Journal of Ethnopharmacology 267 (2021) 113361

Contents lists available at ScienceDirect

Journal of Ethnopharmacology
journal homepage: www.elsevier.com/locate/jethpharm

Proteomic screening identifies the direct targets of chrysin anti-lipid depot

in adipocytes
Jie Mei 1, Rong Yang 1, Qiaohong Yang, Wencheng Wan, Xiaoyong Wei *
School of Basic Medical Sciences, Guangzhou University of Chinese Medicine, Guangzhou, 510006, China

A R T I C L E I N F O A B S T R A C T

Keywords: Ethnopharmacological relevance: Overweight/obesity was mentioned by many countries as an obstacle to good
Chrysin health and long life, which increases risk of diseases and disorders. Previous studies suggested that the chronic
Obesity low-grade inflammation present in the body was considered as the essential pathogenesis for obesity. Chrysin is
Inflammation
extracted from traditional Chinese medicine Oroxylum indicum (Linn.) Kurz and plays a superior anti-obesity role.
Target screening
Proteomics
Chrysin could reduce the lipid depot by inhibiting the obesity-related inflammation in adipose tissue. However,
Molecular docking the target protein for chrysin to exert its anti-obesity role are not verified.
Aim of study: The present study aimed to screen and validate the target protein for chrysin to reduce the lipid
depot in palmitic acid-induced 3T3-L1 adipocytes.
Materials and methods: Obesity model was established employing 0.5 mmol/L palmitic acid-induced 3T3-L1
adipocytes through “Cocktails” method. Two-dimensional gel electrophoresis (2-DE) combined with liquid
chromatography-mass spectrometry (LC-MS) was applied to analyze the differentially expressed proteins for
chrysin intervention by lipid formation in adipocytes. Gene silencing was utilized to decrease gene expression of
the candidate proteins, then production of triglyceride in 3T3-L1 was detected by triglycerides assay to deter­
mine the target proteins. Ultraviolet (UV) absorption together with fluorescence spectra validated the direct
target proteins of chrysin. They also computed the correlation constants of combination between chrysin and the
target proteins. Molecular docking was further employed to identify the main binding amino acids between
chrysin and the target protein.
Results: 2-DE combined with LC-MS screened four candidate proteins which were related to metabolism and
inflammation. The production of triglycerides in 3T3-L1 was reduced after decreasing gene expression of
Annexin A2 (ANXA2), 60 kDa heat shock protein (HSP-60) and succinyl-CoA:3-ketoacid coenzyme A transferase
1 (SCOT-S), respectively. UV spectrum showed that the absorbance spectra of ANXA2 from 260 to 300 nm shifted
upwards along with the increase in chrysin concentration, meanwhile the absorbance spectra of HSP-60 from 200
to 220 nm and from 265 to 280 nm shifted slightly upwards along with the increase in chrysin concentrations.
The results indicated the conjugated structures between chrysin and ANXA2 or HSP-60. Fluorescence quenching
further suggested a spontaneous interaction between chrysin and ANXA2 or HSP-60. Finally, molecular docking
identified the main binding amino acids between ANXA2 and chrysin were Ser22, Tyr24, Pro267, Val298,
Asp299, and Lys302.
Conclusions: Chrysin can reduce the amount of triglycerides by directly downregulating the inflammation-related
target proteins ANXA2 and HSP-60, exerting an anti-obesity role.

1. Introduction estimated according to World Health Organization (WHO), which cau­

ses a huge burden to the society and healthcare systems as obesity is
Overweight/obesity epidemic is escalating worldwide, and many associated with increased risk of diseases and disorders, such as malig­
countries mentioned it as an obstacle to good health and long life. nancy, type 2 diabetes, cardiovascular diseases, and musculoskeletal
Approximately, 1.9 billion overweight and 650 million obese adults are disorders (Singh et al., 2020). The current studies suggested that not

* Corresponding author.
E-mail address: jidewowxy2@163.com (X. Wei).
1
Equal contribution to this study.

https://doi.org/10.1016/j.jep.2020.113361
Received 17 April 2020; Received in revised form 7 August 2020; Accepted 29 August 2020
Available online 4 September 2020
0378-8741/© 2020 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
J. Mei et al.
only the energy imbalance but the chronic low-grade inflammation
presented in the body is considered as the essential pathogenesis for
obesity (van Dierendonck et al., 2020; Trayhurn et al., 2020; Šálek et al.,
2020; Daemen et al., 2020; Chen et al., 2020). Although the anti-obesity
drugs, such as Amfepramone, Liraglutide, and Orlistat, can reduce the
lipid absorption in the intestine by appetite inhibition. They exhibit
severe side effects such as anxiety, insomnia, and gastrointestinal
damage (Gómez-Silva et al., 2019; Khalil et al., 2020). Hitherto, effec­
tive solution has yet been found that can slow down the epidemic of
obesity.
“Sweet and abundant lipid food would trigger obesity” from Plain
Questions of Yellow Emperor’s Canon of Medicine demonstrated that the
therapy should be targeted to maintain homeostasis with the circulation
of Qi. A traditional Chinese medicine Oroxylum indicum (Linn.) Kurz
facilitates the Qi movement that was recorded into the Pharmacopoeia
of People’s Republic of China (Zhang et al., 2016). Chrysin is widely
extracted from Oroxylum and plays a superior anti-obesity role among
the flavonoids (Mangal et al., 2016; Naz et al., 2019; Choi te al., 2016).
Reportedly, chrysin reduces the lipid depot by inhibiting the accumu­
lation of macrophages in adipose tissue (Feng et al., 2014; Latorre et al.,
2018). Nevertheless, the correlation between chrysin and adipocytes is
not yet clarified.
Target screening is critical in elucidating the pharmacological
mechanism of small molecules drugs and has become an indispensable
step during the drug discovery process (Kubota et al., 2019). In recent
years, genomics, proteomics and computational method such as mo­
lecular docking, are widely applied to screen the target of small mole­
cule drugs and investigate their combination (Jost et al., 2018; Noberini
et al., 2019; Pinzi et al., 2019; Zhang et al., 2019).
Therefore, the present study applied proteomics and gene silencing
to screen the target proteins of chrysin, and molecular docking was
employed to identify the key binding residues related to anti-obesity by
chrysin in adipocytes, providing a novel perspective for obesity therapy.
2. Materials and methods
2.1. Drugs and reagents
Chrysin (Cat No: 376184, purity: 99.62%) was obtained from J&K
Scientific Ltd. (Beijing, China), Annexin A2 (human fusion protein, Cat.
No: Ag1777) from Proteintech (IL, USA), Dimethyl sulfoxide (DMSO)
from Keygen-Biotech (Jiangsu, China), and glycerol from Ruishu Tech
(Guangzhou, China). The stock solution of chrysin was prepared at 50
mmol/L in DMSO and stored at 4 ◦ C for up to 1 month. Annexin A2 was
solubilized in Tris-Hcl pH 7.4. Dulbecco’s modified Eagle’s medium
(DMEM), fetal bovine serum (FBS), and penicillin-streptomycin were
purchased from Gibco (MA, USA). Trypsin (sequence grade), dexa­
methasone (Dex), 3-isobutyl-1-methylxanthine, insulin, dithiothreitol
(DTT), urea, thiourea, and 3-[(3-cholamidopropyl) dimethylammonio]-
1-propanesulfonate (CHAPS) were purchased from Sigma-Aldrich (MO,
USA). Carrier ampholytes were obtained from Jimeibio (pH 3–10, Bei­
jing, China), pH gradient (IPG) strips from Bio-Rad (17 cm, pH 3–10
nonlinear, CA, USA), Coomassie brilliant blue G250 from Saiguo-
Biotech Co., Ltd (Guangzhou, China), and ammonium bicarbonate, tri­
fluoroacetic acid, and acetonitrile were purchased from Damao Chem­
ical Regent Factory (Tianjin, China). Tripure and SYBR green were
purchased from Roche (Basel, Switzerland), and 3T3-L1 preadipocytes
from Kunming Cell Bank (Yunnan, China).
2.2. Cell culture
3T3-L1 preadipocytes were randomly divided into control, model,
and chrysin groups (n = 3). The preadipocytes were cultured in DMEM
containing 10% FBS and 100 mg/mL of penicillin-streptomycin at 37 ◦ C
in a 5% CO2 incubator. Differentiation was induced by “Cocktails” (Guo
et al., 2007) in DMEM containing 10% FBS, 172 nmol/L insulin, 0.25
2
Journal of Ethnopharmacology 267 (2021) 113361
mmol/L mM dexamethasone, and 0.5 mmol/L 3-isobutyl-1-methylxan­
thine for 2 days, followed by culturing for 6 days in a medium consist­
ing of 90% DMEM, 10% FBS, and 344 nmol/L insulin. Subsequently, the
control group was treated with 90% DMEM containing 10% FBS, model
group with 90% DMEM containing 10% FBS and 0.5 mmol/L palmitic
acid, and chrysin group with 90% DMEM, 10% FBS, 0.5 mmol/L pal­
mitic acid, and 50 μmol/L chrysin for 4 days. The dose of palmitic acid
induced remarkable lipid accumulation (Morita et al., 2018). The oil red
staining assessed the cytotoxicity of chrysin using the cell viability assay
(Mangal et al., 2016).
2.3. 2-DE
Proteins were extracted from the treated cells in lysis buffer con­
taining 8 mol/L urea, 2 mol/L thiourea, 4% (w/v) CHAPS, 50 mmol/L
DL-Dithiothreitol, 2% (v/v) carrier ampholytes, and 1 mmol/L DMSO.
The lysed protein samples were rehydrated at 300 μg/gel in 350 μL
rehydration solution containing 8 mmol/L urea, 4% CHAPS, and 50
mmol/L DTT. 1D electrophoresis was performed in a PROTEAN Iso­
electric Focusing cell system (Bio-Rad, CA, USA) using the dry immo­
bilized pH gradient (IPG) strips based on the following conditions: 50 V
for 12 h, 250 V for 30 min, 1000 V for 50 min, linear gradient to 9000 V
for 4.5 h, linear gradient to 9000 V in 4 h, and 8000 V until approxi­
mately 60,000 Vhours. After the 1D electrophoresis, the IPG strips were
equilibrated in the SDS equilibration buffer containing 75 mmol/L Tris-
HCl (pH 8.8), 8 mmol/L urea, 20% glycerol, 2% sodium dodecyl sulfate
(SDS), and 1% bromophenol blue (w/v) for 15 min, followed by a second
equilibration with 2.5% iodoacetamide (IAM) for 15 min. After equili­
bration, the samples were resolved on 12.5% polyacrylamide gels using
a DYCZ-24F Electrophoresis System (Liuyi Instrument Co., Ltd, Beijing,
China) at constant power with 20 mA/strip for 10 h or until the bro­
mophenol blue reached the bottom of the gels. Subsequently, the gels
were stained with Coomassie brilliant blue G250 (Saiguo Biotech Co.,
Ltd, Guangzhou, China). Protein spot detection, volume calculation,
matching, and patterns were analyzed using PDQuest 8.0 software (Bio-
Rad). The differentially expressed protein spots between treatments
were considered significant when they showed >2-fold difference (P <
0.05, Student’s t-test). Then, the differentially expressed protein spots
were excised, washed two times with water, de-stained with 1 mL 50%
acetonitrile containing 25 mmol/L ammonium bicarbonate for 30 min at
37 ◦ C, and rinsed with 1 mL 100% acetonitrile for 30 min until the gel
pieces turned white. Subsequently, the dry gel pieces were trypsinized,
the excessive trypsin was removed, and gel pieces were covered with 20
μL of 25 mM ammonium bicarbonate and 10% (v/v) acetonitrile for
overnight digestion at 37 ◦ C. The supernatant was preserved; and 5%
(w/v) trifluoroacetic acid and 67% (v/v) acetonitrile were added to the
gel pieces for 30 min at 37 ◦ C. The combination with the supernatant
was lyophilized for 4 h (Jin et al., 2011).
2.4. LC-MS
Peptides derived from 2-DE were characterized using an EASY-nLC
1200 chromatography system coupled with an Orbitrap Fusion Lumos,
Tribrid Mass Spectrometer (Thermo Scientific, MA, USA), a PepMap100
C18 trap column (100 μm × 2 cm, 5 μm), and a Pep-Map RSLC C18
column (50 μm × 15 cm, 2 μm). The separation was achieved using
linear gradient from 6 to 38% solvent B (0.1% formic acid, 80% C2H3N)
for 20 min at a flow rate of 280 nL/min. Data were acquired with a cycle
time of 3 s. Raw data were automatically processed by the Sequest HT
engine of the Proteome Discoverer v2.2 against a database of Uniprot-
Homo (20171002) using the parameters described previously (Slow­
inska et al., 2017): 1) enzyme: trypsin; 2) fixed modification: carbami­
domethylation (C); 3) variable modifications: oxidation (M), 4) peptide
mass tolerance: 10 ppm, 5) mass tolerance: 0.02 Da; 6) peptide charges:
1+, 2+, and 3+; 7) instrument: ESI trap; 8) allowed up to two missed
cleavages. The false discovery rate was estimated by running searches
J. Mei et al. Journal of Ethnopharmacology 267 (2021) 113361

using the same parameters against decoy databases, and the rate was set
to 0.01. At least two unique peptide identifications were required for
each protein (Sulima et al., 2017).
2.5. Small interfering RNA (siRNA) knockdown and quantitative real-
time polymerase chain reaction (qRT-PCR)
The knockdown of Annexin A2 (Gene name:Anxa2), 60 kDa heat
shock protein (Hspd1), 26S protease regulatory subunit 8 (Psmc5), and
succinyl-CoA:3-ketoacid coenzyme A transferase 1 (Oxct1) was per­
formed in mouse 3T3-L1 pre-adipocytes using siRNA oligonucleotides
(Ribo-Bio, China). The sense sequence of Anxa2 siRNA oligo was 5′ -
GAAGAGGUAUUGAAUGCUA-3′ , Oxct1 siRNA oligo was 5′ -GGA­
GAAATGTACACTACCA-3′ , Psmc5 siRNA oligo 5′ -AGATCAAGGA­
GATTAAAGA-3′ , and Hspd1 siRNA oligo was 5′ -
GAAGAGAAGGACCCTGGAA-3 . The cells were transfected with siRNA
′ mL quartz cell. The wavelength range was set at 190–300 nm with a slit
(50 nmol/L) transfection buffer and reagent (Ribo-Bio).
Total RNA was extracted from the cells in culture dishes using Tri­
pure (Roche, Basel, Switzerland), according to the manufacturer’s in­
structions. cDNA was synthesized from 1 μg of total RNA using a reverse
transcription kit (Roche, Basel, Switzerland) according to the manu­
facturer’s instructions. The relative expression of mRNA was analyzed
by qRT-PCR using glyceraldehyde-3-phosphate dehydrogenase (Gapdh)
as an internal standard. The amount of template cDNA and SYBR green
and the number of cycles were applied according to the manufacturer’s
instructions. The primers (Takara, Dalian, China) were listed in Table 1.
2.6. Triglycerides assay
According to the instructions of the tissue/cell triglyceride assay kit
(Applygen, Beijing, China), the fat cells of the silencing and control
groups were washed with PBS two times after transfection and differ­
entiation modelling. Then, 100 μL (24-well plate) of lysis buffer was
added into each well, and protein quantification was used to calibrate
the concentration of triglycerides in 3T3-L1 preadipocytes.
2.7. Molecular docking
(Wang et al., 2018). A grid map was chosen to cover these residues and
was calculated by the AutoGrid program with the following parameters:
The box-size was set and centered on the ligand; the grid spacing was set
to 0.375 Å. The Lamarck’s genetic algorithm (LGA) was used to optimize
the conformation of chrysin. Semi-flexible docking was employed to
acquire the flexible binding residues between chrysin and ANXA2 in the
lowest binding energy conformation, then flexible docking was applied
to further calculate the binding energy and binding sites of chrysin and
ANXA2. For visualization of docking results, ADT, Discovery Studio
2019 Client and PyMol software were utilized.
2.8. UV absorption and fluorescence spectra
Absorption spectra were measured using an Ultrospec-3300 pro-
spectrophotometer (Biochrom Ltd, Cambridge, UK) equipped with a 3.5
width of 1.0 nm. The ANXA2 solution (5 × 10− 7 mol/L), HSP-60 (3 ×
10− 7 mol/L), and SCOT-S (1 × 10− 7 mol/L) was titrated with chrysin at
concentrations ranging from 5 × 10− 7 to 2.5 × 10− 5 mol/L. The mixture
was allowed to equilibrate for 20 min before spectra were recorded.
Proteins and chrysin were prepared with Tris-HCl buffer (pH 7.4).
Fluorescence spectra were measured using a Hitachi Spectro Fluo­
rimeter (F-4500 model, Tokyo, Japan) at the temperatures of 277 and
298 K. The concentrations of ANXA2 solution, HSP-60, and SCOT-S were
2.5 × 10− 7 mol/L and titrated with chrysin at concentrations ranging
from 2.5 × 10− 8 to 2.5 × 10− 6 mol/L. The excitation wavelength was set
at 280 nm, and the slit widths of both excitation and emission were fixed
at 5 nm. The fluorescence quenching mechanism could be explained
using the Stern–Volmer Eq (1) (Jiang et al., 2002):
F0/F = 1 + kqτ0[Q] (1)
where F0 and F are the fluorescence emission intensity with and without
quencher, respectively, kq is the constant of quencher rate, τ0 is the
average fluorescence lifetime, and [Q] is the concentration of the
quencher. Fluorescence data were employed to calculate the binding
constant (Ka) and the number of binding sites per protein using the
following Eqs (2) and (3) (Jiang et al., 2002):

log[(F0-F)/F] = log Ka + nlog[Q] (2)

The three-dimensional structure of chrysin (PubChem CID: 5281607)
was downloaded from the NCBI PubChem Compound database (http F0/(F0-F) = 1+Ka-1[Q] (3)
://www.ncbi.nlm.nih.gov/pccompound), and the crystal structure of
where Ka is the binding constant and n is the number of binding sites.
ANXA2 (PDB ID: 4HRE) was downloaded from the RCSB Protein Data
The value of Ka was obtained from the antilog of the y-intercept of the
Bank (http://www.rcsb.org/pdb). This structure is a complexed
double logarithm regression curve log (F0–F)/F vs. log [Q].
conformation of ANXA2 with P11 and SMARCA 3 (Oh et al., 2013). After
The thermodynamic parameters, such as standard enthalpy change
P11 and SMARCA 3 were removed, ANXA2 was then minimized with
(△H), standard entropy change (△S), and standard free energy change
CHARMm force field in Discovery Studio 2.5 software. Thereafter, the
(△G), could be determined to specify the acting force between the
energy-minimized ANXA2 was used in docking experiment. AutoDock
protein and the drug depending on the temperature (Jiang et al., 2002).
v4.2.6 and AutoDockTools v1.5.6 (ADT) software were applied to
Herein, Ka is the associative binding constants at the corresponding
calculate the binding energy, binding conformation and residues when
temperature and R is the gas constant (8.314 Jmol− 1K− 1). For the
chrysin interacts with ANXA2 (Morris et al., 2009).
interaction, △S>0 and △H>0, △S>0 represents hydrophobic inter­
Amino acids Glu296 and Lys301 were used as docking residues,
action; △H<0, △S<0 exhibits hydrogen bonds; △H<0 and △H<0,
which were the key binding residues between ginsenoside and ANXA2
△S>0 signifies electrostatic force (Ross and Subramanian, 1981). △H
and △S can be calculated simultaneously by the van’t Hoff Eqs (4) and
Table 1 (5) (Verdonk et al., 2016):
Primers used for the qRT-PCR analysis.
Gene name Primers Sequence (5′ - 3′ ) lnKa= − △H/RT + △S/R (4)
Anxa2 Anxa2 (F) GGACATTGCCTTCGCCTATCA − △G = △H − T△S = − RTlnKa (5)
Anxa2 (R) CGTCTCCAGGTGGCCAGATAA
Psmc5 Psmc5 (F) CAGGCAGTGGACTCCGTCAATA
Psmc5 (R) CAGTCTACGGAGATTCTGGCTCTTA
Oxct1 Oxct1 (F) TAAGCCTGGAGGCGATGTGA
Oxct1 (R) ATGTTGGGACTGATGAAGTTGCTG 2.9. Statistical analysis
Hspd1 Hspd1 (F) GACGTTGCCAATAACACAAACGA
Hspd1 (R) AAGTTCAGCAATTACAGCATCCACA All experiments were performed in triplicate. Data were expressed as
Gapdh Gapdh (F) AGCAGATCAAGGCCGCGTA mean ± standard deviation (SD). Statistical significance was evaluated
Gapdh (R) CATGGCACCACGGAGTTCA
using unpaired two-tailed Student’s t-test and one-way analysis of

3
J. Mei et al. Journal of Ethnopharmacology 267 (2021) 113361

variance (ANOVA), and P-value < 0.05 was considered as statistically
significant.
3. Results
3.1. Proteomic analysis of candidate target proteins for chrysin
intervention by lipid formation in adipocytes
The total protein spectra of the control, model, and chrysin groups
were obtained by 2-DE. According to PDQuest 8.0 software, the groups
were analyzed (n = 3 in each group) with an average of 323 ± 12 protein
points per gel (Fig. 1-A). Compared to the two-phase differential protein
spectra obtained after 2-DE, the difference in the gray values was ≥2-
fold (P < 0.05), among which, there were 21 points in the control group,
19 in the chrysin group, and 35 in the model group. Among these protein
spots, 8 showed a difference >2-fold between the model and control
groups (P < 0.05). However, >2-fold difference was detected between
the chrysin and model groups (P < 0.05). Also, the difference was not
significant between the chrysin and control groups. The spots number
are 1202, 2402, 1404, 4503, 5502, 9104, 7501, and 7302, respectively
(Fig. 1-A and -B).
The eight spots were selected for the LC-MS analysis, which included
14-3-3 protein epsilon, T-complex protein 1 subunit epsilon 2, ANXA2,
26S protease regulatory subunit 8, SCOT-S, T-complex protein 1 subunit
beta, HSP-60, and heterogeneous nuclear ribonucleoprotein (Fig. 1-C;
Table 2). Uniprot revealed that 14-3-3 protein epsilon, T-complex

Fig. 1. Differential proteins were analyzed for chrysin treatment by 2-DE. A) From the left to right are control group, model group and chrysin group. B) The
enlargement graph of differential spots in different groups. C) The quality of spot in control group, palmitic acid group and palmitic acid plus chrysin group.
*Compared with control group, statistical significance was shown as *p < 0.05.

4
J. Mei et al. Journal of Ethnopharmacology 267 (2021) 113361

Table 2
LC-MS identified the differential protein.
Position Swiss-Prot accession number Protein name E Mr/pI a Coverage % b
Mascot score

1202 P07356 Annexin A2 7.5/31.5 29.4 449

2402 P62196 26S protease regulatory subunit 8 7.1/48.5 16 290
1404 Q9D0K2 Succinyl-CoA:3-ketoacid coenzyme A transferase 1, mitochondrial 8.7/51 12.1 258
4503 P80314 T-complex protein 1 subunit beta 6.0/58.7 3.2 73
5502 P80316 T-complex protein 1 subunit epsilon 5.7/67.3 10.4 166
9104 D6REF3 14-3-3 protein epsilon 4.5/27.1 10 145
7503 P63038 60 kDa heat shock protein, mitochondrial 5.3/67.9 11.9 181
7302 Q9Z2X1 Heterogeneous nuclear ribonucleoprotein F 5.2/44.8 14.5 264
a
Experimental (E) molecular weight (Mr) in kilodaltons and theoretical isoelectric point (pI).
b
Amino acid sequence coverage (%) for the identified proteins.

protein 1 subunit epsilon 2, T-complex protein 1 subunit beta, and
heterogeneous nuclear ribonucleoprotein were related to the cell
structure. In addition, ANXA2, 26S protease regulatory subunit 8, SCOT-
S, and HSP-60 were related to metabolism and inflammation.
3.2. Triglyceride formation was decreased by ANXA2 and HSP-60 in
adipocytes
directly interact with chrysin. It was reported that SCOT-S was associ­
ated with the formation of fat metabolism (Orii et al., 2008). The
downregulation of SCOT-S by chrysin in proteomic experiments and its
role in reducing production of triglycerides after knockdown maybe due
to its intermediate link in lipid metabolism. Collectively, the results
implied that ANXA2 and HSP-60 were the direct target proteins of
chrysin.

In order to verify the correlations between these four candidate

proteins and chrysin, detection of triglyceride in 3T3-L1 after knock­ 3.4. Correlation constant of chrysin-ANXA2 and chrysin-HSP-60
down each of the candidate proteins was performed. As is exhibited in
Fig. 2-A, after respectively downregulating gene expression of ANXA2, The fluorescence spectra of ANXA2 decreased along with the
HSP-60, and SCOT-S in 3T3-L1 preadipocytes, the amount of tri­ increased concentrations of chrysin at temperature of 277 and 298 K
glycerides from palmitic acid-induced 3T3-L1 were reduced signifi­
cantly compared to the non-silent group (Fig. 2-B). The 26S protease
regulatory subunit 8 did not directly affect the production of tri­
glycerides in 3T3-L1, indicating that it was not a target of chrysin.
However, the expression of 26S protease regulatory subunit 8 was
downregulated by chrysin in proteomic experiments. It indicated that
high-fat diet can induce mitochondrial damage resulting in the
increased expression of 26S protease regulatory subunit 8, but it could
be recovered by chrysin intervention (Bach et al., 2003; Izuta et al.,
2008), which might be the mechanism underlying the downregulation
of 26S protease regulatory subunit 8 expression. The results suggested
ANXA2, HSP-60 and SCOT-S were the corresponding targets of chrysin.

3.3. UV spectrum revalidated the correlation between candidate target

proteins and chrysin

The structure of chrysin was shown in Fig. 3-F. The UV-absorption

spectrum showed that the absorbance spectra of ANXA2 from 260 to
300 nm shifted upwards along with the increase in chrysin concentra­
tion (Fig. 3-A); especially, the upward trend in the absorbance peak at
275 nm revealed a blue shift (Fig. 3-B). At 200–220 nm, a marked red
shift was noticed. This might be due to the conjugated structures; the
benzene (R2) and the contiguous double bond of chrysin combined with
peptide allows optimal charge transport into the conjugated system. The
consequent decrease in the difference in the energy level reduced the
required displacement energy and brought a red-shift towards ANXA2
absorption.
In Fig. 3-C, UV-absorption spectrum showed that the absorbance
spectra of HSP-60 from 200 to 220 nm (Fig. 3-C) and from 265 to 280 nm
shifted slightly upwards along with the increase in chrysin concentra­
tions. In addition, the upward trend in the absorbance peak at 200–220
nm presented a red-shift. This phenomenon was similar to the interac­
tion between chrysin and ANXA2 and might be related to the conjugated
structures. At 275 nm, the absorbance peak increased by chrysin grad­
ually without a shift (Fig. 3-D). This performance was due to the com­
bination between HSP-60 and chrysin decreased the energy level but not Fig. 2. Gene silencing verified candidate target protein. A) qRT-PCR tested and
significantly. verified the silencing efficiency in 3T3-L1 adipocytes. B) The triglyceride for­
Also, the UV spectrum result of SCOT-S did not alter significantly mation influenced by siRNA knockdown. *Compared with control group, sta­
with an increase in chrysin concentration (Fig. 3-E), indicating it did not tistical significance was shown as *p < 0.05, **p < 0.01.

5
J. Mei et al. Journal of Ethnopharmacology 267 (2021) 113361

Fig. 3. Verification of the extracellular interaction of chrysin with ANXA2 and HSP-60. A) UV spectrum (wavelength 190–300 nm) of chrysin binding to ANXA2 in
vitro (ratio of chrysin/ANXA2=1 to 20 is displayed in changed blue); B) chrysin causes a slight blue shift at the characteristic peak (wavelength 260–300 nm) of
ANXA2 complex and the peak value increases; C) UV spectrum (wavelength 190–300 nm)of chrysin binding to HSP-60 (ratio of chrysin/HSP-60=1 to 50 is displayed
in changed blue); D) chrysin increases the peak at HSP-60 (260–300 nm); E) chrysin could not affect the structure of SCOT-S (190–300 nm, ratio of chrysin/SCOT-
S=1 to 20 is displayed in changed blue); F) chemical structure of chrysin. Chrysin is displayed in black, and ANXA2,HSP-60 and SCOT-S are displayed in red.

(Fig. 4-A and -B). Eq (1) computed the quenching constant (Kq) for
chrysin-ANXA2 complex at 277 and 298 K were 1.9 ± 0.05 × 1015 and
1.6 ± 0.05 × 1015 M− 1S− 1, respectively. The logarithmic plot of the
binding constant and binding sites were shown in Fig. 4-F. According to
the equation, the binding constants were 3.9 ± 0.12 × 107 and 4.0 ±
0.36 × 107 M− 1 at 277 and 298 K, respectively. The number of binding
sites reduced from 0.88 ± 0.04 to 0.83 ± 0.01 when the system tem­
perature raised from 277 to 298 K.
In addition, the interaction forces between drugs and protein might
include electrostatic interactions, multiple hydrogen bonds, van der
Waals interactions, and hydrophobic and steric contacts within the
protein-drug site (Ross and Subramanian, 1981). The △S>0, △H<0,
and △G<0 indicated spontaneous interaction. The corresponding data
are presented in Table 3.
Moreover, the quenching constant (Kq) for chrysin-HSP-60 complex
at 277 and 298 K was 3.47 ± 0.31 × 1013 and 1.6 ± 0.05 × 1015 M− 1S− 1,
respectively. The logarithmic plot of the binding constant and binding
sites are shown in Fig. 4-G. According to Eqs (3) and (4), the binding
constants were 1.42 ± 0.64 × 105 and 4.75 ± 0.46 × 105 M− 1 at 277 and
298 K, respectively. The number of binding sites reduced from 1.55 ±
0.42 to 0.34 ± 0.02 when the system temperature elevated from 277 to
298 K.
According to Eqs (4) and (5), the thermodynamics constant is shown
in Table 3. Based on the calculation results, △H<0 and △S>0 revealed

6
J. Mei et al. Journal of Ethnopharmacology 267 (2021) 113361

Fig. 4. Chrysin can directly combine with ANXA2 or HSP-60 to form stable complexes outside cells. A) Under the conditions of 277 K and B) 298 K, with the increase
of the concentration of chrysin, fluorescence quenching occurred with ANXA2 (2.5 × 10 − 7 mol/L). from top to bottom, the concentration ratio of chrysin to ANXA2
was 0, 0.1, 0.2, 0.3, and the lowest was the fluorescence curve of chrysin. C) and D) chrysin and HSP-60 (1 × 10 − 7 mol/L) undergo fluorescence quenching under
277 K, C) with chrysin and HSP-60 concentration ratio of 0, 2, 3, 4, 5, D) chrysin and HSP-60concentration ratio of 0, 1, 2, 3 under 298 K , E) and F) chrysin
undergoes static quenching with ANXA2, E) the slope represents the quenching constant (kq) and F) the slope represents the binding constant (ka); G) and H) chrysin
undergoes static quenching with HSP-60, G) the slope represents the quenching constant (kq) and H) the slope represents the binding constant (ka). In A-D, chrysin is
displayed in black.

7
J. Mei et al.
Table 3
Thermodynamic parameters of chrysin-ANXA2 and chrysin-HSP-60.
System T(K) △G (kJ/mol) △H (kJ/mol) △S (kJ/mol)
Chrysin- 277 − 40.25 ± 1.04 − 31.9 ± 11.9 2.21 ± 0.04
ANXA2 298 − 43.47 ± 1.75
Chrysin- 277 2.72 ± 0.18 × 104 − 4.97 ± 1.31 × 10 3
3.59 ± 0.52
HSP-60 298 3.24 ± 0.03 × 104
All experiments were run in triplicates and data were shown as means ± SD.
that HSP-60 interacted with chrysin by electrostatic interactions.
Also, △G<0 demonstrated their spontaneous interaction (Table 3).
3.5. Interaction between chrysin and ANXA2
According to the binding energy and optimal conformation of flex­
ible docking, the most negative binding energy between chrysin and
ANXA2 was − 5.13 kcal/mol, indicating that they had strong binding
affinity. Molecular docking experiments further identified the main
binding amino acids between ANXA2 and chrysin were Ser22, Tyr24,
Pro267, Val298, Asp299, and Lys302 (Fig. 5).
4. Discussion
Obesity is one of the chronic diseases that disturbs human health
worldwide. Adipose tissue and dietary saturated fatty acid levels are
significantly correlated with an increase in the size and number of fat
cells. In obesity, triglyceride removal rate (lipolysis followed by oxida­
tion) is decreased and the amount of triglycerides stored each year is
increased (Peter et al., 2011). Degenerating adipocytes release lipid
droplets into the extracellular space and the lipid-like materials
extruded from degenerating adipocytes are detected in the neighboring
immune cells, which and activate the immune response. During the
development of obesity, the accumulation of immune cells and inflam­
matory in the adipose tissue has also been described (Wernstedt et al.,
2014). Several targets, such as leptin and acyl-CoA-binding protein have
been assessed in the studies of obesity. These molecules work in the
central system for appetite control accompanied by increased inflam­
matory response in obese individuals (Manuel et al., 2019). Further­
more, promoting adiponectin/leptin ratio has been suggested as a
valuable strategy for the treatment of obesity; the release of adiponectin
exerts an effect opposite to that of the inflammation factor (Engin,
2017). Pentraxin 3 is an acute-phase protein in the immunoin­
flammatory response in diet-induced obesity. Recently, Bonacina et al.
suggested that Pentraxin 3 (PTX3) plays a critical role in the onset of
obesity (Bonacina et al., 2019). In the anti-inflammation reaction,
Annexin A1 protein is involved in the resolution of inflammation that
might be altered in obesity-associated type 2 diabetes mellitus, which is
a chronic inflammatory disease. However, Nathalia suggested that the
Fig. 5. Molecular docking revealed the interaction between ANXA2 and chrysin. A) The lowest binding energy of conformation between ANXA2 and chrysin; B) the
mesh models of binding residues (Ser22, Tyr24, Gly25, Glu297, Val298, Asp299, and Lys302) interacting with chrysin; C) two-dimensional map of main interaction
forces. ANXA2 and chrysin are colored as pink and yellow respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the
Web version of this article.)
8
Journal of Ethnopharmacology 267 (2021) 113361
high levels of cleaved Annexin A1 in the adipose tissue of individuals
with obesity compromise its anti-inflammatory and pro-resolving ac­
tions (Pietrani et al., 2018). Inhibition of this chronic inflammation is
critical for the development of therapeutic strategies in the prevention
and treatment of obesity.
Food-derived bioactive compounds have been highlighted as regu­
lators against various chronic diseases due to their low toxicity as
opposed to drugs that induce severe side effects (Lee et al., 2017).
Anti-inflammatory reaction provides new insights into the potential
nutritional effects of dietary flavonoids while protecting against the
development of obesity. Chrysin facilitated AMPK activation and sup­
pression of oxidative stress, p53-dependent apoptotic pathway, and
MAPK and NF-κB pathways while augmenting the vascular endothelial
growth factor/AKT pathway (Shao et al., 2012; Mantawy et al., 2017).
Chrysin serves as an effective modulator of PPARγ to recover the in­
flammatory diseases in obesity (Feng et al., 2014). It also inhibits the
formation of non-alcoholic fatty liver disease by reducing the expression
of liver X receptors-α (LXR-α), sterol regulatory element binding protein
(SREBP)-1c, and fatty acid synthase (FAS) genes and modulates the
structural alteration of gut microbiota in obese mice (Cheng et al.,
2019). However, only a few mechanism studies related to adipocyte and
inflammatory pathway are available. In this study, we revealed that
chrysin inhibited the expression of ANXA2 and HSP-60, two
pro-inflammatory molecules, in palmitic acid-induced mast adipocytes.
ANXA2 is a multifunctional calcium2+ (Ca2+) and phospholipid-
binding protein that is expressed in a wide spectrum of cells, including
those participating in the inflammatory response (Dallacasagrande and
Hajjar, 2020). ANXA2 also serves as an inflammatory mediator by
activating the ERK-dependent MAPK pathway, resulting in the opening
of NF-κB signaling pathway, promoting the release of inflammatory
factors (Lin et al., 2017; San et al., 2016; Wang et al., 2019). This
pro-inflammatory function has been found in the injury muscle, which
induced muscle adipogenic replacement of myofibers and impaired
muscle repair (Defour et al., 2017). Simultaneously, ANXA2 has been
reported to participate in adipose tissue changing and triglyceride
regulation in adipocytes (Bouwman et al., 2014; Parray et al., 2015). In
addition, pro-inflammatory ANXA2 and anti-inflammatory Anxa1
belong to annexin family have opposite sides, which was in agreement
with the contrary effect in obesity.
On the other hand, HSP-60 is a key target of macrophages in chronic
inflammation. This phenomenon was positively related to TNF-α and
nitric oxide released, activating Myd88 signaling pathway (Chen et al.,
1999; Benomar et al., 2019; Younis et al., 2019). When adipocytes were
administered high fat, HSP-60 transferred rapidly from the cytoplasm to
mitochondria to repair the damaged protein in mitochondria as a marker
in obese patients. (Sell et al., 2017; Wardelmann et al., 2019; Togo et al.,
2018). This served as a marker in previous studies but displayed a sig­
nificant role in attenuating triglyceride in adipocytes and could be
conjunct with chrysin. Interestingly, these two targets were localized in
J. Mei et al.
the membrane and cytoplasm and combined with chrysin. Thus, we
summarized the correlation that downregulates the response to
fat-induced irritation via inflammatory inhibition in the adipocytes;
nonetheless, further studies should be conducted.
5. Conclusions
Chrysin exerts an anti-obesity role by inhibiting the expression of
target protein ANXA2 and HSP-60. The decreased expression of ANXA2
and HPS-60 available playing a role in anti-obesity and anti-
inflammation. Chrysin may directly combine with these two crucial
proteins, displaying an anti-lipid depot effect in adipocytes.
Author contributions
Xiaoyong Wei (jidewowxy2@163.com) was responsible for the
design of the experiments; Jie Mei (mjldly310@163.com), Rong Yang
(18840843480@163.com) contributed to the most of the experimental
operation and finished the write of the article; Wencheng Wan (wa
nwencheng@gzucm.edu) and Qiaohong Yang (297010172@qq.com)
gave the guidance on experimental operation and the data statistics.
Declaration of competing interest
The authors declare no conflicts of interest.
Acknowledgments
This study was supported by the grants from the National Natural
Science Foundation of China (81973537), the Natural Science Founda­
tion of Guangdong (2020A1515011419, 2017A030313814), and the
National Key R&D Program of China (2017YFC1701100). We would like
to thank Rd. Sun Zhenghua from College of Life and Science and Tech­
nology, Jinan University for mass spectrometry analyzed.
References
Bach, D., Pich, S., Soriano, F.X., Vega, N., Baumgartner, B., Oriola, J., Daugaard, J.R.,
Lloberas, J., Camps, M., Zierath, J.R., Rabasa-Lhoret, R., Wallberg-Henriksson, H.,
Laville, M., Palacín, M., Vidal, H., Rivera, F., Brand, M., Zorzano, A., 2003.
Mitofusin-2 determines mitochondrial network architecture and mitochondrial
metabolism. A novel regulatory mechanism altered in obesity. J. Biol. Chem. 278
(19), 17190–17197.
Benomar, Y., Taouis, M., 2019. Molecular mechanisms underlying obesity-induced
hypothalamic inflammation and insulin resistance: pivotal role of resistin/TLR4
pathways. Front. Endocrinol. 10, 140.
Bonacina, F., Moregola, A., Porte, R., 2019. Pentraxin 3 deficiency protects from the
metabolic inflammation associated to diet-induced obesity. Cardiovasc. Res. 115
(13), 1861–1872.
Bouwman, F.G., Wang, P., Baak, M.V., 2014. Increased β-oxidation with improved
glucose uptake capacity in adipose tissue from obese after weight loss and
maintenance. Obesity (Silver Spring) 22 (3), 819–827.
Chen, J.Y., Zhu, X.L., Liu, W.H., Xie, Y., Zhang, H.F., Wang, X., Ying, R., Chen, Z.T.,
Wu, M.X., Qiu, Q., Wang, J.F., Chen, Y.X., 2020. C-reactive protein derived from
perivascular adipose tissue accelerates injury-induced neointimal hyperplasia.
J. Transl. Med. 18 (1), 68.
Chen, W., Syldath, U., Bellmann, K., 1999. Human 60-kDa heat-shock protein: a danger
signal to the innate immune system. J. Immunol. 162 (6), 3212–3219.
Cheng, N., Chen, S.N., Liu, X.Y., 2019. Impact of SchisandrChinensis bee pollen on
nonalcoholic fatty liver disease and gut microbiota in high fat diet induced obese
mice. Nutrients 11 (2), 346.
Choi, J.H., Yun, J.W., 2016. Chrysin induces brown fat-like phenotype and enhances
lipid metabolism in 3T3-L1 adipocytes. Nutrition 32 (9), 1002–1010.
Daemen, S., Schilling, J.D., 2020. The interplay between tissue niche and macrophage
cellular metabolism in obesity. Front. Immunol. 10, 3133.
Dallacasagrande, V., Hajjar, K.A., 2020. Annexin A2 in inflammation and host defense.
Cells 9 (6), 1499.
Defour, A., Medikayala, S., Van der Meulen, J.H., Hogarth, M.W., Holdreith, N.,
Malatras, A., Duddy, W., Boehler, J., Nagaraju, K., Jaiswal, J.K., 2017. Annexin A2
links poor myofiber repair with inflammation and adipogenic replacement of the
injured muscle. Hum. Mol. Genet. 26, 1979–1991.
Engin, A., 2017. Adiponectin-Resistance in obesity. Adv. Exp. Med. Biol. 960, 415–441.
Feng, X.J., Qin, H.H., Shi, Q., 2014. Chrysin attenuates inflammation by regulating M1/
M2 status via activating PPARγ. Biochem. Pharmacol. 89 (4), 503–514.
9
Journal of Ethnopharmacology 267 (2021) 113361
Gómez-Silva, M., Piñeyro-Garza, E., Vargas-Zapata, R., Gamino-Peña, M.E., León-
García, A., de León, M.B., Llerena, A., León-Cachón, R.B.R., 2019. Pharmacogenetics
of Amfepramone in healthy Mexican subjects reveals potential markers for tailoring
pharmacotherapy of obesity: results of a randomised trial. Sci. Rep. 9 (1), 17833.
Guo, W., Wong, S., Xie, W., Lei, T., Luo, Z., 2007. Palmitate modulates intracellular
signaling, induces endoplasmic reticulum stress, and causes apoptosis in mouse 3T3-
L1 and rat primary preadipocytes. Am. J. Physiol. Endocrinol. Metab. 293 (2),
E576–E586.
Izuta, H., Shimazawa, M., Tazawa, S., Araki, Y., Mishima, S., Hara, H., 2008. Protective
effects of Chinese propolis and its component, chrysin, against neuronal cell death
via inhibition of mitochondrial apoptosis pathway in SH-SY5Y cells. J. Agric. Food
Chem. 56 (19), 8944–8953.
Jin, H., Hu, R., Cheng, Y., Yang, F., Zhou, X., Li, X., Yang, P.Y., 2011. Differential protein
expression level identification by knockout of 14-3-3τ with siRNA technique and
2DE followed MALDI-TOF-TOF-MS. Analyst 136 (2), 401–406.
Jiang, C.Q., Gao, M.X., He, J.X., 2002. Study of the interaction between terazosin and
serum albumin synchronous fluorescence determination of terazosin. Anal. Chim.
Acta 252, 185.
Jost, M., Weissman, J.S., 2018. CRISPR approaches to small molecule target
identification. ACS Chem. Biol. 13 (2), 366–375.
Khalil, H., Ellwood, L., Lord, H., Fernandez, R., 2020. Pharmacological treatment for
obesity in adults: an umbrella review. Ann. Pharmacother. 54 (7), 691–705.
Kubota, K., Funabashi, M., Ogura, Y., 2019. Target deconvolution from phenotype-based
drug discovery by using chemical proteomics approaches. Biochim. Biophys. Acta
Protein Proteonomics 1867 (1), 22–27.
Latorre, J., Moreno-Navarrete, J.M., Sabater, M., Buxo, M., Rodriguez-Hermosa, J.I.,
Girones, J., Fort, J.M., Vilallonga, R., Ricart, W., Simo, R., Fernandez-Real, J.M.,
Ortega, F.J., 2018. Decreased TLR3 in hyperplastic adipose tissue, blood and
inflamed adipocytes is related to metabolic inflammation. Cell. Physiol. Biochem. 51
(3), 1051–1068.
Lee, Y.M., Yoon, Y., Yoon, H., 2017. Dietary anthocyanins against obesity and
inflammation. Nutrients 9 (10), 1089.
Lin, L., Hu, K., 2017. Tissue-type plasminogen activator modulates macrophage M2 to
M1 phenotypic change through Annexin A2-mediated NF-κB pathway. Oncotarget 8
(50), 88094–88103.
Mangal, P., Khare, P., Jagtap, S., Bishnoi, M., Kondepudi, K.K., Bhutani, K.K., 2016.
Screening of six Ayurvedic medicinal plants for anti-obesity potential: an
investigation on bioactive constituents from Oroxylumindicum (L.) Kurz bark.
J. Ethnopharmacol. 7, 1–7.
Mantawy, E.M., Esmat, A., El-Bakly, W.M., Salah ElDin, R.A., El-Demerdash, E., 2017.
Mechanistic clues to the protective effect of chrysin against doxorubicin-induced
cardiomyopathy: plausible roles of p53, MAPK and AKT pathways. Sci. Rep. 7, 4795.
Manuel Bravo-San Pedro, J., Sica, V., Madeo, F., Kroemer, G., 2019. Acyl-CoA-binding
protein (ACBP): the elusive ’hunger factor’ linking autophagy to food intake. Cell
Stress 3 (10), 312–318.
Morita, N., Hosaka, T., Kitahara, A., Murashima, T., Onuma, H., Sumitani, Y.,
Takahashi, K., Tanaka, T., Kondo, T., Ishida, H., 2018. Novel mechanisms
modulating palmitate-induced inflammatory factors in hypertrophied 3T3-L1
adipocytes by AMPK. J. Diabetes. Res, 9256482.
Morris, G.M., Huey, R., Lindstrom, W., Sanner, M.F., Belew, R.K., Goodsell, D.S.,
Olson, A.J., 2009. AutoDock4 and AutoDockTools4: automated docking with
selective receptor flexibility. J. Comput. Chem. 30 (16), 2785–2791.
Naz, S., Imran, M., Rauf, A., Orhan, I.E., Shariati, M.A., Iahtisham, Ul-Haq, Iqra, Yasmin,
Shahbaz, M., Qaisrani, T.B., Shah, Z.A., Plygun, S., Heydari, M., 2019. Chrysin:
pharmacological and therapeutic properties. Life Sci. 235, 116797.
Noberini, R., Bonaldi, T., 2019. Epigenetic drug target deconvolution by mass
spectrometry-based technologies. Nat. Struct. Mol. Biol. 26 (10), 854–857.
Oh, Y.S., Gao, P., Lee, K.W., Ceglia, I., Seo, J.S., Zhang, X., Ahn, J.H., Chait, B.T., Patel, D.
J., Kim, Y., Greengard, P., 2013. SMARCA3, a chromatin-remodeling factor, is
required for p11-dependent antidepressant action. Cell 152 (4), 831–843.
Orii, K.E., Fukao, T., Song, X.Q., Mitchell, G.A., Kondo, N., 2008. Liver-specific silencing
of the human gene encoding succinyl-CoA: 3-ketoacid CoA transferase. Tohoku.
J. Exp. Med. 215 (3), 227–236.
Parray, H.A., Yun, J.W., 2015. Proteomic identification of target proteins of
thiodigalactoside in white adipose tissue from diet-induced obese rats. Int. J. Mol.
Sci. 16 (7), 14441–14463.
Peter, A., Samuel, B., Mehran, S., 2011. Dynamics of human adipose lipid turnover in
health and metabolic disease. Nature 478 (7367), 110–113.
Pietrani, N.T., Ferreira, C.N., Rodrigues, K.F., 2018. Proresolving protein Annexin A1:
the role in type 2 diabetes mellitus and obesity. Biomed. Pharmacother. 103,
482–489.
Pinzi, L., Rastelli, G., 2019. Molecular docking shifting paradigms in drug discovery. Int.
J. Mol. Sci. 20 (18), 4331.
Ross, P.D., Subramanian, S., 1981. Thermodynamics of protein association reactions:
forces contributing to stability. Biochemistry 20 (11), 3096–3102.
Šálek, T., Adamíková, A., Ponížil, P., 2020. The fat mass, estimated glomerular filtration
rate, and chronic inflammation in type 2 diabetic patients. J. Clin. Lab. Anal. 34 (6).
San, I.V., Prost, G., Williams, J.A., Moss, S.E., Nuber, U.A., 2016. High podocalyxin levels
promote cell viability partially through up-regulation of annexin A2. Biochem.
Biophys. Res. Commun. 478 (2), 573–579.
Sell, H., Poitou, C., Habich, C., Bouillot, J.L., Eckel, J., Clément, K., 2017. Heat shock
protein 60 in obesity: effect of bariatric surgery and its relation to inflammation and
cardiovascular risk obesity. Obesity (Silver Spring) 25 (12), 2108–2114.
Shao, J.J., Zhang, A.P., Qin, W., Zheng, L., Zhu, Y.F., Chen, X., 2012. AMP-activated
protein kinase (AMPK) activation is involved in chrysin-induced growth inhibition
J. Mei et al.
and apoptosis in cultured A549 lung cancer cells. Biochem. Biophys. Res. Commun.
423 (3), 448–453.
Singh, A.K., Singh, R., 2020. Pharmacotherapy in obesity: a systematic review and meta-
analysis of randomized controlled trials of anti-obesity drugs. Expet Rev. Clin.
Pharmacol. 13 (1), 53–64.
Sulima, A., Bień, J., Savijoki, K., Näreaho, A., Sałamatin, R., Conn, D.B., Młocicki, D.,
2017. Identification of immunogenic proteins of the cysticercoid of Hymenolepis
diminuta. Parasites Vectors 10 (1), 577.
Togo, M., Konari, N., Tsukamoto, M., 2018. Effects of a high-fat diet on superoxide anion
generation and membrane fluidity in liver mitochondria in rats. J. Int. Soc. Sports.
Nutr. 15, 13.
Trayhurn, P., 2020. Through fat and thin - a journey with the adipose tissues. Proc. Nutr.
Soc. 79 (3), 1–13.
van Dierendonck, X., de la Rosa Rodriguez, M.A., Georgiadi, A., Mattijssen, F., Dijk, W.,
van Weeghel, M., Singh, R., Borst, J.W., Stienstra, R., Kersten, S., 2020. HILPDA
uncouples lipid droplet accumulation in adipose tissue macrophages from
inflammation and metabolic dysregulation. Cell Rep. 30 (6), 1811–1822.
Verdonk, M.L., Ludlow, R.F., Giangreco, I., Rathi, P.C., 2016. Protein-Ligand informatics
force field (PLIff): toward a fully knowledge driven “Force field” for biomolecular
interactions. J. Med. Chem. 59 (14), 6891–6902.
10
Journal of Ethnopharmacology 267 (2021) 113361
Wang, Y., Cheng, Y.S., Yin, X.Q., Yu, G., Jia, B.L., 2019. Anxa2 gene silencing attenuates
obesity-induced insulin resistance by suppressing the NF-κB signaling pathway. Am.
J. Physiol. Cell Physiol. 316 (2), C223–C234.
Wang, Y.S., Li, H., Li, Y., Zhu, H., Jin, Y.H., 2018. Identification of natural compounds
targeting Annexin A2 with an anti-cancer effect. Protein. Cell 9 (6), 568–579.
Wardelmann, K., Blümel, S., Rath, M., Alfine, E., Chudoba, C., Schell, M., Cai, W.,
Hauffe, R., Warnke, K., Flore, T., Ritter, K., Weiß, J., Kahn, C.R., Kleinridders, A.,
2019. Insulin action in the brain regulates mitochondrial stress responses and
reduces diet-induced weight gain. Mol. Metab. 21, 68–81.
Wernstedt, I., Tao, C., Morley, T.S., Wang, Q.A., Delgado-Lopez, F., Wang, Z.V.,
Scherer, P.E., 2014. Adipocyte inflammation is essential for healthy adipose tissue
expansion and remodeling. Cell Metabol. 20 (1), 103–118.
Younis, N.S., Mohamed, M.E., 2019. β-Caryophyllene as a potential protective agent
against myocardial injury: the role of toll-like receptors. Molecules 24 (10), 1929.
Zhang, H., Pan, J., Wu, X., Zuo, A.R., Wei, Y., Ji, Z.L., 2019. Large-scale target
identification of herbal medicine using a reverse docking approach. ACS Omega 4
(6), 9710–9719.
Zhang, J., Zhang, S., Teng, S., Zhai, L., 2016. An LC-MS/MS method for simultaneous
determination of four flavonoids from Semen Oroxyli in rat plasma and its
application to a pharmacokinetic study. J. Chromatogr. B. Analyt. Technol. Biomed.
Life. Sci. 1020, 96–102.