0.040
uninfected individuals, respectively. In case of IL6 SNP, GG, GC and CC
(0.18–0.95)
C T 0.031 0.054 0.56 0.350 genotypes were found in 41.1% (30/73), 38.4% (28/73), and 20.5%
(0.17–1.86) (15/73) of the studied pregnant women. Taking into account IL10
polymorphism, GG, GA, and AA variants were observed in 24.3% (18/
a
SNPs, single nucleotide polymorphisms. 74), 41.9% (31/74) and 33.8% (25/74) of the studied pregnant women,
b
OR, odds ratio. respectively. Considering IL12B SNP, AA, AC and CC genotypes were
c
95% CI, confidence interval. found in 71.6% (53/74), 24.3% (18/74), and 4.0% (3/74) of the un-
d
Logistic regression model; P≤0.050 is considered significant. infected individuals, respectively. In case of TNFA polymorphism, GG,
GA and AA variants were determined in 72.6% (53/73), 23.3% (17/
well. The relationships between the genetic modifications within the 73), and 4.1% (3/73) of the uninfected pregnant women. The observed
polymorphisms and the occurrence of T. gondii infection among preg- genotypes within the studied polymorphic sites were similarly dis-
nant women, as well as of the congenital parasitic transmission from the tributed between T. gondii-infected and uninfected pregnant women. In
infected pregnant women to their foetuses, were estimated by cross- turn, multiple-SNP analysis showed TC haplotype in the range of IL1A
tabulation, Pearson's Chi-square test and the logistic regression model and IL1B SNPs to be significantly associated with a decreased risk of the
to define genetic models of inheritance, including codominant, domi- parasitic infection (OR 0.41 95% CI 0.62–1.82, P≤0.050, see Table 4).
nant, recessive and overdominant models. The analyses enabled to es- The additional power analysis performed for pregnant women with TC
timate the best models of inheritance of genetic changes within the haplotypes, revealed that infection was significantly more prevalent in
analyzed cytokine genes, which are typical for the studied T. gondii carriers of CT-CC and CT-CT complex variants, while the lack of in-
infections among pregnant women. The multiple-SNP analyses of hap- fection - among individuals with TT-CT and TT-CC variants (Cramér's
lotypes in IL1 SNPs and of the complex variants for the studied poly- V = 0.39, χ2 = 7.73, P≤0.050, see Table 5). Moreover, the further
morphisms, were performed by the Expectation Maximization (EM) analysis performed for larger groups of patients with all individuals
algorithm. The possible impact of statistically significant results of included in the study, confirmed important relationship between the
single- as well as multiple-SNP analyses, was estimated by Cramér's V occurrence of TC haplotype within IL1A and IL1B SNPs, and decreased
test. The power analysis was performed using the SPSS Statistics 17.0 risk of the infection (OR 0.47 95% CI 0.24–0.93, P≤0.050). The
software. The outcomes were acknowledged as statistically significant CCCAGA complex variants for all the studied polymorphisms were at
at the significance level of P≤0.050. The statistical analysis was, in increased risk of T. gondii infection (OR 8.14 95% CI 1.79–37.08,
part, supported by the NCSS 2004 software. P≤0.050, see Table 6). In the power analysis, CCCAGA variants were
strongly associated with the occurrence of infection, however the re-
3. Results lationship was not significant (Cramér's V = 0.76, χ2 = 26.81,
P = 0.310, see Table S1). Considering other complex variants, similar
3.1. Hardy-Weinberg equilibrium, linkage disequilibrium distribution levels were determined in the studied groups of pregnant
women. Regarding the susceptibility to congenital transmission of T.
Hardy-Weinberg (H-W) equilibrium was preserved in case of IL1A gondii from mothers to their foetuses, the occurrence of GA hetero-
−889 C > T SNP in the T. gondii-infected pregnant women, in case of zygotic status within IL10 polymorphism in the infected pregnant
IL1B +3954 C > T and IL6 -174 G > C SNPs – in the uninfected in- women, increased significantly the risk of parasitic transmission (OR
dividuals and in case of IL10 -1082 G > A, IL12B −1188 A > C and 5.73 95% CI 1.12–29.25 in the codominant model, and OR 5.18 95% CI
TNFA -308 G > A SNPs – in all the studied women (P > 0.050). H-W 1.27–21.19 in the overdominant model; P≤0.050, see Table 7). The
was not observed in case of IL1A polymorphism – among the uninfected power analysis showed GA heterozygotic status to be significantly more
pregnant women or in case of IL1B and IL6 SNPs – among the infected prevalent among infected foetuses, and AA homozygotic status - among
patients (P≤0.050). IL1A and IL1B SNPs were found in the linkage uninfected individuals (Cramér's V = 0.29, χ2 = 6.03, P≤0.050).
disequilibrium between the studied groups of the infected and unin- However, the association was not further significant among larger study
fected pregnant women (P≤0.050). groups of pregnant women. Other genotypic variants within the studied

3.2. Distribution of genotypes in cytokine gene polymorphisms

Table 5
Complex genotypes for TC haplotype within IL1A and IL1B SNPs and T. gondii
Considering the T. gondii-infected pregnant women, CC, CT and TT infections in pregnant women.
genotypes within IL1A −889 C > T SNP, were observed in 59.1% (42/
Complex genotypes for TC haplotypes, Infected Controls Totality
71), 29.6% (21/71), and 11.3% (8/71) of the studied individuals, re-
No. of carriers (%)a cases
spectively. Considering the T. gondii-infected pregnant women, CC, CT
and TT genotypes within IL1A −889 C > T SNP, were observed in CT-CC 7 (31.8) 5 (16.7) 12 (23.1)
62.2% (46/74), 27.0% (20/74), and 10.8% (8/74) of the studied in- CT-CT 14 (63.6) 14 (46.7) 28 (53.8)
TT-CC 0 (0.0) 3 (10.0) 3 (5.8)
dividuals, respectively. Considering IL6 -174 G > C SNP, GG, GC and
TT-CT 1 (4.5) 8 (26.7) 9 (17.3)
CC variants were determined in 49.3% (35/71), 29.6% (21/71), and Totality 22 (100.0) 30 (100.0) 52 (100.0)
21.1% (15/71) of the infected women. In case of IL10 -1082 G > A
a
polymorphism, GG, GA, and AA variants were found in 15.3% (11/72), No. of tested pregnant women, P = 0.050, Cramer's V = 0.39,χ2 = 7.73;
43.1% (31/72), and in 41.7% (30/72) of the infected patients, P≤0.050 is considered significant.

288
W. Wujcicka et al. Microbial Pathogenesis 121 (2018) 283–292

Table 6
The most common multiple-SNP variants for the polymorphisms of cytokine genes and the risk of T. gondii infection in pregnant women.
Alleles within SNPsa Multiple-SNP variant prevalence ORb (95% CIc) P-valued

IL1A - IL1B IL6 -174 G > C IL10 IL12B -1188 TNF -308 G > A Infected Uninfected
889 C > T +3954C > T -1082 G > A A>C cases controls

C C G G A G 0.172 0.171 1.00

C C G A A G 0.181 0.143 1.53 (0.51–4.58) 0.450
C C C A A G 0.187 0.089 8.14 0.008
(1.79–37.08)
C C G A A A 0.024 0.054 0.41 (0.06–2.72) 0.360
T T C G A G 0.033 0.064 0.32 (0.04–2.42) 0.270
T T C A A G 0.039 0.025 2.35 0.320
(0.44–12.64)
T T G G A G 0.046 0 1.61 (0.27–9.52) 0.600
T T G A A G 0.037 0.040 1.70 (0.30–9.67) 0.550
C C C G C G 0.046 0.032 0.13 (0.02–1.06) 0.059
C C G G C G 0.023 0.029 4.42 0.220
(0.41–48.01)

a
SNPs, single nucleotide polymorphisms.
b
OR, odds ratio.
c
95% CI, confidence interval.
d
Logistic regression model; P≤0.050 is considered as significant; global multiple-SNP variants association P-value was estimated to be 0.028.

polymorphisms were distributed similarly among the T. gondii-infected
mothers of the congenitally infected and uninfected foetuses. Moreover,
the important relationships found for the first studied cohort of preg-
nant women, remained non-significant in the second group of patients.
3.3. Allelic variants within SNPs of the cytokine genes
Among T. gondii-infected pregnant women, C and T alleles in IL1A
−889 C > T SNP were observed with the prevalence rates of 74.0%
(105/142) and 26.0% (37/142), respectively. In case of IL1B +3954
C > T polymorphism, C and T alleles were found with the prevalence
rates of 76.0% (112/148) and 24.0% (36/148), respectively. Taking
into account IL6 SNP -174 G > C polymorphism, the prevalence rates of
G and C alleles were 64.0% (91/142) and 36.0% (51/142), respectively.
Considering IL10 -1082 G > A SNP, G and A alleles were determined
with the prevalence rates of 63.0% (91/144) and 37.0% (53/144), re-
spectively. A and C alleles in IL12B −1188 A > C SNP, were observed
with the prevalence rates of 81.0% (117/144) and 19.0% (27/144),
respectively. In case of TNFA -308 G > A polymorphism, G and A alleles
demonstrated the prevalence rates of 89.0% (126/142) and 11.0% (16/
142), respectively.
Taking into account the uninfected control pregnant women, C and
T alleles within IL1A SNP were observed with the prevalence rates of
68.0% (99/146) and 32.0% (47/146), respectively. In case of IL1B
polymorphism, C and T alleles demonstrated the prevalence rates of
76.0% (111/146) and 24.0% (35/146), respectively. Considering IL6
SNP, the prevalence rates of G and C alleles were 60.0% (88/146) and
40.0% (58/146), respectively. G and A alleles within IL10 SNP were
determined with the prevalence rates of 55.0% (81/148) and 45.0%
(67/148), respectively. In case of IL12B polymorphism, A and C alleles
were found with the prevalence rates of 84.0% (124/148) and 16.0%
(24/148), respectively. G and A alleles within TNFA SNP were observed
at the prevalence rates of 84.0% (123/146) and 16.0% (23/146), re-
spectively. The observed genotypes at the studied polymorphic sites
were similarly distributed between T. gondii-infected and uninfected
pregnant women.
4. Discussion
TC haplotype, in the range of IL1A −889 C > T and IL1B
+3954 C > T polymorphisms, was found in the current study to be
correlated with a decreased risk of T. gondii infection among Polish
pregnant women. Significantly more prevalent infection was observed
in carriers of CT-CC and CT-CT complex variants, while the lack of
infection - among individuals with TT-CT and TT-CC variants.
Considering the infections with T. gondii, C allele within IL1B SNP was
previously reported to occur significantly more frequently among the
foetuses and neonates with congenital infection than among uninfected

Table 7
Relationship between genotypes in IL10 polymorphism and congenital parasitic transmission to the foetuses of T. gondii-infected pregnant women.
Gene polymorphism Genetic model Genotype Genotype prevalence rates; n (%)a ORb (95% CI)c P-valued

Infected offsprings Controls

IL10 -1082 G > A Codominant GG 1 (8.3%) 10 (16.7%) 1.40 (0.11–17.17)

GA 9 (75.0%) 22 (36.7%) 5.73 (1.12–29.25)
AA 2 (16.7%) 28 (46.7%) 1.00 0.047
Dominant AA 2 (16.7%) 28 (46.7%) 1.00
GA-GG 10 (83.3%) 32 (53.3%) 4.37 (0.88–21.68) 0.043
Recessive AA-GA 11 (91.7%) 50 (83.3%) 1.00
GG 1 (8.3%) 10 (16.7%) 0.45 (0.05–3.93) 0.440
Overdominant AA-GG 3 (25.0%) 38 (63.3%) 1.00
GA 9 (75.0%) 22 (36.7%) 5.18 (1.27–21.19) 0.014

a
n, the number of tested pregnant women.
b
OR, odds ratio.
c
95% CI, confidence interval.
d
Logistic regression model; P≤0.050 is considered significant.

289
W. Wujcicka et al.
cases [8]. Moreover, a protective role of T allele from IL1B SNP was
suggested against congenital T. gondii infection as well [11]. In turn, in
a cross-sectional study performed for TR patients, comparable pre-
valence rates of genotypes and alleles, located within both IL1A
−889 C > T and IL1B +3954 C > T polymorphisms, were found
among the individuals with TR and controls [20]. The distribution of
the C and T alleles within IL1A −889 C > T SNP that occurred in our
study among uninfected pregnant women, was similar to the reported
prevalence rates in healthy individuals in China, Iran, Germany, Swit-
zerland, Italy and Austria [32–35]. It is noteworthy that the prevalence
rates of C and T alleles in IL1A polymorphism, found in both T. gondii-
infected and uninfected pregnant women, were comparable to the rates
previously reported for the foetuses and neonates with congenital tox-
oplasmosis and uninfected controls, respectively [11]. In case of IL1B
+3954 C > T SNP, the C and T alleles among healthy pregnant women
were found to be at comparable prevalence rates to those reported for
normal pregnant individuals from the North East of Iran, as well as for
healthy populations of Germany, Switzerland, Italy and Austria
[33,36]. Taking into account the distribution of C and T alleles in IL1B
SNP among T. gondii-infected pregnant women, similar prevalence rates
were observed in children with meningococcal disease in Germany,
Switzerland, Italy and Austria [33]. Moreover, the distribution of CC,
CT, and TT genotypes in the range of IL1B polymorphism, determined
in our study in healthy pregnant women, was similar to the reported
prevalence rates for normal pregnant individuals, living in the North
East of Iran as well as in Austria [36,37]. Considering the distribution of
the reported genotypes from IL1B SNP among T. gondii-infected preg-
nant women, comparable outcomes were estimated for Chinese adults
with recurrent oral ulceration, Chinese patients with acute pancreatitis,
Egyptian chronic HCV subjects, as well as for German patients suffering
from periodontitis [35,37–39].
Regarding the mechanistic function, the IL1A −889 C > T poly-
morphism, located at 5′-UTR region of the gene, was previously sug-
gested to regulate the expression of the encoded IL1α cytokine [40].
The TT, compared to CC genotype in this SNP, was found to be sig-
nificantly associated with higher transcriptional activity of IL1A in
plasma specimens, as well as with increased levels of IL1α in severe
periodontal disease and in chronic iridocyclitis in juvenile rheumatoid
arthritis [41–43]. Moreover, TT genotype in IL1A SNP was observed to
be possibly involved in the elevated expression of IL1β cytokine, as
compared to the levels determined in CC genotypes [44]. In case of
synonymous IL1B +3954 C > T polymorphism, located within the fifth
exon of the gene, a modification was proposed to result in a premature
stop codon or exon skipping and, therefore, in production of degraded
or functionally inactive protein [43]. The IL1B SNP was also correlated
with an increased production of the encoded cytokine in response to
LPS-stimulation, as well as with the occurrence of advanced period-
ontitis in adults [45,46]. Additionally, lowered expression levels of
ocular IL1α cytokine were reported to be associated with the occur-
rence of more severe inflammation in the retina and vitreous humour,
related to ocular toxoplasmosis in mice [47]. Considering IL1β, sig-
nificantly higher levels were found in human monocytic wild-type
MonoMac6 cells, infected with T. gondii, as compared to non-infected
cells [48]. Other studies also showed contribution of IL1β cytokine to
an immune response observed after T. gondii infection [11,49,50].
Therefore, it seems that both the affected regulation of IL1α and IL1β
expression levels, and the linkage disequlibrium between IL1A and IL1B
polymorphisms, localised very closely in the long arm of chromosome
2, might argue for a common contribution of the studied IL1 SNPs to the
occurrence of T. gondii infection among pregnant women [51,52].
Moreover, the complex CCCAGA multiple-SNP variants in the range
of all the analyzed polymorphisms within IL1A, IL1B, IL6, IL10, IL12B,
and TNFA genes, were correlated with about eight times higher risk of
infection with T. gondii among pregnant women, although this strong
association was not further significant in the power analysis.
Considering IL6 -174 G > C polymorphism, the C allele was also
290
Microbial Pathogenesis 121 (2018) 283–292
previously reported to be significantly associated with congenital
parasitic infection among foetuses and neonates, as well as with TR
among adult patients [11,19]. Taking into account IL10 –1082 G > A
SNP, the presence of A allele was shown to be related to the occurrence
of TR [18]. Additionally, TR patients with AA and AG genotypes were
determined to be at increased risk of the disease, as compared to the
individuals with GG genotypes [18]. Similarly, in the current study, the
GA heterozygotic pregnant women within IL10 -1082 G > A poly-
morphism, were significantly more susceptible to congenital transmis-
sion of the parasite to their foetuses. The further power analysis con-
firmed almost moderate important association of GA female genotype
in IL10 -1082 G > A SNP with the occurrence of congenital infection,
while AA homozygotes were correlated with the lack of infection.
Among larger cohort of patients, the lack of significance observed for
the relationship between GA genotypes within IL10 -1082 G > A poly-
morphism, and congenital infection, might result from different struc-
ture of randomly selected groups of pregnant women, regarding para-
sitic transmission to their foetuses. It seems possible that, among T.
gondii-infected pregnant women, the minor C allele located in IL6 SNP
and the A allele in IL10 polymorphism may have been associated with
elevated and decreased levels of their encoded cytokines, respectively.
The IL6 -174 G > C SNP was shown to alter the immune response
against T. gondii through an increased expression of the cytokine [11].
In turn, IL10 -1082 G > A polymorphism, was correlated with a de-
creased production of the encoded molecule [18]. In case of IL12B
−1188 A > C SNP, the presence of C allele and the occurrence of CC
genotype were reported to be significantly more prevalent among
healthy controls, as compared to patients with active brucellosis, while
the AA genotype was more frequent among the patients, and correlated
with increased serum levels of the IL-12p40 cytokine [24]. The elevated
expression of IL12 may also have been associated with T. gondii infec-
tion among pregnant women [24,53]. Regarding multiple-SNP analysis,
the CCGAG variants in the range of IL1A −889 C > T, IL1B
+3954 C > T, IL6 -174 G > C, IL12B −1188 A > C and TNF
-308 G > A polymorphisms were previously reported to be correlated
with an increased risk of congenital HCMV infection among foetuses
and neonates [27]. Therefore, the common influence of various SNPs
from different genes, encoding cytokines, seems also possible for the
occurrence of T. gondii infection in the presented cohort of Polish
pregnant women. The lack of important differences determined in the
power analysis, might result from too much flattening of the outcomes
obtained in the research. In turn, lack of significant results for the above
presented relationships found for the second study group of pregnant
women, in comparison with statistically important outcomes specific
for the first cohort of patients, might be caused by selection bias of
these two Polish populations to the research. It is noteworthy, that the
analyzed two cohorts were hospitalized at the Polish Mother's Memorial
Hospital – Research Institute at different time intervals. Therefore,
contribution of the studied genetic changes located within cytokine
genes to the occurrence of T. gondii infection in pregnant women, might
be characteristic for the analyzed cohort of patients, as well as depen-
dent on the time frame of the cohort selection to the study. Taking into
account TNFA -308 G > A polymorphism, the GG and AG haplotypes
for LTA +252 G > A and TNF SNPs, were shown to be associated with
sepsis development among infected Colombian patients [54]. Among
Tanzanian children, infected with Plasmodium, the AA genotype within
TNFA -308 SNP was significantly associated with decreased rates of
malarial episodes [55]. Considering the available literature data and
the outcomes, presented in the current research, the individual influ-
ence of genetic changes within TNFA -308 G > A polymorphism does
not seem to be associated with the occurrence of T. gondii infection
among pregnant women, although its contribution to the parasitic in-
fection among pregnant women, may be related to the simultaneous
presence of the genetic alterations from other cytokine genes. De-
creased expression of TNF-α seems to occur among T. gondii-infected
pregnant women, since the A allele in the analyzed TNFA
W. Wujcicka et al.
polymorphism was reported to be correlated with the increased ex-
pression of TNF-α [56,57]. Taking into account all IL1α, IL1β, IL6,
IL10, IL12, and TNF-α cytokines, analyzed in this study, several pre-
vious papers also showed their contribution to the immune response
after T. gondii infection [13–16]. A study of a murine model revealed
that T. gondii-infected macrophages expressed high amounts of IL1β,
IL12, as well as TNF-α cytokines [21,58]. In case of T. gondii-infected
IL6 knockout mice, more severe inflammations in the retina and vitr-
eous humour were associated with lower IL1α and higher TNF-α ex-
pression levels [19,47]. In turn, IL10 has been proposed to down-
regulate the protective immune response to T. gondii through the
expression of TNF-α and IL12 cytokines [18,59]. Therefore, regarding
the reported literature and outcomes presented in this paper, a common
involvement of the polymorphisms from all the currently studied genes
may be plausible through an altered expression of the encoded cyto-
kines, for the occurrence of T. gondii infection among pregnant women.
However, further studies with other cohorts of pregnant women would
be necessary to reveal a more detailed role of the analyzed poly-
morphisms in the occurrence of the infection during pregnancy.
5. Conclusions
Summing up, TC haplotype for IL1A and IL1B SNPs was found to be
significantly associated with a decreased risk of the parasitic infection
among Polish pregnant women. Considering all the analyzed poly-
morphisms, the CCCAGA complex variants were correlated with an
about eight times higher risk of T. gondii infection, although the strong
association remained non-significant in the power analysis.
Additionally, the occurrence of GA heterozygotic status within IL10
polymorphism among infected pregnant women significantly increased
the risk of parasitic transmission to their foetuses, but the association
was not further important for a larger cohort of pregnant women. In
turn, the important relationships found to be specific for the first study
cohort of pregnant women, were not further significant for another
cohort of patients, possibly due to selection bias. The genetic changes
within the studied polymorphisms of IL1A, IL1B, IL6, IL12B, as well as
IL10 genes, may have been associated with susceptibility to T. gondii
infection among studied cohort of Polish pregnant women. However,
further research with other populations of pregnant women would be
desirable to reveal a more detailed role of the presented polymorphisms
in the analyzed T. gondii infections.
Acknowledgements
The study was supported by the Polish Ministry of Science & Higher
Education, Polish Mother's Memorial Hospital – Research Institute
(Grant supporting statutory research No. 2014/II/3).
Appendix A. Supplementary data
Supplementary data related to this article can be found at http://dx.
doi.org/10.1016/j.micpath.2018.05.048.
References
[1] A. Berrebi, M. Bardou, M.H. Bessieres, D. Nowakowska, R. Castagno, M. Rolland,
M. Wallon, J. Franck, A. Bongain, P. Monnier-Barbarino, C. Assouline, S. Cassaing,
Outcome for children infected with congenital toxoplasmosis in the first trimester
and with normal ultrasound findings: a study of 36 cases, Eur. J. Obstet. Gynecol.
Reprod. Biol. 135 (1) (2007) 53–57.
[2] S.E. Jamieson, L.A. de Roubaix, M. Cortina-Borja, H.K. Tan, E.J. Mui, H.J. Cordell,
M.J. Kirisits, et al., Genetic and epigenetic factors at COL2A1 and ABCA4 influence
clinical outcome in congenital toxoplasmosis, PLoS One 3 (6) (2008) e2285.
[3] D. Nowakowska, M. Respondek-Liberska, E. Golab, B. Stray-Pedersen, K. Szaflik,
T.H. Dzbenski, J. Wilczynski, Too late prenatal diagnosis of fetal toxoplasmosis: a
case report, Fetal Diagn. Ther. 20 (3) (2005) 190–193.
[4] D. Nowakowska, W. Wujcicka, W. Sobala, E. Spiewak, Z. Gaj, J. Wilczynski, Age-
associated prevalence of Toxoplasma gondii in 8281 pregnant women in Poland
between 2004 and 2012, Epidemiol. Infect. 142 (3) (2014) 656–661.
291
Microbial Pathogenesis 121 (2018) 283–292
[5] G. Pappas, N. Roussos, M.E. Falagas, Toxoplasmosis snapshots: global status of
Toxoplasma gondii seroprevalence and implications for pregnancy and congenital
toxoplasmosis, Int. J. Parasitol. 39 (12) (2009) 1385–1394.
[6] J.M. Ramos, A. Milla, J.C. Rodriguez, S. Padilla, M. Masia, F. Gutierrez,
Seroprevalence of Toxoplasma gondii infection among immigrant and native
pregnant women in Eastern Spain, Parasitol. Res. 109 (5) (2011) 1447–1452.
[7] A.P. Lopes, J.P. Dubey, O. Moutinho, M.J. Gargate, A. Vilares, M. Rodrigues,
L. Cardoso, Seroepidemiology of Toxoplasma gondii infection in women from the
North of Portugal in their childbearing years, Epidemiol. Infect. 140 (5) (2012)
872–877.
[8] J.Q. Nash, S. Chissel, J. Jones, F. Warburton, N.Q. Verlander, Risk factors for tox-
oplasmosis in pregnant women in Kent, United Kingdom, Epidemiol. Infectio 133
(3) (2005) 475–483.
[9] B. Pinto, B. Castagna, R. Mattei, R. Bruzzi, L. Chiumiento, R. Cristofani,
W. Buffolano, F. Bruschi, Seroprevalence for toxoplasmosis in individuals living in
north west Tuscany: access to Toxo-test in central Italy, Eur. J. Clin. Microbiol.
Infect. Dis. 31 (6) (2012) 1151–1156.
[10] J.M. Remington, R. McLeod, C.B. Wilson, G. Desmonts, Toxoplasmosis,
J.S. Remington, J.O. Klein (Eds.), Infectious Diseases of the Fetus and Newborn
Infant, Saunders, Philadelphia, 2011, pp. 918–1041.
[11] W. Wujcicka, Z. Gaj, J. Wilczynski, D. Nowakowska, Contribution of IL6 -174 G > C
and IL1B +3954 C > T polymorphisms to congenital infection with Toxoplasma
gondii, Eur. J. Clin. Microbiol. Infect. Dis. 34 (11) (2015) 2287–2294.
[12] W. Wujcicka, Z. Gaj, J. Wilczynski, D. Nowakowska, Possible role of TLR4 and TLR9
SNPs in protection against congenital toxoplasmosis, Eur. J. Clin. Microbiol. Infect.
Dis. 34 (10) (2015) 2121–2129.
[13] B.F. Barbosa, J.B. Lopes-Maria, A.O. Gomes, M.B. Angeloni, A.S. Castro, P.S. Franco,
M.L. Fermino, M.C. Roque-Barreira, F. Ietta, O.A. Martins-Filho, D.A. Silva,
J.R. Mineo, E.A. Ferro, IL10, TGF beta1, and IFN gamma modulate intracellular
signaling pathways and cytokine production to control Toxoplasma gondii infection
in BeWo trophoblast cells, Biol. Reprod. 92 (3) (2015) 82.
[14] A.C. Carneiro, A.S. Machado, S.R. Bela, J.G. Costa, G.M. Andrade, D.V. Vasconcelos-
Santos, J.N. Januario, J.G. Coelho-Dos-Reis, E.A. Ferro, A. Teixeira-Carvalho,
R.W. Vitor, O.A. Martins-Filho, Cytokine signatures associated with early onset,
active lesions and late cicatricial events of retinochoroidal commitment in infants
with congenital toxoplasmosis, J. Infect. Dis. 213 (12) (2016) 1962–1970.
[15] X. Liu, M. Zhao, X. Yang, M. Han, X. Xu, Y. Jiang, X. Hu, Toxoplasma gondii in-
fection of decidual CD1c(+) dendritic cells enhances cytotoxicity of decidual nat-
ural killer cells, Inflammation 37 (4) (2014) 1261–1270.
[16] Y.H. Zhang, H. Chen, Y. Chen, L. Wang, Y.H. Cai, M. Li, H.Q. Wen, J. Du, R. An,
Q.L. Luo, X.L. Wang, Z.R. Lun, Y.H. Xu, J.L. Shen, Activated microglia contribute to
neuronal apoptosis in Toxoplasmic encephalitis, Parasites Vectors 7 (2014) 372.
[17] K. Rezende-Oliveira, N.M. Silva, J.R. Mineo, V. Rodrigues Junior, Cytokines and
chemokines production by mononuclear cells from parturient women after stimu-
lation with live Toxoplasma gondii, Placenta 33 (9) (2012) 682–687.
[18] C.A. Cordeiro, P.R. Moreira, M.S. Andrade, W.O. Dutra, W.R. Campos, F. Orefice,
A.L. Teixeira, Interleukin-10 gene polymorphism (-1082G/A) is associated with
toxoplasmic retinochoroiditis, Invest. Ophthalmol. Vis. Sci. 49 (5) (2008)
1979–1982.
[19] C.A. Cordeiro, P.R. Moreira, T.F. Bessa, G.C. Costa, W.O. Dutra, W.R. Campos,
F. Orefice, L.H.L.H. Young, A.L. Teixeira, Interleukin-6 gene polymorphism (-174
G/C) is associated with toxoplasmic retinochoroiditis, Acta Ophthalmol. 91 (4)
(2013) e311–e314.
[20] C.A. Cordeiro, P.R. Moreira, G.C. Costa, W.O. Dutra, W.R. Campos, F. Orefice,
A.L. Teixeira, Interleukin-1 gene polymorphisms and toxoplasmic retinochoroiditis,
Mol. Vis. 14 (2008) 1845–1849.
[21] C.A. Cordeiro, P.R. Moreira, G.C. Costa, W.O. Dutra, W.R. Campos, F. Orefice,
A.L. Teixeira, TNF-alpha gene polymorphism (-308G/A) and toxoplasmic re-
tinochoroiditis, Br. J. Ophthalmol. 92 (7) (2008) 986–988.
[22] Y.R. Freund, G. Sgarlato, C.O. Jacob, Y. Suzuki, J.S. Remington, Polymorphisms in
the tumor necrosis factor alpha (TNF-alpha) gene correlate with murine resistance
to development of toxoplasmic encephalitis and with levels of TNF-alpha mRNA in
infected brain tissue, J. Exp. Med. 175 (3) (1992) 683–688.
[23] N.O. Dundar, P. Gencpinar, N. Sallakci, O. Duman, S. Haspolat, B. Anlar, O. Yegin,
Interleukin-12 (-1188) A/C and interferon-gamma (+874) A/T gene polymorph-
isms in subacute sclerosing panencephalitis patients, J. Neurovirol. 22 (5) (2016)
661–665.
[24] E. Eskandari-Nasab, M. Moghadampour, A. Asadi-Saghandi, E. Kharazi-Nejad,
A. Rezaeifar, H. Pourmasoumi, Levels of interleukin-(IL)-12p40 are markedly in-
creased in Brucellosis among patients with specific IL-12B genotypes, Scand. J.
Immunol. 78 (1) (2013) 85–91.
[25] M.B. Freidin, A.A. Rudko, O.V. Kolokolova, A.K. Strelis, V.P. Puzyrev, Association
between the 1188 A/C polymorphism in the human IL12B gene and Th1-mediated
infectious diseases, Int. J. Immunogenet. 33 (3) (2006) 231–232.
[26] C. Phawong, C. Ouma, P. Tangteerawatana, J. Thongshoob, T. Were,
Y. Mahakunkijcharoen, D. Wattanasirichaigoon, D.J. Perkins, S. Khusmith,
Haplotypes of IL12B promoter polymorphisms condition susceptibility to severe
malaria and functional changes in cytokine levels in Thai adults, Immunogenetics
62 (6) (2010) 345–356.
[27] W. Wujcicka, J. Wilczynski, E. Paradowska, M. Studzinska, D. Nowakowska, The
role of single nucleotide polymorphisms, contained in proinflammatory cytokine
genes, in the development of congenital infection with human cytomegalovirus in
fetuses and neonates, Microb. Pathog. 105 (2017) 106–116.
[28] A.R. de Sa, P.R. Moreira, G.M. Xavier, I. Sampaio, E. Kalapothakis, W.O. Dutra,
R.S. Gomez, Association of CD14, IL1B, IL6, IL10 and TNFA functional gene poly-
morphisms with symptomatic dental abscesses, Int. Endod. J. 40 (7) (2007)
W. Wujcicka et al.
563–572.
[29] Y. Gorgi, I. Sfar, R. Goucha, H. Aouadi, M. Amri, M. Makhlouf, R.T. Ben, M. Cherif,
S. Jendoubi-Ayed, A.T. Ben, K. Ayed, IL1/IL1 Ra, CTLA-4 and Apo1/Fas genes
polymorphisms and susceptibility to IgA nephropathy in Tunisian patients, Tunis.
Med. 88 (11) (2010) 789–793.
[30] N. Li, Z. He, J. Xu, F. Liu, S. Deng, H. Zhang, Association of PDE4D and IL-1 gene
polymorphism with ischemic stroke in a Han Chinese population, Brain Res. Bull.
(Arch. Am. Art) 81 (1) (2010) 38–42.
[31] R.C. Sobti, A.M. Salih, B. Nega, A.H. Seyed, K. Rupinder, K. Vijesh, W. Ajay, Insights
into the role of IL-12B and IFN-gamma cytokine gene polymorphisms in HIV-1/
AIDS infection, Folia Biol. 56 (3) (2010) 110–115.
[32] R. Assari, Y. Aghighi, V. Ziaee, M. Sadr, F. Rahmani, A. Rezaei, Z. Sadr,
M.H. Moradinejad, S.R. Raeeskarami, N. Rezaei, Pro-inflammatory cytokine single
nucleotide polymorphisms in Kawasaki disease, Int. J. Rheum. Dis (2016) 10–185X.
[33] G. Endler, R. Marculescu, P. Starkl, A. Binder, G. Geishofer, M. Muller, B. Zohrer,
B. Resch, W. Zenz, C. Mannhalter, Polymorphisms in the interleukin-1 gene cluster
in children and young adults with systemic meningococcemia, Clin. Chem. 52 (3)
(2006) 511–514.
[34] X.L. Huang, G.C. Wu, Y.J. Wang, X.K. Yang, G.J. Yang, J.H. Tao, Y. Duan, J.W. Yan,
X.P. Li, D.Q. Ye, J. Wang, Association of interleukin-1 family cytokines single nu-
cleotide polymorphisms with susceptibility to systemic sclerosis: an independent
case-control study and a meta-analysis, Immunol. Res. 64 (4) (2016) 1041–1052.
[35] S. Schulz, J.M. Stein, W. Altermann, J. Klapproth, U. Zimmermann, Y. Reichert,
C. Glaser, H.G. Schaller, S. Reichert, Single nucleotide polymorphisms in inter-
leukin-1 gene cluster and subgingival colonization with Aggregatibacter actino-
mycetemcomitans in patients with aggressive periodontitis, Hum. Immunol. 72 (10)
(2011) 940–946.
[36] F. Mohajertehran, A.J. Tavakkol, Z. Rezaieyazdi, N. Ghomian, Association of single
nucleotide polymorphisms in the human tumor necrosis factor-alpha and inter-
leukin 1-beta genes in patients with pre-eclampsia, Iran. J. Allergy, Asthma
Immunol. 11 (3) (2012) 224–229.
[37] M. Schmid, P. Haslinger, S. Stary, H. Leipold, C. Egarter, C. Grimm, Interleukin-1
beta gene polymorphisms and preterm birth, Eur. J. Obstet. Gynecol. Reprod. Biol.
165 (1) (2012) 33–36.
[38] D.Z. Chi, J. Chen, D.P. Huang, Influence of interleukin-1beta and interleukin-6 gene
polymorphisms on the development of acute pancreatitis, Genet. Mol. Res. 14 (1)
(2015) 975–980.
[39] C. Jing, J.Q. Zhang, Association between interleukin gene polymorphisms and risk
of recurrent oral ulceration, Genet. Mol. Res. 14 (2) (2015) 6838–6843.
[40] J.Y. Um, H.K. Rim, S.J. Kim, H.L. Kim, S.H. Hong, Functional polymorphism of IL-1
alpha and its potential role in obesity in humans and mice, PLoS One 6 (12) (2011)
e29524.
[41] R. Dominici, M. Cattaneo, G. Malferrari, D. Archi, C. Mariani, L.M. Grimaldi,
I. Biunno, Cloning and functional analysis of the allelic polymorphism in the
transcription regulatory region of interleukin-1 alpha, Immunogenetics 54 (2)
(2002) 82–86.
[42] T.L. McDowell, J.A. Symons, R. Ploski, O. Forre, G.W. Duff, A genetic association
between juvenile rheumatoid arthritis and a novel interleukin-1 alpha poly-
morphism, Arthritis Rheum. 38 (2) (1995) 221–228.
[43] S. Shirodaria, J. Smith, I.J. McKay, C.N. Kennett, F.J. Hughes, Polymorphisms in the
IL-1A gene are correlated with levels of interleukin-1alpha protein in gingival
crevicular fluid of teeth with severe periodontal disease, J. Dent. Res. 79 (11)
(2000) 1864–1869.
[44] J. Hulkkonen, P. Laippala, M. Hurme, A rare allele combination of the interleukin-1
gene complex is associated with high interleukin-1 beta plasma levels in healthy
292
Microbial Pathogenesis 121 (2018) 283–292
individuals, Eur. Cytokine Netw. 11 (2) (2000) 251–255.
[45] E.A. Gore, J.J. Sanders, J.P. Pandey, Y. Palesch, G.M. Galbraith, Interleukin-1beta
+3953 allele 2: association with disease status in adult periodontitis, J. Clin.
Periodontol. 25 (10) (1998) 781–785.
[46] F. Pociot, J. Molvig, L. Wogensen, H. Worsaae, J. Nerup, A TaqI polymorphism in
the human interleukin-1 beta (IL-1 beta) gene correlates with IL-1 beta secretion in
vitro, Eur. J. Clin. Invest. 22 (6) (1992) 396–402.
[47] R.E. Lyons, J.P. Anthony, D.J. Ferguson, N. Byrne, J. Alexander, F. Roberts,
C.W. Roberts, Immunological studies of chronic ocular toxoplasmosis: up-regulation
of major histocompatibility complex class I and transforming growth factor beta
and a protective role for interleukin-6, Infect. Immun. 69 (4) (2001) 2589–2595.
[48] H.W. Witola, E. Mui, A. Hargrave, S. Liu, M. Hypolite, A. Montpetit, P. Cavailles,
C. Bisanz, M.F. Cesbron-Delauw, G.J. Fournié, R. McLeod, NALP1 influences sus-
ceptibility to human congenital toxoplasmosis, proinflammatory cytokine response,
and fate of Toxoplasma gondii-infected monocytic cells, Infect. Immun. 79 (2)
(2011) 756–766.
[49] E.S. Marshall, H.M. Elshekiha, M.A. Hakimi, R.J. Flynn, Toxoplasma gondii per-
oxiredoxin promotes altered macrophage function, caspase-1-dependent IL-1beta
secretion enhances parasite replication, Vet. Res. (Paris) 42 (2011) 80.
[50] J.H. Yamamoto, A.L. Vallochi, C. Silveira, J.K. Filho, R.B. Nussenblatt, E. Cunha-
Neto, R.T. Gazzinelli, R. Belfort Jr., L.V. Rizzo, Discrimination between patients
with acquired toxoplasmosis and congenital toxoplasmosis on the basis of the im-
mune response to parasite antigens, J. Infect. Dis. 181 (6) (2000) 2018–2022.
[51] V. Asensi, C. Rego, A.H. Montes, J. Collazos, J.A. Carton, M.G. Castro, V. Alvarez,
C. Fernandez, J.A. Maradona, E. Valle-Garay, IL-1beta (+3954C/T) polymorphism
could protect human immunodeficiency virus (HIV)-infected patients on highly
active antiretroviral treatment (HAART) against lipodystrophic syndrome, Genet.
Med. 10 (3) (2008) 215–223.
[52] M.J. Nicklin, A. Weith, G.W. Duff, A physical map of the region encompassing the
human interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antago-
nist genes, Genomics 19 (2) (1994) 382–384.
[53] A. Ben Chaaben, M. Busson, H. Douik, W. Boukouaci, T. Mamoghli, L. Chaouch,
L. Harzallah, S. Dorra, C. Fortier, A. Ghanem, D. Charron, R. Krishnamoorthy,
F. Guemira, R. Tamouza, Association of IL-12p40 +1188 A/C polymorphism with
nasopharyngeal cancer risk and tumor extension, Tissue Antigens 78 (2) (2011)
148–151.
[54] C. Montoya-Ruiz, F.A. Jaimes, M.T. Rugeles, J.A. Lopez, G. Bedoya, P.A. Velilla,
Variants in LTA, TNF, IL1B and IL10 genes associated with the clinical course of
sepsis, Immunol. Res. 64 (5–6) (2016) 1168–1178.
[55] W.N. Gichohi-Wainaina, A. Melse-Boonstra, E.J. Feskens, A.Y. Demir,
J. Veenemans, H. Verhoef, Tumour necrosis factor allele variants and their asso-
ciation with the occurrence and severity of malaria in African children: a long-
itudinal study, Malar. J. 20 (14) (2015) 249.
[56] E. Eskandari-Nasab, M. Moghadampour, A. Sepanj-Nia, TNF-α -238, -308, -863
polymorphisms, and brucellosis infection, Hum. Immunol. 77 (1) (2016) 121–125.
[57] I. Sghaier, S. Zidi, L. Mouelhi, R. Dabbech, E. Ghazouani, E. Brochot, M. Stayoussef,
B. Yacoubi-Loueslati, The relationship between TNF alpha gene polymorphisms
(-238/-308),TNF RII VNTR(p75) and outcomes of hepatitis B virus infection in
Tunisian population, Gene 568 (2) (2015) 140–145.
[58] B. Mayer, B. Hemmens, Biosynthesis and action of nitric oxide in mammalian cells,
Trends Biochem. Sci. 22 (1997) 477–481.
[59] L.E. Neyer, G. Grunig, M. Fort, J.S. Remington, D. Rennick, C.A. Hunter, Role of
interleukin-10 in regulation of T-cell-dependent and T-cell independent mechan-
isms of resistance to Toxoplasma gondii, Infect. Immun. 65 (1997) 1675–1682.