International Biodeterioration & Biodegradation 97 (2015) 90e96

Contents lists available at ScienceDirect

International Biodeterioration & Biodegradation

journal homepage: www.elsevier.com/locate/ibiod

A Bacillus subtilis strain can reduce hexavalent chromium to trivalent

and an nfrA gene is involved
Zhe Zheng 1, Yabo Li 1, Xiaowei Zhang, Pu Liu, Jun Ren, Gaofeng Wu, Yanli Zhang,
Yong Chen, Xiangkai Li*
Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Tianshuinanlu #222, Lanzhou, Gansu 730000, PR China

a r t i c l e i n f o a b s t r a c t

Article history: Baiyin city, which is located upstream of the Yellow River and in the central part of Gansu province,
Received 5 September 2014 China, is severely contaminated by heavy metals such as chromium. A Gram-positive bacterium BYCr-1
Received in revised form capable of reducing hexavalent chromium (Cr(VI)) to trivalent (Cr(III)) aerobically was isolated from a
9 October 2014
rare-earth ore in Baiyin, Gansu, China. 16S rRNA analysis revealed that it was closely related to Bacillus
Accepted 31 October 2014
Available online
subtilis. It can reduce 0.2 mM Cr(VI) to Cr(III) in M9 medium after 48 h incubation. Transmission electron
microscopy (TEM) image showed that Cr(III) precipitates were located both inside and outside the cells.
An nfrA gene was upregulated by 5.3 folds upon Cr(VI) treatment. Furthermore, E. coli-NfrA demon-
Keywords:
Bacillus
strated elevated chromate-reducing ability. Our results indicate that BYCr-1 is able to resist and reduce
Bioremediation high concentrations of Cr(VI), which makes it a potentially suitable candidate for bioremediation of
nfrA Cr(VI) contamination. This study also reveals that nfrA confers Cr(VI)-reducing ability in Bacillus subtilis.
Chromium © 2014 Elsevier Ltd. All rights reserved.
Rare-earth ore

Introduction
Baiyin city, the biggest rare-earth ore refining site of China in
1990s, is located upstream of the Yellow River and in the central
part of Gansu province, China. Rare earth and nonferrous metals are
important industrial elements used in metallurgy, petroleum,
chemical engineering, light textile, pharmaceuticals industry and
agriculture (Jones et al., 1996). Current methods of rare and
nonferrous metal refining involve acids wash which result in heavy
metal contaminations (Murase et al., 1995). Previous study revealed
that the concentrations of heavy metals in contaminated area near
rare-earth and nonferrous metal ores of Baiyin city exceeded the
discharging standard of pollutants for municipal wastewater
treatment plant in China (Nan and Zhao, 2000).
Chromium, widely used in paints and pigments, leather, metal
plating, and wood preservation, is one of the major heavy metal
contaminants from the metal ores of Baiyin city. In natural envi-
ronment, chromium exists in two stable oxidation states:
* Corresponding author. Tel.: þ86 931 8912561; fax: þ86 931 8912560.
E-mail addresses: zhengzh12@lzu.edu.cn (Z. Zheng), liyb11@lzu.edu.cn (Y. Li),
smile19880726@gmail.com (X. Zhang), liupu@lzu.edu.cn (P. Liu), renj13@lzu.edu.
cn (J. Ren), wugf12@lzu.edu.cn (G. Wu), zhangyanli12@lzu.edu.cn (Y. Zhang),
chenyong@lzu.edu.cn (Y. Chen), xkli@lzu.edu.cn (X. Li).
1
These authors contributed equally to this work.
hexavalent and trivalent (Cervantes, 1991). Cr(III) is far less toxic
than Cr(VI) because of its lower solubility, mobility, mutagenicity
and carcinogenicity (Enterline, 1974; Petrilli and De Flora, 1977;
Gibb et al., 2000). Hence reducing Cr(VI) to Cr(III) is a reasonable
method to control chromate contamination. Conventional tech-
niques for chromate reduction include ion exchange, electro-
chemical methods, and photocatalytic reduction (Rengaraj et al.,
2001; Barrera-Díaz et al., 2012). However, these chemical
methods cannot be applied at a large scale because of their high
cost and subsequent secondary contamination. In recent years,
bioremediation of chromate contamination has been widely re-
ported (Garbisu et al., 1998). Reduction of chromate by bacteria is
an efficient and environmental friendly strategy to solve chromate
pollution. A number of chromium-resistant micro-organisms able
to detoxify hexavalent chromium have been reported such as
Pseudomonas (Bopp and Ehrlich, 1988), Leucobacter (Zhu et al.,
2008), Streptomyces (Poopal and Laxman, 2008), Brucella (Thacker
et al., 2007), Bacillus (Garbisu et al., 1998), Intrasporangium (Yang
et al., 2009), Thermus (Balkwill et al., 2004), Escherichia (Wang
and Shen, 1997), Shewanella (Myers et al., 2000), Enterobacter
(Wang et al., 1989) and Desulfovibrio strains (Lovley and Phillips,
1994). Bacteria can reduce Cr(VI) under both aerobic and anaer-
obic conditions (McLean and Beveridge, 2001). Under anaerobic
condition, chromate reduction is thought to be catalyzed by soluble
enzymes inside or outside of cytoplasmic membrane (Campos-

http://dx.doi.org/10.1016/j.ibiod.2014.10.017
0964-8305/© 2014 Elsevier Ltd. All rights reserved.
 Z. Zheng et al. / International Biodeterioration & Biodegradation 97 (2015) 90e96
Garcia et al., 1997), and Cr(VI) is used as an alternative electron
acceptor in electron transport chain (Bencheikh-Latmani et al.,
2005). .
Among the reported Cr(VI) reductases, such as flavinoxidor-
eductase, nitroreductase, dehydrogenase and quinoneoxidor-
eductase (Park et al., 2000, 2001; Kwak et al., 2003; Ackerley et al.,
2004a,b), several were confirmed including chromate reductase
(ChrR) in Pseudomonas putita, flavoprotein (YieF) and Oxygen-
insensitive NADPH nitroreductase (NfsA) in Escherichia coli
(Ackerley et al., 2004a,b). NfrA, a soluble enzyme from Bacillus
subtilis, is closely related to FMN-containing NADPH-linked nitro/
flavinreductase. It is encoded by an nfrA gene and has high simi-
larity with NfsA in E. coli and an NAD(P)H-dependent Cr(VI)
reductase in Pseudomonas ambigua (Suzuki et al., 1992; ZENNO
et al., 1998). Previous studies revealed that NfsA is able to reduce
Cr(VI) to Cr(III) (Ackerley et al., 2004a,b), but no evidence has yet
shown that NfrA participates in the chromate reduction in
B. subtilis.
In this study, we isolated a Bacillus strain which can reduce
Cr(VI) from heavy metal-contaminated soil in Baiyin. We also found
that nfrA contributed to Cr(VI) reduction in the isolated strain. The
factors affecting chromate reduction (pH, temperature) were
evaluated and the roles of nfrA in Cr(VI) reduction were further
investigated.
Materials and methods
Bacterial isolates and culture conditions
The bacterium (named as BYCr-1) in this work was isolated from
the soil of rare-earth mine in Baiyin of China which was contami-
nated with heavy metals. The latitude and longitude of the sam-
pling site is 35 330 N 103 30 E. The soil sample was obtained from
15 cm below surface horizon and stored at -4  C. The pH of the soil
was range from 5.5 to 6.5. BYCr-1 was obtained in shaken culture in
the M9 medium with the following content: Na2HPO4, 6.0 g l1;
KH2PO4, 3.0 g l1; NH4Cl, 1.0 g l1; yeast extract, 2 g l1; MgSO4,
0.24 g l1; glucose, 2 g l1. The pH of M9 medium was adjusted to
7.4 by NaOH.
Cr(VI) analysis
The concentration of Cr(VI) was measured by the diphe-
nylcarbazide method (Eaton and Franson, 2005). The standard
curve of hexavalent chromium was constructed under different
concentration of Cr(VI) (0.1e0.5 mM). The R2 value is 0.9975. The
bacteria were removed from liquid fraction by centrifugation at
13,000 g for 2 min. Cr(VI) in the supernatant was measured by the
method mentioned above. The sterile M9 medium without Cr(VI)
was used as control.
Identification of the isolated strain
BYCr-1 was identified by the Biolog tests and 16S rRNA anal-
ysis. Gram staining of BYCr-1 was carried out using standard
methods. Genomic DNA extraction from BYCr-1 was done as
described by Ausubel (Ausubel et al., 1994). Universal bacterial
16S rDNA gene primers 1492R and 27F were used to amplify 16S
rDNA fragment. The PCR products were purified by 2% agarose
gel electrophoresis and DNA Gel Extraction Kit (AXYGEN Inc.,
China). Purified PCR products were cloned in pUM-T vector
(Bioteke, Beijing, China) and transferred into E. coli. DH5a. The
positive clone was sequenced (Majorbio Bio-pharm Technology
Co., Shanghai, China). The sequenced 16S rRNA gene was
analyzed using the BLASTn searching tools (NCBI) and
91
corresponding sequences were downloaded. Phylogenetic tree
was constructed by the neighbor-joining method in MEGA
package version 4. The sequence was deposited at GenBank with
accession number KF998584.
Chromate resistance and reduction test
Exponential phase cultures of BYCr-1 were diluted 1:100 in M9
medium (5 ml) supplemented with different concentrations
(1e20 mM) of Cr(VI) and incubated with shaking at 37  C, 180 rpm
for 48 h. The OD600 values were then determined by UVevis
spectrophotometer (SUNNY HENGPING, China). For the chromate
reduction assay, BYGr-1 was inoculated in M9 medium with 0.2 mM
Cr(VI). The chromate-reducing capacity of BYCr-1 was tested in M9
medium supplemented with 0.2 mM Cr(VI) because of this con-
centration did not influence the growth of BYCr-1. The mixture was
then incubated at 37  C, 180 rpm for 48 h. During the 48 h incu-
bation period, the cell density (as measured by optical density at
600 nm) and the Cr(VI) concentration was measured. Because the
MIC of BYCr-1 to ampicillin is 0.13 mg l1, the mixture added
0.2 mg l1 ampicillin was used as abiotic control. The MIC of BYCr-1
to ampicillin was measured in M9 medium supplemented with
different concentrations (0.1e1 mg l1) of ampicillin. The factors
affecting reduction of Cr(VI) included temperature, pH and Cr(VI)
concentration were determined. The effect of temperature was
investigated in different temperature ranged from 23  C to 42  C at
pH 7, 0.2 mM Cr(VI) in M9 medium. The medium inoculated with
BYCr-1 was incubated at 180 rpm for 60 h. The effect of pH was
researched in different pH(5, 6, 7, 8, 9) at 37  C,0.2 mM Cr(VI). The
pH was adjusted by 1 mM NaOH and HCl. As for confirming the
optimum temperature and optimum pH, Colony-Forming Units
(CFU) was measured after cultivating isolated strains until the
growth of bacteria reached to stationary phases. The reduction of
Cr(VI) was measured every 6 h. All assays were carried out in
triplicate.
The resting cell assay
Cell suspension of BYCr-1 was prepared by harvesting cells in
their late logarithmic phase after 12 h of incubation. The cells
were harvested by centrifugation at 10,000 g, 2 min and 4  C.The
obtained cells then were washed twice using 0.85% NaCl solu-
tion. The cells were added in 0.85% NaCl solution with 0.2 mM
Cr(VI) and 1% NADPH until the OD600 value was 1.2. The Cr(VI)
concentration in supernatant was measured after 6 h. Then the
cell pellets were treated with lysozyme at 37  C for 30 min and
at 95  C for 15 min so that absorbed Cr(VI) could be determined.
The reoxidation of reduced Cr(VI) was carried out to determine
the concentration of Cr(III) according the method reported pre-
viously (Zhang et al., 2013). E. coli BL21 (DE3) was used as
control.
Transmission electron microscopy and energy dispersive X-ray
analysis (TEM-EDXA)
The cells incubated in the M9 medium with 0.2 mM Cr(VI) under
37  C, 180 rpm for 12 h were collected for TEM observation. The
harvested cells were fixed in 2.5% glutaraldehyde. The cells were
then dehydrated in ethanol series and embedded in epoxy resin.
The embedded cells were sectioned on an ultramicrotome. Electron
micrographs were taken using a Tecnai™G2F30 TEM (FEI, America)
operating at 100 kV. Elemental analysis was performed by an en-
ergy dispersive X-ray spectroscopy (EDS) (FEI, America). The cells
without Cr(VI) were used as control.
92 Z. Zheng et al. / International Biodeterioration & Biodegradation 97 (2015) 90e96

Table 1 products were cloned into pET-30a as follows. The pET-30a vector
Primers used in this study. was digested with BamH Ⅰ and SalⅠfollowing the manufacturer
Primer Sequence (50 to 30 ) Description protocol. The cohesive-ended PCR products were ligated into
27F AGAGTTTGATCCTGGCTCAG Amplify 16S rDNA gene
digested pET-30a. Then the reconstructed plasmids were trans-
1492R GGTTACCTTGTTACGACTT Amplify 16S rDNA gene ferred into E. coli BL21 (DE3). The positive clone was sequenced.
NfrAB-F TAGGATCCATGAATAACACAATCGAAACCAT Construct pET-30a E. coli BL21 (DE3) containing reconstructed plasmids (E.coli-NfrA)
NfrAS-R GCGTCGACTTAGTTTTTATTAAAGCCCTTTTC Construct pET-30a was inoculated in M9 medium with 0.2 mM Cr(VI) and 1 mM IPTG
Primers for qRT-PCR and then incubated at 37  C, 180 rpm. The cell density and Cr(VI)
Primer Sequence (50 to 30 ) Gene concentration were measured every 6 h. E. coli BL21 (DE3) con-
taining empty pET-30a (E. coli-pET-30a) was chosen as control. The
16SeF CCTGTAAGACTGGGATAACT 16S rDNA
16S-R GTAAGTGGTAGCCGAAGCCA 16S rDNA
resting cell assays of E. coli-pET-30a and E.coli-NfrA were carried
NfrA-F TCCAGCTATGTGCAGGCATA nfrA out according to the method described above.
NfrA-R TCTTCTCAACGTAAGGCTGA nfrA

SDS-PAGE and western blotting

RNA isolation and reverse transcription-PCR (RT- PCR)
E.coli-NfrA and E. coli-pET-30a were inoculated in M9 medium
Total RNA was extracted from BYCr-1 cells grown for 3 h in the with 0.2 mM Cr(VI) and 1 mM IPTG and then incubated at 37  C,
absence and presence of the 0.2 mM K2CrO4 in M9 medium by 180 rpm for 6 h. The cells were harvested by centrifugation at
using SV Total RNA Isolation System (Promega, USA). First-Strand 10000 g, 2 min and 4  C.The obtained cells then were washed twice
cDNA Synthesis was completed using PrimeScript™RT reagent Kit by PBS. Total solution proteins were extracted using bacterial pro-
(TaKaRa, Dalian, China) followed by PCR. The PCR program was as tein extraction kit (CWBIO, China). Protein extracts were electro-
follows: 37  C, 15 min; 85  C, 5sec. Reverse transcriptase PCR phoretically resolved on 15% SDS-PAGE and then stained with
products were examined by 2% agarose gel electrophoresis. Coomassie brilliant blue G250 (Sedmak and Grossberg, 1977). For
western blotting, protein extracts were electrophoretically resolved
on 15% SDS-PAGE and blotted on to a nitrocellulose membrane. His-
Quantitative real-time RT-PCR
tag mouse monoclonal antibody (ZSGB-BIO, China) was employed
as primary antibody because NfrA expressed by pET-30a contains
Primers for quantitative real-time reverse transcription PCR
were designed to amplify a 100 bp internal nfrA fragment and a
100 bp 16S rDNA gene of BYCr-1 fragment was used as control
(Table 1). The sequences of nfrA (NC_000964.3) and the 16S rDNA
gene (KF998584) were based on our sequencing results. Quantita-
tive real-time PCR was performed using SYBR Premix Ex Tap™ II
(TaKaRa, Dalian, China). PCR reactions were carried out in a total
volume of 20 ml in Mx3005P QPCR Systems (Agilent, CA, America).
The PCR program was as follows: 1 cycle of 95  C for 30 s; 40 cycles
of 95  C for 5 s, 58  C for 30 s. A melting curve test was performed to
check the specificity and identity of the PCR product. Quantitative
analysis was carried out using the comparative CT method. All
genes were analyzed in triplicate.

Cloning and sequencing of nfrA

The nfrA gene was amplified with the sequence-specific primers

which introduced BamH Ⅰand SalⅠcutting site (Table 1). The PCR

Fig. 1. Growth curves and Cr(VI) reduction curves of BYCr-1 in M9 medium incubated Fig. 2. Transmission electron micrographs of BYCr-1 added with (A) and without
with 0.2 mM Cr(VI): growth curve of BYCr-1 (◊); Cr(VI) reduction curve of BYCr-1 (A); (B) 1 mM Cr(VI). A: Cr(III) precipitates were found inside and outside of cell membrane
M9 medium amended with 0.2 mgL1 ampicillin as a control to monitor abiotic (arrows). B: No visible precipitates were found in the cell without treatment of Cr(VI).
chromate reduction (△) and (:). The standard deviations were shown as error bar. An EDX spectrum from the electron-dense particles generated a Cr peak.
 Z. Zheng et al. / International Biodeterioration & Biodegradation 97 (2015) 90e96
Fig. 3. The resting cell assays of E. coli BL21 (DE3) and BYCr-1. Cr(VI) concentration of four different treatment groups: before inoculated with bacteria (▢); the Cr(VI) concen-
tration in supernatant after cultivating bacteria in M9 medium for 12 h (G); the Cr(VI) concentration in supernatant after treating cultured bacteria with Lysozyme (D); after
oxidizing the Cr(III) which had been reduced by bacteria (E). The standard deviations were shown as error bar.
his-tag. Fluorescein-Conjugated AffiniPure Goat Anti-Mouse IgG
(ZSGB-BIO) was used as secondary antibody.
Results
Isolation and identification of a Cr(VI)-reducing bacterium
Initial enrichment analysis revealed that the soil microbial
community of this district had Cr(VI)-reducing ability (Data not
shown). Further isolation and enrichment experiments were car-
ried out. 14 pure cultures were obtained. A bacterial strain desig-
nated BYCr-1 was isolated and chosen for further characterization
because of its high resistance to Cr(VI). BYCr-1 was a Gram-positive
rod-shaped strain. The phylogenetic identity of BYCr-1 was deter-
mined by 16S rDNA sequencing, which indicated that it was a Ba-
cillus with 98.6% similarity to B. subtilis subsp. subtilis str. SC-8 and
97.9% similarity to Bacillus tequilensis 10B (Fig. S1). And the Biolog
tests showed that BYCr-1 was 94.7% similar to B. subtilis subsp.
subtilis str. SC-8 (Data not shown).
Chromate reduction
BYCr-1 had a minimum inhibitory concentration (MIC) of the
10 mM to K2CrO4 in M9 medium. As shown in Fig. 1, Cr(VI) was
reduced to Cr(III) in 48 h (41.7 mM h1). No reduction of Cr(VI) was
detected in the abiotic controls. TEM and energy dispersive X-ray
analysis (EDXA) were used to further determine whether the pre-
cipitates were Cr(III). TEM images (Fig. 2A) showed visible pre-
cipitates located both inside and outside of the cells. Elemental
analysis of the precipitates by EDXA indicated that the electron
dense granules were composed of chromium. No visible pre-
cipitates were found in the cells without Cr(VI) (Fig. 2B).
Influence of temperature and pH on chromate reduction
Optimum temperature for chromate reduction and growth of
BYCr-1 in 0.2 mM Cr(VI) were measured ranging from 22  C to
93
42  C. As shown in Fig. S2A, the optimal temperature for reduction
was 37  C where the culture showed the highest Cr(VI) reduction
rate. The highest growth rate was also observed at 37  C (Fig. S2B).
The effect of pH on chromate reduction was evaluated in different
pH ranging from 5.0 to 9.0 under 0.2 mM Cr(VI) (Fig. S2C). BYC-1
showed optimum growth (Fig. S2D) and Cr(VI) reduction at pH
between 6.0 and 7.0, and the reduction was inhibited at pH 9.0. The
results indicated a possible correlation between pH and chromate
reduction.
Reduction of Cr(VI) by resting cell
The results of resting cell assay showed that 88% of Cr(VI) in
BYCr-1 was reduced, and conversely, 73% of Cr(VI) in E. coli BL21
(DE3) was biosorbed (Fig. 3) Reoxidation of reduced Cr(VI) again
confirmed that Cr(VI) was reduced and the recovery rate of the total
chromium was up to 90%.
Identification and quantitative analysis of a Cr(VI)-reducing gene
In order to address the mechanism of chromate reduction in
BYCr-1, we blasted the genome of B. subtilis subsp. subtilis str. SC-8 in
NCBI database with amino acids sequences of NfsA, YieF, and ChrR
and obtained a protein named NfrA. The key FMN-binding residues
identified in the crystallographic studies of NfsA and P. ambigua
chromate reductase were present in NfrA as well (Fig. 4).
Transcriptional level of nfrA was measured in BYCr-1 with or
without Cr(VI) to determine whether nfrA participate in Cr(VI)
reduction. Upon the addition of Cr(VI), expression of nfrA increased
about 5.3 folds, suggesting that nfrA in BYCr-1 could be induced by
chromate.
Expression of nfrA in E. coli BL21 (DE3)
The nfrA gene was cloned and expressed in E. coli BL21 (DE3) to
confirm its function in chromate reduction. The growth and Cr(VI)
reduction of E. coli BL21 (DE3) harboring either nfrA or an empty
94 Z. Zheng et al. / International Biodeterioration & Biodegradation 97 (2015) 90e96

Fig. 4. Clustal W alignment of NfrA, NfsA and the P. ambigua chromate reductase. Asterisks indicate identical residues; the colons indicate residues with a high level of
similarity; and the periods indicate residues with lower similarity. The 11 FMN-binding residues identified from the NfsA crystallographic data are boxed in gray, together with the
corresponding residues in the P. ambigua enzyme and NfrA (Kobori et al., 2001; Cortial et al., 2010).

vector pET-30a were measured and compared (Fig. 5). The results identified as B. subtilis was isolated from a chromate contami-
demonstrated that E. coli-NfrA (4.17 mM h1) had a higher chromate- nated site. This Bacillus strain reduced chromate aerobically which
reduction rate than E. coli-pET-30a (2.78 mM h1), but there was no differed from the anaerobic Cr(VI)-reducing Bacillus previously
significant difference in the growth of the two cultures. This sug- described by Gvozdyak and Lebedeva (Gvozdyak et al., 1986).
gested that the chromate-reducing ability of E. coli BL21 (DE3) but Moreover, our results demonstrated that BYCr-1 had the ability to
not its resistance to chromate could be enhanced by nfrA. Meanwhile
SDS-PAGE and western blotting were utilized to monitor the
expression of nfrA in E. coli BL21 (DE3) (Fig. 6). The results of resting
cell assays showed that 63% of Cr(VI) was reduced in E. coli-NfrA and
it was almost twice more effective than E. coli-pET-30a (Fig. 7). These
indicated that the difference in chromate-reducing ability between
the two cultures was due to nfrA expression.

Discussion

Since the first strain capable of reducing chromate was isolated

by Romanenko and Koren'kov in 1977 (Romanenko and Koren'kov,
1977), quite a number of chromate-reducing bacteria have been
discovered (Bopp and Ehrlich, 1988; Ishibashi et al., 1990; Rene'N
et al., 2006). In this study, a Cr(VI)-reducing bacterium BYCr-1

Fig. 6. SDS-PAGE and western blotting. Lane 1, pretained protein marker (); lane 2,
Fig. 5. Growth curve and chromate reduction curve. Growth curve (A) and chro- E. coli-pET-30a; lane 3, E. coli-NfrA; lane 4, Western blotting of NfrA in protein extracts
mate reduction curve (>) of E. coli-NfrA. Growth curve (:) and chromate reduction from E. coli-pET-30a; 5, Western blotting of NfrA in protein extracts from E. coli-NfrA.
curve (△) of E. coli-pET-30a. The standard deviations were shown as error bar. The 26 KDa NfrA band is indicated by an arrow.
 Z. Zheng et al. / International Biodeterioration & Biodegradation 97 (2015) 90e96
Fig. 7. The resting cell assays of E. coli-pET-30a and E. coli-NfrA. Cr(VI) concentration of four different treatment groups: before inoculated with bacteria (▢); the Cr(VI) con-
centration in supernatant after cultivating bacteria in M9 medium for 12 h (G); the Cr(VI) concentration in supernatant after treating cultured bacteria with Lysozyme (D); after
oxidizing the Cr(III) which had been reduced by bacteria (E). The standard deviations were shown as error bar.
both grow with and reduce high concentration of chromate in M9
medium. On the other hand, though some bacteria for example
Arthrobacter sp. reportedly reduce chromate more efficiently than
BYCr-1, the growth of these bacteria is affected even by very low
concentration of Cr(VI) (Megharaj et al., 2003; Asatiani et al., 2004).
It is very likely that the spore-bearing characteristic confers this
Bacillus strain high Cr(VI) resistance and allows it to remain in
stationary phase longer (Zouboulis et al., 2004). The sporulating
characteristic could also let Bacillus tolerate dramatic changes of
ambient environment.
The result that the optimal temperature for Cr(VI)-reduction
was between 22  C and 42  C has been observed in many Bacillus
(McLean et al., 2000; Focardi et al., 2012). Higher or lower tem-
perature would significantly decrease the rate of chromate reduc-
tion. Different pH can form different reduction products. Around
neutral pH, Cr(III) will easily form insoluble oxides and hydroxides
(Focardi et al., 2012). In BYCr-1, reduced Cr(III) precipitates were
found both inside and outside of cell, which is a good site for pre-
cipitation formation because of its high surface-to-volume ratio,
and phosphoryl and electronegative surface functional groups
(Beveridge and Murray, 1980; Doyle et al., 1980; Fortin et al., 1997).
As Cr(VI) is reduced, Cr(III) is free to bind to these electronegative
groups, which will be the nucleation sites for further heterogenous
nucleation and precipitate growth (Beveridge and Murray, 1976).
P. ambigua, Bacillus cereus and Shewanella oneidensis all reportedly
induced the formation of Cr(III) precipitates (Horitsu et al., 1987;
Myers et al., 2000; He et al., 2010).
The resting cell assay confirmed that decreased level of Cr(VI) in
the BYCr-1 culture medium was mostly due to reduction but not
biosorption. The reducing capability of BYCr-1 makes it a better
candidate for bioremediation of chromate when compared with the
bacteria that decrease heavy metal level mainly by sorption,
because sorbed Cr(VI) can easily desorb back into environment,
while reduced form Cr(III) is much less toxic and more stable.
In Bacillus, NfrA is a member of nitro/flavinreductase family.
NfrA has a broad electron accepter activity and it can reduce
95
nitrofurazone using NAD(P)H as electron donor (ZENNO et al.,
1998). Purified chromate reductases from Pseudomonas putida
and P. ambigua can use NAD(P)H as a source of electron as well
(Suzuki et al., 1992; Park et al., 2000). High similarities in amino
acid sequence between NfrA, and a chromate reductase in
P. ambigua. The expression of nfrA in E. coli BL21 (DE3) demon-
strated that NfrA can enhance the Cr(VI)-reducing ability of E. coli
BL21 (DE3), but not its resistance. The same results were observed
with ChrR, YieF and NfsA (Ackerley et al., 2004a,b). NfsA employs a
mixture of uni- and di-valent electron transfer steps in chromate
reduction (Ackerley et al., 2004a,b). Because of the amino acid
sequence similarity between NfrA and NfsA, NfrA might reduce
chromate by a similar mechanism with NfsA. But this speculation
needs further validation.
Conclusions
The isolate BYCr-1 is able to resist and reduce high concentra-
tions of Cr(VI).Its Cr(VI)-reducing property and the ability to survive
in the stressful in-site environmental conditions make it a poten-
tially suitable candidate for bioremediation of chromate contami-
nation. This study also reveals that the nfrA gene participates in
chromate reduction of BYCr-1.
Acknowledgments
This work was supported by National Natural Science Founda-
tion grant 31200085 to X. Li and 31100888 to P. Liu and Gansu
provincial science and technology support program 1104NKCA092
to Y. Chen.
Appendix A. Supplementary data
Supplementary data related to this article can be found at http://
dx.doi.org/10.1016/j.ibiod.2014.10.017.
96 Z. Zheng et al. / International Biodeterioration & Biodegradation 97 (2015) 90e96

References Kwak, Y.H., Lee, D.S., Kim, H.B., 2003. Vibrio harveyi nitroreductase is also a chro-
mate reductase. Appl. Environ. Microbiol. 69, 4390e4395.
Lovley, D.R., Phillips, E.J., 1994. Reduction of chromate by Desulfovibrio vulgaris and
Ackerley, D., Gonzalez, C., Keyhan, M., Blake, R., Matin, A., 2004a. Mechanism of
its c3 cytochrome. Appl. Environ. Microbiol. 60, 726e728.
chromate reduction by the Escherichia coli protein, NfsA, and the role of
McLean, J., Beveridge, T.J., 2001. Chromate reduction by a pseudomonad isolated
different chromate reductases in minimizing oxidative stress during chromate
from a site contaminated with chromated copper arsenate. Appl. Environ.
reduction. Environ. Microbiol. 6, 851e860.
Microbiol. 67, 1076e1084.
Ackerley, D., Gonzalez, C., Park, C., Blake, R., Keyhan, M., Matin, A., 2004b. Chro-
McLean, J.S., Beveridge, T.J., Phipps, D., 2000. Isolation and characterization of a
mate-reducing properties of soluble flavoproteins from Pseudomonas putida
chromium-reducing bacterium from a chromated copper arsenate-contami-
and Escherichia coli. Appl. Environ. Microbiol. 70, 873e882.
nated site. Environ. Microbiol. 2, 611e619.
Asatiani, N.V., Abuladze, M.K., Kartvelishvili, T.M., Bakradze, N.G., Sapojnikova, N.A.,
Megharaj, M., Avudainayagam, S., Naidu, R., 2003. Toxicity of hexavalent chromium
Tsibakhashvili, N.Y., Tabatadze, L.V., Lejava, L.V., Asanishvili, L.L., Holman, H.-Y.,
and its reduction by bacteria isolated from soil contaminated with tannery
2004. Effect of chromium (VI) action on Arthrobacter oxydans. Curr. Microbiol.
waste. Curr. Microbiol. 47, 0051e0054.
49, 321e326.
Murase, K., Machida, K.-i., Adachi, G.-y., 1995. Recovery of rare metals from scrap of
Ausubel, F., Brent, R., Kingston, R., Moore, D., Seidman, J., Smith, J., Struhl, K., 1994.
rare earth intermetallic material by chemical vapour transport. J. Alloys Compd.
Current Protocols in Molecular Biology. Greene, New York, 2e2.
217, 218e225.
Balkwill, D.L., Kieft, T., Tsukuda, T., Kostandarithes, H.M., Onstott, T.,
Myers, C., Carstens, B., Antholine, W., Myers, J., 2000. Chromium (VI) reductase
Macnaughton, S., Bownas, J., Fredrickson, J.K., 2004. Identification of iron-
activity is associated with the cytoplasmic membrane of anaerobically grown
reducing Thermus strains as Thermus scotoductus. Extremophiles 8, 37e44.
Shewanella putrefaciens MR-1. J. Appl. Microbiol. 88, 98e106.
Barrera-Díaz, C.E., Lugo-Lugo, V., Bilyeu, B., 2012. A review of chemical, electro-
Nan, Z., Zhao, C., 2000. Heavy metal concentrations in gray calcareous soils of Baiyin
chemical and biological methods for aqueous Cr (VI) reduction. J. Hazard. Mater
region, Gansu province, PR China. Water, Air, Soil Pollut. 118, 131e142.
223, 1e12.
Park, C.-H., Gonzalez, C., Ackerley, D., Keyhan, M., Matin, A., 2001. Molecular engi-
Bencheikh-Latmani, R., Williams, S.M., Haucke, L., Criddle, C.S., Wu, L., Zhou, J.,
neering of soluble bacterial proteins with chromate reductase activity.
Tebo, B.M., 2005. Global transcriptional profiling of Shewanella oneidensis MR-1
Remediat. Benef. Reuse Contam. Sediments 103e112.
during Cr (VI) and U (VI) reduction. Appl. Environ. Microbiol. 71, 7453e7460.
Park, C., Keyhan, M., Wielinga, B., Fendorf, S., Matin, A., 2000. Purification to ho-
Beveridge, T., Murray, R., 1976. Uptake and retention of metals by cell walls of Ba-
mogeneity and characterization of a novel Pseudomonas putida chromate
cillus subtilis. J. Bacteriol. 127, 1502e1518.
reductase. Appl. Environ. Microbiol. 66, 1788e1795.
Beveridge, T., Murray, R., 1980. Sites of metal deposition in the cell wall of Bacillus
Petrilli, F.L., De Flora, S., 1977. Toxicity and mutagenicity of hexavalent chromium on
subtilis. J. Bacteriol. 141, 876e887.
Salmonella typhimurium. Appl. Environ. Microbiol. 33, 805e809.
Bopp, L.H., Ehrlich, H.L., 1988. Chromate resistance and reduction in Pseudomonas
Poopal, A.C., Laxman, R.S., 2008. Hexavalent chromate reduction by immobilized
fluorescens strain LB300. Arch. Microbiol. 150, 426e431.
lez, R., Cervantes, C., 1997. Streptomyces griseus. Biotechnol. Lett. 30, 1005e1010.
Campos-Garcia, J., Martínez-Cadena, G., Alvarez-Gonza
Rene'N, H., Apel, W.A., Thompson, V.S., Sheridan, P.P., 2006. Low temperature
Purification and partial characterization of a chromate reductase from Bacillus.
reduction of hexavalent chromium by a microbial enrichment consortium and a
Rev. Latinoam. Microbiol. 39, 73.
novel strain of Arthrobacter aurescens. BMC Microbiol. 6, 5.
Cervantes, C., 1991. Bacterial interactions with chromate. Antonie Leeuwenhoek 59,
Rengaraj, S., Yeon, K.-H., Moon, S.-H., 2001. Removal of chromium from water and
229e233.
wastewater by ion exchange resins. J. Hazard. Mater. 87, 273e287.
Cortial, S., Chaignon, P., Iorga, B.I., Aymerich, S., Truan, G., Gueguen-Chaignon, V.,
Romanenko, V., Koren'kov, V., 1977. Pure culture of bacteria using chromates and
Meyer, P., Morera, S., Ouazzani, J., 2010. NADH oxidase activity of Bacillus subtilis
bichromates as hydrogen acceptors during development under anaerobic
nitroreductase NfrA1: insight into its biological role. FEBS Lett. 584, 3916e3922.
conditions. Mikrobiologiia 46, 414.
Doyle, R.J., Matthews, T.H., Streips, U.N., 1980. Chemical basis for selectivity of metal
Sedmak, J.J., Grossberg, S.E., 1977. A rapid, sensitive, and versatile assay for protein
ions by the Bacillus subtilis cell wall. J. Bacteriol. 143, 471e480.
using Coomassie brilliant blue G250. Anal. Biochem. 79, 544e552.
Eaton, A.D., Franson, M.A.H., 2005. Standard Methods for the Examination of Water
Suzuki, T., Miyata, N., Horitsu, H., Kawai, K., Takamizawa, K., Tai, Y., Okazaki, M.,
& Wastewater. American Public Health Association, 20001-3710.
1992. NAD (P) H-dependent chromium (VI) reductase of Pseudomonas ambigua
Enterline, P.E., 1974. Respiratory cancer among chromate workers. J. Occup. Environ.
G-1: a Cr (V) intermediate is formed during the reduction of Cr (VI) to Cr (III).
Med. 16, 523e526.
J. Bacteriol. 174, 5340e5345.
Focardi, S., Pepi, M., Landi, G., Gasperini, S., Ruta, M., Di Biasio, P., Focardi, S.E., 2012.
Thacker, U., Parikh, R., Shouche, Y., Madamwar, D., 2007. Reduction of chromate by
Hexavalent chromium reduction by whole cells and cell free extract of the
cell-free extract of Brucella sp. isolated from Cr (VI) contaminated sites. Bio-
moderate halophilic bacterial strain Halomonas sp. TA-04. Int. Biodeterior.
resour. Technol. 98, 1541e1547.
Biodegrad. 66, 63e70.
Wang, P.-C., Mori, T., Komori, K., Sasatsu, M., Toda, K., Ohtake, H., 1989. Isolation and
Fortin, D., Ferris, F., Beveridge, T., 1997. Surface-mediated mineral development by
characterization of an Enterobacter cloacae strain that reduces hexavalent
bacteria. Rev. Mineral. Geochem. 35, 161e180.
chromium under anaerobic conditions. Appl. Environ. Microbiol. 55,
Garbisu, C., Alkorta, I., Llama, M.J., Serra, J.L., 1998. Aerobic chromate reduction by
1665e1669.
Bacillus subtilis. Biodegradation 9, 133e141.
Wang, Y.-T., Shen, H., 1997. Modelling Cr (VI) reduction by pure bacterial cultures.
Gibb, H.J., Lees, P.S., Pinsky, P.F., Rooney, B.C., 2000. Lung cancer among workers in
Water Res. 31, 727e732.
chromium chemical production. Am. J. Ind. Med. 38, 115e126.
Yang, J., He, M., Wang, G., 2009. Removal of toxic chromate using free and immo-
Gvozdyak, P., Mogilevich, N., Ryl'skii, A., Grishchenko, N., 1986. Reduction of hex-
bilized Cr (VI)-reducing bacterial cells of Intrasporangium sp. Q5-1. World J.
avalent chromium by collection strains of bacteria. Mikrobiologiya 55,
Microbiol. Biotechnol. 25, 1579e1587.
962e965.
Zenno, S., Kobori, T., Tanokura, M., Saigo, K., 1998. Purification and characterization
He, M., Li, X., Guo, L., Miller, S.J., Rensing, C., Wang, G., 2010. Characterization and
of NfrA1, a Bacillus subtilis nitro/flavin reductase capable of interacting with the
genomic analysis of chromate resistant and reducing Bacillus cereus strain SJ1.
bacterial luciferase. Biosci. Biotechnol. Biochem. 62, 1978e1987.
BMC Microbiol. 10, 221.
Zhang, X., Krumholz, L.R., Yu, Z., Chen, Y., Liu, P., Li, X., 2013. A novel subspecies of
Horitsu, H., Futo, S., Miyazawa, Y., Ogai, S., Kawai, K., 1987. Enzymatic reduction of
Staphylococcus aureus from sediments of Lanzhou reach of the yellow river
hexavalent chromium by hexavalent chromium tolerant Pseudomonas ambigua
aerobically reduces hexavalent chromium. J. Bioremed. Biodegrad. 4, 04.
G-1. Agric. Biol. Chem. 51, 2417e2420.
Zhu, W., Yang, Z., Ma, Z., Chai, L., 2008. Reduction of high concentrations of chro-
Ishibashi, Y., Cervantes, C., Silver, S., 1990. Chromium reduction in Pseudomonas
mate by Leucobacter sp. CRB1 isolated from Changsha, China. World J. Microbiol.
putida. Appl. Environ. Microbiol. 56, 2268e2270.
Biotechnol. 24, 991e996.
Jones, A.P., Wall, F., Williams, C.T., 1996. Rare Earth Minerals: Chemistry, Origin and
Zouboulis, A., Loukidou, M., Matis, K., 2004. Biosorption of toxic metals from
Ore Deposits, 7. Chapman & Hall, pp. 349e355.
aqueous solutions by bacteria strains isolated from metal-polluted soils. Process
Kobori, T., Sasaki, H., Lee, W.C., Zenno, S., Saigo, K., Murphy, M.E., Tanokura, M., 2001.
Biochem. 39, 909e916.
Structure and site-directed mutagenesis of a flavoprotein from Escherichia coli
that reduces nitro compounds: alteration of pyridine nucleotide binding by a
single amino acid substitution. J. Biol. Chem. 276, 2816e2823.