Downloaded from http://journals.aai.org/jimmunol/article-pdf/168/4/1659/1146188/1659.

pdf by guest on 23 February 2024

RESEARCH ARTICLE | FEBRUARY 15 2002
CpG Oligodeoxynucleotides as Vaccine Adjuvants in Primates1 
Daniela Verthelyi; ... et. al
J Immunol (2002) 168 (4): 1659–1663.
https://doi.org/10.4049/jimmunol.168.4.1659

Related Content
CpG Oligodeoxynucleotides Protect Normal and SIV-Infected Macaques from Leishmania Infection
J Immunol (May,2003)

Protective Immunity Using Recombinant Human IL-12 and Alum as Adjuvants in a Primate Model of Cutaneous
Leishmaniasis
J Immunol (October,1999)
CpG Oligodeoxynucleotides as Vaccine Adjuvants in Primates1

Daniela Verthelyi,* Richard T. Kenney,2† Robert A. Seder,‡ Albert A. Gam,† Brenda Friedag,‡
and Dennis M. Klinman3*
Synthetic oligodeoxynucleotides (ODN) containing unmethylated CpG motifs act as immune adjuvants in mice, boosting the
humoral and cellular response to coadministered Ags. CpG ODN that stimulate human PBMC are only weakly active in mice.
Thus, alternative animal models are needed to monitor the activity and safety of “human” CpG ODN in vivo. This work dem-
onstrates that rhesus macaques recognize and respond to the same CpG motifs that trigger human immune cells. Coadministering
CpG ODN with heat-killed Leishmania vaccine provided significantly increased protection of macaques against cutaneous Leish-
mania infection. These findings indicate that rhesus macaques provide a useful model for studying the in vivo activity of human
CpG motifs, and that ODN expressing these motifs act as strong immune adjuvants. The Journal of Immunology, 2002, 168:

Downloaded from http://journals.aai.org/jimmunol/article-pdf/168/4/1659/1146188/1659.pdf by guest on 23 February 2024

1659 –1663.

S ynthetic oligodeoxynucleotides (ODN)4 containing un-
methylated “CpG motifs” are broadly immunostimulatory
in mice (1– 4). They activate B cells and dendritic cells
(DC), and trigger an immune cascade that includes the production
of cytokines, chemokines, and IgM (1, 2, 5– 8). In mice, CpG ODN
boost the protective efficacy of vaccines against bacterial, viral,
and parasitic pathogens (9 –14).
Due to evolutionary divergence in CpG recognition between
species, ODN that are highly active in rodents are poorly immu-
nostimulatory in primates, and vice versa (15–17). Extensive stud-
ies involving human PBMC identified two distinct classes of im-
munostimulatory CpG ODN (17, 18). “K” type ODN have
phosphorothioate backbones, encode multiple TCGTT and/or
TCGTA motifs (CpG motif is underlined), trigger the maturation
of plasmacytoid DC, and stimulate the production of IgM and IL-6
(17, 19). “D” ODN have mixed phosphodiester/phosphorothioate
backbones and contain a single hexameric purine/pyrimidine/CG/
purine/pyrimidine motif flanked by self-complementary bases that
form a stem-loop structure capped at the 3⬘ end by a poly G tail
(17). D ODN trigger the maturation of APC and preferentially
induce the secretion of IFN-␣ and IFN-␥ (Refs. 17 and 18 and M.
Gursel, unpublished observations).
There is considerable interest in evaluating the safety and ac-
tivity of CpG ODN planned for human use in a relevant animal
model. Although Davis and colleagues (20 –22) showed that K
Divisions of *Viral Products and †Bacterial, Parasitic, and Allergenic Products, Cen-
ter for Biologics Evaluation and Research/Food and Drug Administration, Bethesda,
MD 20892; and ‡Vaccine Research Center, National Institute of Allergy and Infec-
tious Diseases/National Institutes of Health, Bethesda, MD 20892
Received for publication July 19, 2001. Accepted for publication December 4, 2001.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported in part by Military Interdepartamental Purchase Request
No. MM8926.1. The assertions herein are the private ones from the authors and are
not to be construed as official or as reflecting the views of the Food and Drug
Administration.
2
Current address: Iomai Corporation, 20 Firstfield Road, Suite 250, Gaithersburg,
MD 20878.
3
Address correspondence and reprint requests to: Dr. Dennis Klinman, Center for Bio-
logics Evalutaion and Research/Food and Drug Administration, Building 29 A, Room 3
D 10, Bethesda, MD 20892-4555. E-mail address: Klinman@CBER.FDA.GOV
4
Abbreviations used in this paper: ODN, oligodeoxynucleotide; SLA, soluble Leish-
mania Ag; DC, dendritic cell; HKLV, heat-killed Leishmania vaccine.
ODN increased the seroconversion rate and Ab response of oran-
gutans and aotus monkeys immunized with hepatitis B vaccine and
malaria proteins, that group was unable to document improved
protection against infection by challenge studies. Moreover, no
studies have compared the activity of K ODN with the recently
discovered D class of ODN in primates.
This work examines whether rhesus macaques provide a useful
model for assessing the activity of CpG ODN in vivo. In vitro
studies established that PBMC from rhesus macaques responded to
the same panel of K and D ODN that were highly active on human
PBMC. Building on results from murine studies (23, 24), CpG
ODN were coadministered with a mixture of OVA plus alum. The
ODN significantly boosted the Ag-specific IgG response of ma-
caques, with D being superior to K ODN. A cutaneous Leishmania
infection model was used to examine whether CpG ODN could
boost protective immunity in primates. The nature, severity, dura-
tion, and histopathology of the cutaneous disease caused by Leish-
mania major in macaques is quite similar to that in humans (25,
26). Results indicate that D ODN significantly improve the pro-
tection conferred by coadministered heat-killed Leishmania vac-
cine (HKLV).
Materials and Methods
Rhesus monkeys
Healthy 3-year-old female rhesus macaques (Macaca mulatta) were ob-
tained from the Food and Drug Administration colony in Morgan Island,
SC. All studies were approved by the Center for Biologics Evaluation and
Research Animal Care and Use Committee, and were conducted in an
American Association for the Accreditation of Laboratory Animal Care-
accredited facility. Animals were monitored daily by veterinarians. No sys-
temic or local adverse reactions to CpG ODN, OVA, or HKLV immuni-
zations were observed. Treatments were administered and peripheral blood
samples obtained from ketamine-anesthetized animals (10 mg/kg, Ketaject;
Phoenix Pharmaceuticals, St. Joseph, MD).
Vaccination groups and protocol
Two in vivo studies were conducted: 1) three monkeys per group were
immunized s.c. and boosted 12 wk later with a mixture of 4 ␮g of OVA,
250 ␮g of ODN, and 125 ␮g of alum (Rehydragel HPA; Reheis, Berkeley
Heights, NJ); 2) five to six monkeys per group were immunized s.c., and
boosted 4 wk later with 250 ␮g of GMP-grade HKLV (Biobras, Montes
Claros, Brazil) plus 125 ␮g of alum, as previously described (27). The
HKLV was administered alone, or combined with 500 ␮g of ODN. Pre-
liminary studies established that this dose of ODN was active in vivo and
well-tolerated. Animals were exposed to nonviable Leishmania amazonen-
sis metacycle promastigotes on wk 8, a treatment that induced no disease

Copyright © 2002 by The American Association of Immunologists 0022-1767/02/$02.00

1660 CpG ODN AS VACCINE ADJUVANTS IN PRIMATES

and no change in Ab titer or proliferative response to Leishmania Ags
when compared with control animals. Animals were challenged on the
forehead on wk 14 with 107 viable L. major (WHOM/IR/-/173) metacyclic
promastigotes intradermally. The monkeys developed a typical self-limited
in situ lesion characterized by erythema, induration, and ulceration. Lesion
size, which reflects the severity of infection (25, 26), was measured
weekly.
Oligodeoxynucleotides
ODN (Table I) were synthesized by the Center for Biologics Evaluation
and Research Core Facility. All ODN had ⬍0.1 EU of endotoxin per mil-
ligram of ODN as assessed by a Limulus amebocyte lysate assay (QCL-
1000; BioWhittaker, Gaithersburg, MD).
Mononuclear cell preparation
Human and monkey mononuclear cells were isolated by density gradient
centrifugation of PBMC over Ficoll-Hypaque as described (17). Cells were
washed three times and cultured in RPMI 1640 supplemented with 10%
heat-inactivated FCS, 1.5 mM L-glutamine, and 100 U/ml penicillin/strep-
tomycin at 5 ⫻ 105 cells/well in the presence of 3 ␮M ODN. Supernatants
sizes were tested by repeated measures ANOVA using the Proc Mixed
procedure from the statistical analysis system.
Results
Response of PBMC from human and nonhuman primates to K
and D ODN
Previous studies established that human PBMC respond to two
structurally distinct classes of CpG ODN (17). D-type ODN trig-
gered the secretion of IFN-␣ and IFN-␥ (17), whereas K ODN
induced human PBMC to proliferate and secrete IL-6 and IgM
(Fig. 1, Ref. 17, and data not shown). Analysis of several hundred
CpG ODN identified several D and K ODN that strongly activated
human PBMC (17). These ODN were tested for their ability to
stimulate PBMC from rhesus macaques.
In this study, the response of rhesus PBMC to D ODN was
evaluated on the basis of IFN-␣ production. Results show that
macaque PBMC are activated by the same D ODN that stimulate

Downloaded from http://journals.aai.org/jimmunol/article-pdf/168/4/1659/1146188/1659.pdf by guest on 23 February 2024

were collected after 72 h and tested by ELISA for cytokine and Ab levels. human PBMC ( p ⬍ 0.002, Fig. 1). In contrast, neither K ODN, nor
ELISA control ODN that are structurally similar to D but lack the critical
CpG dinucleotide have this effect.
Ninety-six-well microtiter plates (Millipore, Bedford, MA) were coated
with Abs that cross-reactively recognized human and macaque IL-6 (R&D Proliferation and IL-6 secretion were used to compare the re-
Systems, Minneapolis, MN), IFN-␣ (PBL Biomedical Laboratories, New sponse of macaque and human PBMC to K ODN (Fig. 1). PBMC
Brunswick, NJ), and IgG (Boehringer Mannheim, Mannheim, Germany). from both species were stimulated by K ODN to proliferate ( p ⬍
The plates were blocked with PBS-5% BSA (17). Culture supernatants 0.002) and secrete IL-6 ( p ⬍ 0.01), whereas controls of the same
from PBMC cultures were added, and their cytokine content quantitated by
the addition of biotin-labeled anti-cytokine Ab followed by phosphatase-
structure as K ODN, but lacking the critical CpG motif, failed to
conjugated avidin and phosphatase-specific colorimetric substrate. Stan- trigger immune stimulation. These findings demonstrate that the
dard curves were generated using known amounts of recombinant human pattern of reactivity of PBMC from rhesus macaques (n ⫽ 20) and
cytokine or purified Ig. All assays were performed in triplicate. Titers of humans (n ⫽ 8 –20) to K and D ODN is quite similar.
Abs to OVA in sera were assayed on OVA-coated plates.
ELISPOT
The number of PBMC secreting IFN-␥ in response to soluble Leishmania
Ag (SLA) was determined by ELISPOT as described (28). Briefly, Milli-
pore 96-well filtration plates (Millipore, Bedford, MA) were coated over-
night at 4°C with 1 ␮g/ml of anti-human IFN-␥ Abs (clone GZ4; Alexis,
San Diego, CA) in PBS and then blocked with PBS-5% BSA for 2 h. The
plates were overlaid with 5 ⫻ 105 cells/well (1–2 series per monkey) and
incubated at 37°C in a humidified 5% CO2 in air incubator for 18 h in the
presence of 25 ␮g of SLA. The plates were then washed with water-
0.025% Tween and overlaid with biotin-conjugated anti-human IFN-␥
(clone 76-B-1; Mabtech, Nacka, Sweden). After 2 h, the plates were
washed again and then overlaid with alkaline phosphatase-conjugated
streptavidin. Spots were visualized by the addition of 5-bromo-4-chloro-
3-indolyl phosphate (Kirkegaard & Perry Laboratories, Gaithersburg, MD)
and counted using the KS ELISPOT Imagine System (Carl Zeiss,
Thornwood, NY).
Cell proliferation assay
A total of 105 PBMC/well were incubated with 3 ␮M of ODN for 68 h,
pulsed with 1 ␮Ci of [3H]thymidine and harvested 4 h later. All assays
were performed in triplicate.
Statistical analysis
Statistically significant differences were determined using a two-tailed non-
parametric ANOVA with Dunnett’s post test analysis. Differences in lesion

Table I. Sequence and backbone of D, K, and control ODNa

ODN Sequences

D19 GGTGCATCGATGCAGGGGGG
D29 GGTGCACCGGTGCAGGGGGG FIGURE 1. Response of primate PBMC to K and D ODN. PBMC from
D35 GGTGCATCGATGCAGGGGGG 8 –20 normal human donors and 20 rhesus macaques were stimulated for
D122 GGTGCATTGATGCAGGGGGG 72 h with 3 ␮M of K, D, or control ODN (in which the critical CpG motifs
K3 ATCGACTCTCGAGCGTTCTC were inverted or replaced with TpG). IL-6 and IFN-␣ levels in culture
K123 TCGTTCGTTCTC supernatants were determined by ELISA, while cell proliferation was as-
K23 TCGAGCGTTCTC sessed by [3H]thymidine uptake. Note that D ODN induce the secretion of
K163 TTGAGTGTTCTC IFN-␣ while K ODN induce cell proliferation and IL-6 production. All
AA3M GGGCATGCATGGGGGG
assays were performed in triplicate. Statistical significance was determined
a
CpG dinucleotides are underlined. Bases in bold are phosphodiester. by ANOVA of log normalized data. ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01.
The Journal of Immunology
Ongoing studies in our lab indicate that individual humans and
monkeys vary in their response to specific K and D sequences.
Indeed, no single D or K motif is optimally stimulatory in all
donors (Ref. 29 and C. Leifer, unpublished observations). How-
ever, mixtures of ODN were identified that strongly stimulated
PBMC from all human donors. These mixtures were tested on
PBMC from macaques and found to be uniformly active (Fig. 2).
Subsequent in vivo studies were conducted with these ODN
mixtures.
Adjuvant activity of CpG ODN in vivo
Previous studies in mice showed that CpG ODN could boost the
immune response to a coadministered protein Ag (such as OVA).
This effect was amplified by adding alum to the mixture of CpG
ODN plus Ag (23, 30, 31). Building on these results, macaques
were immunized and boosted with a mixture of OVA, alum, and
ODN. Animals immunized with mixtures containing D ODN in-
creased their IgG anti-OVA response 470-fold after primary ( p ⬍
0.05) and 600-fold after secondary ( p ⬍ 0.01) immunization (Fig.
3). By comparison, K ODN boosted the IgG Ab response 7-fold
after primary, and 35-fold after secondary immunization when
compared with pretreatment values ( p ⬍ 0.05). Macaques immu-
nized with OVA plus control ODN generated only a 4-fold in-
crease in anti-OVA titer. These findings indicate that D ODN are
particularly effective at boosting the Ag-specific humoral response
to a coadministered Ag.
Effect of CpG ODN on the immunogenicity and protective
efficacy of HKLV
Previous human clinical trials showed that HKLV was safe, but
poorly immunogenic (26). Building on evidence that HKLV com-
bined with alum and IL-12 induces short-term protective immunity
in rhesus macaques (27), and that CpG ODN plus alum increased
the immune response to the hepatitis B vaccine in cyalomongus
monkeys (20), we immunized and boosted macaques with a mix-
ture of HKLV, alum, and CpG ODN. PBMC from these animals
were isolated 10 days postboost and restimulated in vitro with
FIGURE 2. Macaque PBMC respond to CpG ODN mixtures optimized
for human use. PBMC from rhesus macaques (n ⫽ 12–20) were stimulated
in vitro for 72 h with a mixture of D19, D29, and D35 (1 ␮M each) or K3
and K123 (1.5 ␮M each). D122 and K163 were used in the control ODN
mixture. Levels of IL-6 and IFN-␣ in culture supernatants were measured
by ELISA, while proliferation was measured by [3H]thymidine uptake.
Statistical significance was determined by ANOVA of the normalized data.
ⴱⴱ, p ⬍ 0.01.
1661
FIGURE 3. Antibody titers in macaques immunized with OVA plus
ODN. Macaques (three per group) were immunized s.c. with a mixture of
4 ␮g of OVA plus 125 ␮g of alum. A total of 250 ␮g of D19 ⫹ D29, K3
⫹ K23, or control (AA3 M) ODN was added to this mixture. Monkeys
Downloaded from http://journals.aai.org/jimmunol/article-pdf/168/4/1659/1146188/1659.pdf by guest on 23 February 2024
were boosted with the same material 12 wk later (black arrow). Serum IgG
anti-OVA titers were determined by ELISA. Values represent the geomet-
ric mean titer ⫾ SEM. Note that the anti-OVA IgG titers in the group that
received D ODN are significantly increased over that of OVA plus alum
alone (p ⬍ 0.01).
Leishmania Ag for 18 h. As seen in Fig. 4, both K and D ODN
significantly increased the number of PBMC triggered to secrete
IFN-␥ ( p ⬍ 0.05). In contrast, animals immunized with alum-
adsorbed HKLV alone showed no increased IFN-␥ production
when compared with unimmunized controls.
The critical measure of an Ag/adjuvant combination is its ability
to induce protective immunity. Vaccinated animals were therefore
challenged with 107 L. major metacyclic promastigotes. Animals
vaccinated with HKLV-alum alone developed typical cutaneous
lesions with a peak surface area of 300 ⫾ 60 mm2 26 days after
challenge (Fig. 5). Monkeys vaccinated with HKLV-alum plus K
ODN developed lesions of similar size, although the peak lesion for-
mation was slightly delayed. Animals immunized with HKLV-alum
plus D ODN had significantly smaller lesions (maximal size 80 ⫾ 13
mm2, p ⬍ 0.05), consistent with a reduced parasite burden (32).
CpG ODN safety
All animals treated with CpG ODN, either alone or with Ag, re-
mained healthy and active throughout the study. No hematologic
FIGURE 4. IFN-␥ production by PBMC from macaques immunized
with alum-adjuvanted HKLV plus ODN. Rhesus macaques were immu-
nized and boosted with 250 ␮g of HKLV-alum alone (n ⫽ 6), or combined
with 500 ␮g of a mixture of D (D19, D29, and D35; n ⫽ 5) or K (K3 and
K123; n ⫽ 5) ODN. PBMC from these animals were incubated with 25 ␮g
of SLA and analyzed in vitro for IFN-␥ production by ELISPOT assay.
Animals immunized with HKLV plus K or D ODN had significantly more
IFN-␥-secreting cells than unvaccinated controls as determined by a one-
way ANOVA (p ⬍ 0.05).
1662
FIGURE 5. Cutaneous lesions in macaques vaccinated with alum-adju-
vanted HKLV plus ODN. Rhesus macaques were primed s.c. with 250 ␮g
of alum-adjuvanted HKLV alone (n ⫽ 6) or combined with 500 ␮g of a
mixture of ODN (D19, D29, and D35; n ⫽ 5) or (K3 and K123; n ⫽ 5) and
boosted 4 wk later. On wk 14, the monkeys were challenged with 107
metacyclic promastigotes. The average size of the lesions on the forehead
(the site of challenge) is shown as the mean area (calculated as mean
diameter/2 ⫻ ␲). Note that macaques immunized with HKLV plus D ODN
had significantly smaller lesions (p ⬍ 0.01).
or serologic abnormalities were observed 3 days or 9 mo after
injection, and no weight loss or change in behavior was detected
following administration of CpG ODN at therapeutic doses.
Discussion
CpG ODN that activate human immune cells in vitro are only
weakly immunostimulatory in mice. To expedite preclinical testing
of the safety and activity of human ODN requires the identification
of a suitable animal model. This report documents that rhesus ma-
caques provide a relevant model for examining the in vivo activity
of CpG ODN planned for human use. PBMC from macaques mir-
rored the response of human PBMC in their response to both K and
D ODN. At the immunostimulatory doses used in this study, nei-
ther type of ODN triggered any adverse events. In vivo, broadly
immunostimulatory mixtures of K and D ODN boosted Ag-spe-
cific IgG responses in macaques immunized with OVA and in-
creased IFN-␥ production in animals vaccinated with HKLV. Of
greater importance, D ODN significantly increased the protective
response elicited by a coadministered HKLV vaccine.
Several previous reports examined whether K ODN could act as
immune adjuvants in nonhuman primates (20 –22). Studies by
Davis and colleagues (20 –22) demonstrated that K ODN boosted
the Ag-specific serum IgG response to alum-adjuvanted hepatitis B
vaccine, and to a peptide from the circumsporozoite protein of
malaria in orangutans and aotus monkeys. This was consistent with
results from earlier studies in mice showing that CpG ODN plus
alum synergize to boost immunity to Ag (23, 30, 31, 33). Yet these
experiments did not establish whether the resulting immune re-
sponse conferred protection against infection. The current experi-
ments confirm that K ODN boost the Ab response to a coadmin-
istered protein (OVA). They further document that D ODN are
significantly more effective in this role, boosting Ab production by
⬎500-fold over pretreatment levels and ⬎100-fold over OVA plus
alum (Fig. 3).
Cutaneous infection of macaques with L. major provides a
means for testing the protective efficacy of CpG ODN vaccine
combinations. The nature, severity, and duration of the cutaneous
disease caused by L. major in macaques is quite similar to that in
humans (25). The leading Leishmania vaccine candidate (HKLV)
has proven safe but poorly immunogenic in clinical trials (26).
CpG ODN AS VACCINE ADJUVANTS IN PRIMATES
Coadministration of both D and K ODN with this alum-adjuvanted
HKLV vaccine significantly increased the number of PBMC trig-
gered to secrete IFN-␥ when stimulated with Leishmania Ag in
vitro. However, the critical test of any vaccine/adjuvant combina-
tion is its ability to induce protective immunity. Results show that
the cutaneous lesions of macaques vaccinated with HKLV plus D
ODN were significantly reduced when compared with HKLV-
alum alone. Previous studies established that a reduction in lesion
size correlates with a reduced parasite load (Ref. 32 and R. A.
Seder, unpublished observations). These findings suggest that the
ability of D ODN to stimulate IFN-␣ and IFN-␥ production while
promoting the maturation of APC may be particularly useful for
the induction of a protective response against Leishmania (17, 18).
K and D ODN have unique structural properties. Optimally ac-
tive K ODN have a phosphorothioate backbone and express mul-
tiple TCGTT and/or TCGTA motifs. D ODN have a mixed phos-
phodiester/phosphorothioate backbone, express a single self-
Downloaded from http://journals.aai.org/jimmunol/article-pdf/168/4/1659/1146188/1659.pdf by guest on 23 February 2024
complementary purine/pyrimidine/CpG/purine/pyrimidine motif,
and are capped by a 3⬘ poly G tail. These two types of ODN trigger
human and rhesus PBMC to mount distinct responses. K ODN
stimulate B cells to proliferate and secrete IgM, plasmacytoid DC
precursors to mature and secrete IL-8, and monocytes to produce
IL-6 (Fig. 1 and Refs. 17, 18, 34, and 35). By comparison, D ODN
trigger plasmacytoid DC to produce large amounts of IFN-␣, and
directly or indirectly trigger NK cells to secrete IFN-␣, and my-
eloid DC to mature (Fig. 1, Refs. 17–19, and M. Gursel, unpub-
lished observations). We postulate that D ODN may be superior
vaccine adjuvants when a Th1-dependent immune response is re-
quired, whereas K ODN may excel at the induction of proinflam-
matory responses.
It is likely that differences in the recognition, uptake, and/or
processing of K and D ODN underlie their distinct functional prop-
erties. It was recently established that Toll-like receptor 9 plays a
critical role in CpG ODN-mediated activation of human and mu-
rine immune cells (35, 36). Using HEK 293 cells transfected with
human Toll-like receptor 9, our lab confirmed that the recognition
of K-type ODN was mediated by this receptor (37). However, our
ongoing studies indicate that these transfected cells do not respond
to D ODN, suggesting that a second type of receptor may be in-
volved in D ODN-mediated immune activation.
Clinical trials exploring the utility of CpG ODN as vaccine ad-
juvants, immunotherapeutic agents, and anti-allergens have been
initiated (38). Current results suggest that rhesus macaques may be
a useful model for evaluating the safety and activity of these agents
in vivo. In this context, neither local nor systemic adverse reac-
tions to K or D CpG ODN were detected in any of the animals
studied. Moreover, although K ODN similar to those currently in
human clinical trials were found to be active in vivo, our results
indicate that D may be superior vaccine adjuvants, improving the
humoral response and protective efficacy to certain coadministered
vaccines.
Acknowledgments
We thank Dr. David Sacks for providing the Leishmania parasites and
reviewing the manuscript, Dr. Phil Snoy and Ray Olsen for their care of the
nonhuman primates, Jackie Conover for technical assistance, Dr. Susan
Leitman-Klinman for providing human PBMC, and Dr. Eduardo Romano
for his assistance with the statistical analysis.
References
1. Krieg, A. M., A. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale,
G. A. Koretzky, and D. M. Klinman. 1995. CpG motifs in bacterial DNA trigger
direct B-cell activation. Nature 374:546.
2. Klinman, D. M., A. Yi, S. L. Beaucage, J. Conover, and A. M. Krieg. 1996. CpG
motifs expressed by bacterial DNA rapidly induce lymphocytes to secrete IL-6,
IL-12 and IFN␥. Proc. Natl. Acad. Sci. USA 93:2879.
The Journal of Immunology
3. Klinman, D. M., S. Kamstrup, D. Verthelyi, I. Gursel, K. J. Ishii, F. Takeshita,
and M. Gursel. 2000. Activation of the innate immune system by CpG oligode-
oxynucleotides: immunoprotective activity and safety. Springer Semin. Immuno-
pathol. 22:173.
4. Wagner, H. 1999. Bacterial CpG-DNA activates immune cells to signal “infec-
tious danger.” Adv. Immunol. 73:329.
5. Yamamoto, S., T. Yamamoto, S. Shimada, E. Kuramoto, O. Yano, T. Kataoka,
and T. Tokunaga. 1992. DNA from bacteria, but not vertebrates, induces inter-
ferons, activate NK cells and inhibits tumor growth. Microbiol. Immunol. 36:983.
6. Messina, J. P., G. S. Gilkeson, and D. S. Pisetsky. 1991. Stimulation of in vitro
murine lymphocyte proliferation by bacterial DNA. J. Immunol. 147:1759.
7. Sparwasser, T., E. Koch, R. M. Vabulas, K. Heeg, G. B. Lipford, J. W. Ellwart,
and H. Wager. 1998. Bacterial DNA and immunostimulatory CpG oligonucleo-
tides trigger maturation and activation of murine dendritic cells. Eur. J. Immunol.
28:2045.
8. Roman, M., E. Martin-Orozco, J. S. Goodman, M. Nguyen, Y. Sato, A. Ronaghy,
R. S. Kornbluth, D. D. Richman, D. A. Carson, and E. Raz. 1997. Immunos-
timulatory DNA sequences function as T helper-1 promoting adjuvants. Nat.
Med. 3:849.
9. Klinman, D. M. 1998. Therapeutic applications of CpG-containing oligode-
oxynucleotides. Antisense Nucleic Acid Drug Dev. 8:181.
10. Lipford, G. B., M. Bauer, C. Blank, R. Reiter, H. Wagner, and K. Heeg. 1997.
CpG-containing synthetic oligonucleotides promote B and cytotoxic T cell re-
sponses to protein antigen: a new class of vaccine adjuvants. Eur. J. Immunol.
27:2340.
11. Davis, H. L. 2000. Use of CpG DNA for enhancing specific immune responses.
Curr. Top. Microbiol. Immunol. 247:171.
12. Moldoveanu, Z., L. Love-Homan, W. Q. Huang, and A. M. Krieg. 1998. CpG
DNA, a novel immune enhancer for systemic and mucosal immunization with
influenza virus. Vaccine 16:1216.
13. Freidag, B. L., G. B. Melton, F. Collins, D. M. Klinman, A. Cheever, L. Stobie,
W. Suen, and R. A. Seder. 2000. CpG oligodeoxynucleotides and interleukin-12
improve the efficacy of Mycobacterium bovis BCG vaccination in mice chal-
lenged with M. tuberculosis. Infect. Immun. 68:2948.
14. Krieg, A. M., and H. L. Davis. 2001. Enhancing vaccines with immune stimu-
latory CpG DNA. Curr. Opin. Mol. Ther 3:15.
15. Bauer, M., K. Heeg, H. Wagner, and G. B. Lipford. 1999. DNA activates human
immune cells through a CpG sequence-dependent manner. Immunology 97:699.
16. Hartmann, G., and A. M. Krieg. 2000. Mechanism and function of a newly
identified CpG DNA motif in human primary B cells. J. Immunol. 164:944.
17. Verthelyi, D., K. J. Ishii, M. Gursel, F. Takeshita, and D. M. Klinman. 2001.
Human peripheral blood cells differentially recognize and respond to two distinct
CpG motifs. J. Immunol. 166:2372.
18. Krug, A., S. Rothenfusser, V. Hornung, B. Jahrsdorfer, S. Blackwell,
Z. K. Ballas, S. Endres, A. M. Krieg, and G. Hartmann. 2001. Identification of
CpG oligonucleotide sequences with high induction of IFN␣/␤ in plasmacytoid
dendritic cells. Eur. J. Immunol. 31:2154.
19. Kadowaki, N., S. Antonenko, and Y. J. Liu. 2001. Distinct CpG DNA and polyi-
nosinic-polycytidylic acid double-stranded RNA, respectively, stimulate CD11c-
type II dendritic precursor and CD11c⫹ dendritic cells to produce type I IFN.
J. Immunol. 166:2291.
20. Hartmann, G., R. D. Weeratna, Z. K. Ballas, P. Payette, S. Blackwell, I. Suparto,
W. L. Rasmussen, M. Waldshmidt, D. Sajuthi, R. H. Purcell, et al. 2000. Delin-
eation of a CpG phosphorothioate oligodeoxinucleotide for activating primate
immune responses in vitro and in vivo. J. Immunol. 164:1617.
21. Davis, H. L., I. I. Suparto, R. R. Weeratna, Jumintarto, D. D. Iskandriati,
S. S. Chamzah, A. A. Ma’ruf, D. D. Nente, A. M. Krieg, Heriyanto, W. Smits,
1663
and D. D. Sajuthi. 2000. CpG DNA overcomes hyporesponsiveness to hepatitis
B vaccine in orangutans. Vaccine 19:413.
22. Jones, T. R., N. Obaldia, R. A. Gramzinski, Y. Charoenvit, N. Kolodny, S. Kitov,
H. L. Davis, A. M. Krieg, and S. L. Hoffman. 1999. Synthetic oligodeoxynucle-
otides containing CpG motifs enhance immunogenic vaccine in Aotus monkeys.
Vaccine 17:3065.
23. Klinman, D. M., K. M. Barnhart, and J. Conover. 1999. CpG motifs as immune
adjuvants. Vaccine 17:19.
24. Davis, H. L., R. Weeranta, T. J. Waldschmidt, L. Tygrett, J. Schorr, and
A. M. Krieg. 1998. CpG DNA is a potent enhancer of specific immunity in mice
immunized with recombinant hepatitis B surface antigen. J. Immunol. 160:870.
25. Amaral, V. F., V. A. O. Ransatto, F. Conceicao-Solva, E. Molinaro, V. Ferreira,
S. G. Coutinho, D. McMahon-Pratt, and G. Grimaldi. 1996. Leishmania ama-
zonensis: The Asian rhesus macaques (Macaca mulatta) as an experimental
model for the study of cutaneous leishmaniasis. Exp. Parasitol. 82:34.
26. Handman, E. 2001. Leishmaniasis: current status of vaccine development. Clin
Microbiol. Rev. 14:229.
27. Kenney, R. T., D. L. Sacks, J. P. Sypek, L. Vilela, A. A. Gam, and
K. Evans-Davies. 1999. Protective immunity using recombinant human IL-12
and alum a adjuvants in a primate model of cutaneous leishmaniasis. J. Immunol.
163:4481.
28. Hagiwara, E., F. Abbasi, G. Mor, Y. Ishigatsubo, and D. M. Klinman. 1995.
Phenotype and frequency of cells secreting IL-2, IL-4, IL-6, IL-10, IFN␥ and
Downloaded from http://journals.aai.org/jimmunol/article-pdf/168/4/1659/1146188/1659.pdf by guest on 23 February 2024
TNF␣ in human peripheral blood. Cytokine 7:815.
29. Leifer, C. A., D. Verthelyi, and D. M. Klinman. 2001. CpG ODN mixtures op-
timally activate human PBMC: interfaces between innate and adaptive immunity.
In Keystone Symposia, Keystone, CO, January, Abstr. 22.
30. Weeratna, R. D., M. J. McCluskie, Y. Xu, and H. L. Davis. 2000. CpG DNA
induces stronger immune responses with less toxicity than other adjuvants. Vac-
cine 6:1755.
31. Deml, L., R. Schirmbeck, J. Reimann, H. Wolf, and R. Wagner. 1999. Immu-
nostimulatory CpG motifs trigger a T helper-1 immune response to human im-
munodeficiency virus type-1 (HIV-1) gp 160 envelope proteins. Clin. Chem. Lab.
Med. 37:199.
32. von Stebut, E., Y. Belkaid, B. V. Nguyen, M. Cushing, D. L. Sacks, and
M. C. Udey. 2000. Leishmania major infected murine Langerhans cell-like den-
dritic cells from susceptible mice release IL-12 after infection and vaccinate
against experimental cutaneous leishmaniasis. Eur. J. Immunol. 30:3498.
33. Stacey, K. J., and J. M. Blackwell. 1999. Immunostimulatory DNA as an adjuvant
in vaccination against Leishmania major. Infect. Immun. 67:3719.
34. Kadowaki, N., S. Ho, S. Antonenko, R. de Waal Malefyt, R. Kastelein, F. Bazan,
and Y. J. Liu. 2001. Subsets of human dendritic cell precursors express different
Toll-like receptors and respond to different microbial antigens. J. Exp. Med. 194:
863.
35. Bauer, S., C. J. Kirschning, H. Hacker, V. Redecke, S. Hausmann, S. Akira,
H. Wagner, and G. B. Lipford. 2001. Human TLR9 confers responsiveness to
bacterial DNA via species-specific CpG motif recognition. Proc. Natl. Acad. Sci.
USA 98:9237.
36. Hemmi, H., O. Takeuchi, T. Kawai, S. Sato, H. Sanjo, M. Matsumoto,
K. Hoshino, H. Wagner, K. Takeda, and S. Akira. 2000. A Toll-like receptor
recognizes bacterial DNA. Nature 408:740.
37. Takeshita, F., C. A. Leifer, I. Gursel, K. Ishii, S. Takeshita, M. Gursel, and
D. M. Klinman. 2001. Cutting edge: role of Toll-like receptor 9 in CpG DNA-
induced activation of human cells. J. Immunol. 167:3555.
38. Krieg, A. M. 2001. From bugs to drugs: therapeutic immunomodulation with
oligodeoxynucleotides containing CpG sequences from bacterial DNA. Antisense
Nucleic Acid Drug Dev. 11:181.