Modifying Common Model Organism Saccharomyces cerevisiae to Identify and Find Potential

Genomic Patterns for Research

Erron Jones, Susan Wisener, L. Spence, and Henry Kusiak,

Abstract

In this experiment, the primary focus was to integrate a selection marker into the genome

of Saccharomyces cerevisiae, a model organism that goes by the name budding yeast, and

examine the localization of proteins in the genome, as well as test if the genome could be

manipulated correctly to provide some parts of the genome that could be worth researching. One

of the key mechanisms utilized in this experiment is the use of GFPs, otherwise known as green

fluorescent proteins. Many techniques involving PCR, transformation, electrophoresis, and

others were utilized to correctly modify the yeast cells and analyze the genome that was

manipulated using GFPs. Many other tests were done throughout the entire experiment to ensure

that results were accurately being recorded, and techniques were being correctly employed. The

enzyme that was found to be closest to the site of modification in the genome was identified as

the part of the S. cerevisiae genome that codes for the PRE2 subunit of a 20S proteasome and is

specifically responsible for degrading protein substrates that are damaged or no longer needed.

This experiment showed how most research into particular parts of cellular organisms is

undergone, especially when most information regarding these parts resides in the genome of the

organism. Using this experiment, the process of finding and researching less known parts of

living things can be repeated, and more can be known about the cellular organisms of this planet.
Introduction

Throughout the course of five weeks, the experiment involved hands on research with

modifying the genome of organisms, and finding pieces of DNA sequences that can be labeled as

valuable knowledge in the science field. In the case of identifying these lesser known regions,

GFP proteins were used in order to confirm whether the organism had been correctly modified or

not. GFP proteins are involved in a wide array of sciences, with one of the most being

microbiology. It is mainly used as a fluorescent tag for parts of a gene that are being expressed,

as well as the localization of proteins, among other qualities of microorganisms (Chudakov,

Lukyanov, 2003). To first modify S. cerevisiae, the cells had to undergo transformation.

Transformation is a process by which the genes of a particular strand of DNA are altered in some

way by foreign DNA being integrated into the genome of the cell. This method of modifying has

been seen in many different forms of microbial study. For example, a certain toxin called

trichothecene mycotoxin was found to be present in many brands of cereal in the early 2000s, so

scientists used bacterium found in the general biota of catfish, named microbial culture C133,

and found that they could transform the bacteria to digest this mycotoxin in the industry line

(Guan, et al., 2009). PCR, or polymerase chain reaction, was also a technique used to the

extraction and modification of S. cerevisiae and its genome. PCR is a very applicable tool in the

field of microbiology as well, as many experiments and much of research involves PCR to

analyze the sequences of the genome found within the organism, what genes are or are not

expressed, and, in the case of this experiment, to modify the genes to study more about the

expression going on inside of the cell (Mengoli, 2009). The main purpose of this experiment was

to correctly modify the genes found within a microorganism, specifically S. cerevisiae, and with
that information, learn more about the genome of the organism, and open up avenues of research

for areas of DNA that are not as well known as others in S. cerevisiae.

Materials & Procedures

A. Genetics of Yeast and their Transformation

In the first laboratory segment of this experiment, DNA samples were retrieved from the model

organism Saccharomyces cerevisiae, or budding yeast, to be manipulated and analyzed

throughout the extent of this experiment. First, small amounts of S. cerevisiae cells were

inoculated into a culture of YPD, which is a media that is specific to yeast. This culture was then

left overnight in 30° Celsius (C) while shaking to grow into a stationary phase. Following the

dilution of the culture that had grown overnight to a 1:20 dilution, a spectrophotometer was

utilized in order to calculate an accurate OD600, or optical density value of the sample. Using

calculations to estimate the OD600 of the sample, a new 50 mL YPD sample, with an OD600 value

of 0.38 was inoculated. This sample was then set in 30° C for four hours with shaking until an

optical density of 1.0 was reached. The culture was then spun, resulting in a cell pellet which was

washed using sterile water. The pellet was resuspended in a 100mM LiAc solution measuring at

1mL, and then ran in a microcentrifuge for 15 seconds at top speed, pelleting the cells again. The

LiAc portion of the solution was removed, and the pellet were resuspended with 100mM LiAC,

measuring 500μL. This process was repeated to yield 1 mL of this sample. Ten groups were then

given two tubes with measurements of 50 μL of the sample for the experiment. One tube was

labeled and marked as a negative control, and the other as the experimental sample. The samples
were then stored properly until the next laboratory period to continue. Next, the samples were

pelleted at top speed, which is 13,200 rpm, in a microcentrifuge for 15 seconds. After, the

supernatant was removed. 240 μL of PEG at approximately 50% concentration was added to

both samples. LiAc with a volume of 36 μL, and concentration of 1.0 M was also added, as well

as ssDNA measuring at a volume of 5 μL. DNA fragment sample measuring at 70 μL was then

added to the experimental tube, and sterile water of a similar volume was added to the negative

control. The mixes were vortexed for approximately one minute, or until the pellet was

dispersed. The tubes were then incubated at 30° C for 30 minutes, followed by a heat shock at

42° C for 25 minutes. The samples were then spun for 15 seconds in a microcentrifuge at a speed

of 6,000 rpm, and the transformation mix left was removed with disturbing the cell pellet. Sterile

water measuring 200 μL was added to each sample. Using a pipette, water was plunged up and

down in the tube until the cell pellet was resuspended. Next, two plates lacking histidine were

retrieved and labeled appropriately, and both tubes were poured onto their corresponding plates.

Inoculating beads were then used to mix the sample around on the plates, and discarded

afterwards. Plates were then stored for a few days in a 30° C environment, which allowed

colonies to populate on the plate. The lab instructor then streaked colonies onto new plates for

the next laboratory session.

B. DNA Extraction

In this next part of the experiment, DNA was extracted from the cells to allow the genes to be

subject to manipulation and insertion of a selection marker. In this case, the selection marker was

GFP. First, plates were retrieved, and pictures of the plates, as well as the number of colonies

found on the plates was recorded for results. Two Eppendorf tubes measuring at 1.5 mL in

volume were given to each group and labeled accordingly. The tubes contained extraction buffer
measuring at a volume of 100 μL. Using the sterile wooden end of a laboratory cotton swab, a

small amount of cells were swabbed from the plate sample and added to each Eppendorf tube.

Glass beads, approximately a scoopful, were then added to each tube. While wearing gloves,

Phenol-CHCl3 measuring at 100 μL was pipetted into both tubes. The samples were then

vortexed for two minutes on high, followed by being centrifuged for five minutes at 13,200 rpm

to pellet the contents of the cell. The tubes were then removed without disturbing the pellets, and

the supernatants measuring at 15 μL were pipetted into fresh Eppendorf tubes with volumes of

500 μL. The two tube samples were then stored for the next segment in the following week.

C. PCR Synthesis of DNA

This section of the experiment involved the cutting and integration of our selection marker into

the genome of S. cerevisiae, as well as the creation of an agarose gel for the following laboratory

session. Before this session could start, Master Mixes were created for both samples. For one

group, the Master Mix #1 consisted of 41.25 μL of ddH2O, 5 μL of 10x Taq Buffer, 1 μL of

forward primer, 1 μL of reverse primer #1, 1 μL of 10mM dNTPs, and 0.25 μL of Taq

Polymerase. All ingredients account for one sample, and as there are four samples that require

Master Mix #1, the materials were multiplied by five. A 2nd Master Mix (Master Mix #2) was

also created for the Knock-In PCR. Master Mix #2 had the same list of materials and

concentrations as Master Mix #1 with one difference, as Master Mix #2 required reverse primer

2, unlike Master Mix #1, which required reverse primer 1. Once the master mixes are made, the

tubes are flicked to ensure the mixes were mixed, as the Taq polymerase comes in a glycerol

solution, causing it to have a tendency to sink to the bottom of water-based solutions. To prevent

any material being lost in the sides of the tubes, the tubes were centrifuged at 3,000 rpm for 10

seconds to ensure that all the mixed material was gathered in the bottom of the tube. Next, 49.5
μL of each corresponding Master Mix went into each Knock-In, or Wild Type, PCR sample.

Next, the DNA samples according to their type (Knock-In/Wild-Type) are added, measuring 0.5

μL, to each corresponding PCR sample tube. In the negative control tubes, water was added in

place of DNA sample. Tubes are then flicked to ensure that solutions are mixed. Afterwards, the

tubes are placed into a thermal cycler, and the “Taq Polymerase” program is initiated. The PCR

samples were then placed in a freezer by the instructor after the program had finished to keep

them stored for the next segment. To prepare for the next laboratory segment of this experiment,

an agarose gel was created as well. First, 1.0 g of agarose was dissolved in a solution of 1X TAE

measuring 100 mL in an Erlenmeyer flask measuring 500 mL. This made a 1% agarose solution

that was needed for the next step. Next, the solution was heated in the microwave to dissolve the

agarose. The solution had to be watched very carefully, as the solution could start boiling over at

random times. Once the solution started to boil, the microwave was turned off, the solution was

swirled, and it was then put back into the microwave to restart the heating process. This cycle

was done until all agarose granules had been dissolved into the solution. Next, a sealed casting

tray was prepared an agarose gel. Combs were then placed in the gel to create wells for the DNA

samples to be dropped into. Once the casting tray was sealed, and the combs were in place, the

solution was then poured into the casting tray.

D. Sequencing of DNA and Electrophoresis

This segment was carried out in order to safely prove whether the genome in the experiment’s

yeast samples had been modified, and to observe the size of DNA fragments in the yeast

samples. First, the 1% agarose gels made from the last laboratory section were submerged in a

running buffer called 1X TAE. A loading buffer measuring approximately 43 μL was put onto a

small piece of parafilm, and 5 μL were taken and added to each sample. A ladder sample
measuring 5 μL was also added to the parafilm, and another 1 μL of loading buffer was allocated

to this. Next, the samples were loaded into the gel wells, and a gel map was made and recorded

in notebooks to keep track of each sample’s observations and results. Once all samples were

loaded, the case was covered, and the electrodes were attached to their proper positions. The gels

were then ran for 25 minutes at 110 volts. Afterwards, the power supply was turned off, and gels

were extracted to view under a UV illuminator. Results of bands were then recorded for results

and discussion. Next, the DNA sample band that was selected (the one with the best results) was

extracted from the gel using a razor blade. The gel slice was then placed into a microcentrifuge

tube with a volume of 1.5 mL, and 500 μL of DF Buffer was added. The tube was then placed

into a warm water bath approximately 55° C for 10 minutes. This step was to dissolve the

agarose to allow the DNA sample to mix in with the rest of the solution. The tube was also

inverted at 3 minutes, 6 minutes, and 9 minutes in this step. Next, the sample was allowed to cool

to room temperature before being transferred into a DF column. The mixture was set in a

microcentrifuge for 30 seconds at top speed, and the flow through was discarded. Wash Buffer

measuring at 600 μL was then added, and the sample sat for 60 seconds. The sample was then set

into a microcentrifuge for 30 seconds at top speed again, and the flow through was discarded.

The DF column was then dried by setting in a microcentrifuge, and being spun for 3 minutes at

top speed. The column was then moved to fresh centrifuge tube with a volume of 1.5 mL.

Elution Buffer measured at a volume of 30 μL was added to the matrix of the column, and then

sat for 2 minutes. Finally, the sample was placed into a microcentrifuge and ran for 2 minutes at

top speed, and the DNA samples were collected at the bottom of the tube. With the final part of

this lab segment, the sample needed to be sent in for testing to observe the genome of the

samples collected. A nanodrop was utilized in this step of the experiment. 1 μL of DNA sample
was placed onto the pedestal of the Nanodrop. The A260/A280 ratio, as well as the ng/μL

concentration was recorded in the notebooks for results and discussion. The nanodrop was then

cleaned with chem wipes. Since the company used (Genewiz) needed a specific concentration

(ng/μL), the volume needed in the samples to send in was then calculated and added to send-off

samples to maintain a specific needed concentration of DNA, as well as sample volume, and then

the sample was given to the instructor to send off to Genewiz for sequencing and results.

E. Fluorescent Microscopy and Sequencing Analysis

In this final segment of the experiment, using the results that were sent back from the DNA

Saccharomyces cerevisiae genomes that were sent in to Genewiz for analysis, proteins and

sequences used in the creation of certain enzymes and functional proteins that were found around

the area that was modified and manipulated were studied more intensely to see what other kinds

of enzymes and proteins there are in a yeast cell. First, after receiving the DNA nucleotide

sequence back from analysis, the sequence was copied and pasted into an “Enter Query

Sequence” text box, and the genome was “BLASTED.” This showed what kinds of pieces in the

genome of the sample were found to be around the site of modification with the GFP protein, and

this was where most of the results for this experiment were recorded. After viewing the analysis

of the DNA nucleotide sequence, fluorescent microscopy was utilized to see a visual

representation of evidence of modified yeast cells. After the instructor had spread parts of the

sample onto a petri dish and incubated them, the samples were then used to make droplets of the

yeast cells on slides to view under a fluorescent microscope. The results of both the proteins

found around the site of modification, as well as the results of the fluorescent microscopy portion

were recorded for results and discussion.

Results

In reference to the results of this experiment, parts of notable results include the

A260/A280 ratio recorded, the presence of yeast growth on transformation plates, and the

concentration of DNA in ng/μL in the electrophoresis and sequencing of DNA portion of the

experiment, as well as the main results of this entire experiment, including the fluorescent

microscopy visual, the nucleotide sequence of the DNA sample sent in to Genewiz, and the band

results for the Wild-Type and Knock-In PCR samples.

In the segment of the experiment involving the transformation of a yeast cell on

transformation plates, the results that were recorded had two separate outcomes based on the

plates. The transformation, or experimental plate, yielded a result of some growth from the yeast

cells on the plates. On the negative plate, there was no evidence of growth, indicating that there

was no contamination within this portion of the experiment.

Figure 1: Presence and Absence of Yeast Growth on Plates.

In the left image, “T” represented the word test, indicating that
it was the experimental plate. The experimental plate was
visually reported as having colonies, while the negative control
plate on the right reportedly had no colonies. As this was one
of the checks throughout the experiment, the results of this one
shows a successful inquiry.
 In the segment of the experiment involving electrophoresis of the samples in agarose

gels, and the sequencing of DNA, the results gathered yielded some positive results, however the

test was still very much inconclusive. The gels were placed under a UV illuminator, and the

results were recorded visually. The sample illuminated was also compared to a DNA Ladder, and

the Wild-Type and Knock-In PCR samples that had visual samples were recorded.

Figure 2: Agarose gel containing Wild-Type and Knock-In

PCR samples under UV illumination. This visual record of
results shows there are some results, however they are very
vague. It is recorded that there are bands found in the WT-A,
KI-A, and KI-C samples, however no other results were able to
be recorded. One large piece of evidence to support the idea
that a defective micropipette caused the error is the fact that the
DNA ladder for comparison also looked very vague near the
end of the ladder.
Figure 3: DNA Ladder used to compare
DNA segments bands in electrophoresis.
This image was provided by the instructor in
the experiment in order to aid the identification
of size of fragments inside of each sample, as
well as allowing samples to be compared to
each other.

Figure 4: DNA sample gel map. This figure

was recorded to keep track of what sample
yielded what results in the agarose gel
electrophoresis segment of the experiment.
 Along with the DNA band results of the Knock-In PCR and Wild-Type PCR, the

A260/A280 ratio recorded was 2.47, and the concentration of DNA in the sample was 23.8

ng/μL.

In addition to discovering the sequence of the DNA that was modified, the samples of

yeast that had been inoculated by the instructor in the last segment of the lab were observed

under a brightfield microscope, as well as a fluorescence microscope, and the same locale was

compared to see if manipulation of yeast DNA had been achieved.

Figure 5: Brightfield microscope sample

compared to fluorescent image of same
locale. These images are of the same locale of
cells inoculated on a slide for comparison.
This was to prove whether the genome of the
yeast cell in the sample had been manipulated
correctly or not.
 Lastly, after sending off the DNA sample for sequencing the genome of the yeast cells

observed in the sample, the following DNA sequence was the result:

NNNNNNNNNNNNNGCNNNNNNNNNNANTACTGGCTGGATTACGCAATCCACTCCTG
ATGCAAGCTATTGCCGATAGTTTCAGTGTACCAAACAGATTGGTTAAGGAACTTCAATAT
GACAACGAACAAAACTTAGAGAGCGATTTCGTAACGGGCGCCTCCCAGTTTCAACGTTT
GGCACCATCGCTTACGGTTCCACCAATTGCGTCTCCACAGCAGTTTTTAAGAGCACACAC
AGATGATTCACGAAACCCAGACTGTAAAATCAAGATCGCAC ATGGTACTACGT
Figure 6: Finalized nucleotide sequence
received from Genewiz. This string of
nucleotides in the sequence was most
commonly found inside of the DNA sample
that was sent in for analysis to Genewiz. It
showed a relatively high query coverage of
80%, and some parts of the 20% can be
contributed to the known nucleotides denoted
as “N.” The nucleotides highlighted in blue
represent a part of the genome that codes for a
certain functionality in the cell, and this part
was the closest to the piece of DNA that was
manipulated in the yeast cell. The blue
highlighted nucleotides code for PRE2, a small
subunit that is part of the 20S proteasome.

Discussion/Conclusion

When mentioning or recording many of the results found within this experiment, many of

them are only referring to a “check” that needs to be made in order to go to the next step of the

experiment. There was only one error throughout the duration of the experiment, but the error

seemed to be apparent in every aspect of the experiment from the discovery to the end of the

experiment. In the electrophoresis segment of the experiment, many of the bands in the gel were

not apparent, or were extremely vague and dim. Before these results had been recorded, it was

speculated that there seemed to be an error with one of the micropipettes that were being utilized.

All of the samples inserted into the gel wells seemed to have more volume of liquid than they
should have, and normally, the loading sequence in the electrophoresis wells would have left

approximately 2 μL of loading buffer as a check that the correct amount loading buffer was

aliquoted into each sample. However, the loading buffer was gone by the time the last sample

was ready to get loading buffer. Also this was a very large error in the electrophoresis portion of

the experiment, the problem was bypassed by using a third Knock-In PCR sample labeled “KI-

C.” This sample was pre-made and provided by the instructor to ensure that the gel had been

created properly, and to compare against the ladder that was loaded into the gel as well. KI-C

was the sample that was substituted in place of any other sample, as it seemed that all other

samples had been diluted. This could also point to why the concentration of DNA in ng/μL was

still low, even after using a sample that proved extremely viable in electrophoresis, such as KI-C.

One of the main ideas of this experiment was to see if, and learn how an organism could

be modified in the laboratory setting. The main part of the experiment that showed the results for

this question came with the brightfield microscopy image and fluorescent microscopy image of

the same locale on a slide containing living cells of the sample analyzed. In the pictures, it could

be recognized that the cells did in fact have a green glow, indicating that the modification of the

genome of S. cerevisiae was successful. It was also worth noting that the glow from the

integrated GFP proteins came from the storage facilities of the yeast cells, or vacuoles, as that is

where most of the proteasomes are located within the cell, and the 20S proteasome was the

closest part of the genome to the integrated GFP protein DNA sequence.

The nucleotide DNA sequence retrieved from analysis proved to be a pretty likely match

to that of S. cerevisiae S288C, as the query coverage was at 80%, and the percentage identity

was recorded as 100%. A good reason for why the query coverage did not completely line up

with that of the full genome of S. cerevisiae is most likely due to the amount of unknown
nucleotides found within the nucleotide DNA sequence retrieved, as unknown nucleotides are

simply denoted as “N.” The closest part of the genome to the modified site of the GFP addition

found within the S. cerevisiae was a genome labeled “PRE2,” and is responsible for the creation

of the PRE2 subunit of a 20S proteasome. This proteasome has many functions within the cell

but is mainly utilized to degrade and break down unwanted proteins and enzymes, or substrates

that are too high in abundance within the cell.

Conclusion

According to all results and discussions mentioned and recorded throughout the duration

of this experiment, one can infer that this experiment was successful in snipping and modifying

the DNA genome of model organism Saccharomyces cerevisiae. Because of this integration and

analysis, it was discovered that the closest piece of DNA to the site of modification was a piece

of the DNA that has not been previously researched thoroughly, and can not only provide insight

to this particular piece of the genome, but the research of the genome as a whole in general. With

regards to the query coverage, as well as the brightfield microscopy and fluorescent microscopy

comparison, it can safely be concluded that manipulation of an organism was successful, and that

much of the understanding of these types of organisms are still waiting to be discovered.
 Bibliography

Burris, Alicia. “Genetics Biology Lab.” Labs 1-5, Genetics BIO 0305-01, Missouri Southern

State University, Joplin, Missouri, Jan-Mar 2023.

Chudakov, D M, and K A Lukyanov. “Use of green fluorescent protein (GFP) and its homologs

for in vivo protein motility studies.” Biochemistry. Biokhimiia vol. 68,9 (September

2003): 952-7. doi:10.1023/a:1026048109654, Accessed 19 Jan, 2023.

Guan, Shu, et al. “Transformation of Trichothecene Mycotoxins by Microorganisms from Fish

Digesta.” Aquaculture, vol. 290, no. 3-4, 19 May 2009, pp. 290–295.,

https://doi.org/10.1016/j.aquaculture.2009.02.037., Accessed 1 February, 2023.

Mengoli, Carlo, et al. “Use of PCR for Diagnosis of Invasive Aspergillosis: Systematic Review

and Meta-Analysis.” The Lancet Infectious Diseases, vol. 9, no. 2, Feb. 2009, pp. 89–96.,

https://doi.org/10.1016/s1473-3099(09)70019-2.