G Model

ARTICLE IN PRESS
Med Clin (Barc). 2017;xxx(xx):xxx–xxx

www.elsevier.es/medicinaclinica

Original article

APOA1 and APOB polymorphisms and apolipoprotein concentrations

as biomarkers of risk in acute coronary syndrome: Relationship
with lipid-lowering therapy effectiveness夽
Fidel Casillas-Muñoz a,b , Yeminia Valle a , José Francisco Muñoz-Valle a ,
Diana Emilia Martínez-Fernández a,c , Gabriela Lizet Reynoso-Villalpando a,b ,
Héctor Enrique Flores-Salinas d , Mara Anaís Llamas-Covarrubias e , Jorge Ramón Padilla-Gutiérrez a,∗
a
Instituto de Investigación en Ciencias Biomédicas, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara (UdeG), Guadalajara, Jalisco, Mexico
b
Doctorado en Genética Humana, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara (UdeG), Guadalajara, Jalisco, Mexico
c
Doctorado en Ciencias Biomédicas, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara (UdeG), Guadalajara, Jalisco, Mexico
d
Unidad Médica de Alta Especialidad, Centro Médico Nacional de Occidente (CMNO), Departamento de Cardiología, Instituto Mexicano del Seguro Social (IMSS), Guadalajara, Jalisco,
Mexico
e
Departamento de Biología Molecular y Genómica, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara (UdeG), Guadalajara, Jalisco, Mexico

a r t i c l e i n f o a b s t r a c t

Article history: Background and objective: Lipid metabolism alterations contribute to acute coronary syndrome (ACS).
Received 27 April 2017 rs670, rs5070 and rs693 polymorphisms have shown to modify the risk of cardiovascular disease.
Accepted 9 July 2017 Apolipoprotein A-I (ApoA-I) plays a major role in reverse cholesterol transport; apolipoprotein B (ApoB)
Available online xxx
contributes to accumulation of cholesterol in the plaque. The aim of this study was to investigate the
association of rs670 and rs5070 polymorphisms of APOA1 and rs693 polymorphism of APOB with ACS
Keywords: and circulating levels of its proteins and find if ApoB/ApoA-I could be implemented as an independent
Acute coronary syndrome
parameter of risk for cardiovascular disease and as a biomarker of lipid-lowering therapy effectiveness
Atherogenic risk
Apolipoprotein AI
in Mexican population.
Apolipoprotein B Methods: Three hundred patients with ACS and 300 control subjects (CS) were included.
Lipid-lowering therapy Results: Neither genotype nor allele frequencies of rs670, rs5070 and rs693 polymorphisms showed
statistical differences between groups. Serum levels of ApoA-I (195 vs. 161.4 mg/dL; p < .001) and ApoB
(167 vs. 136.9 mg/dL; p < .001) were significantly higher in CS compared with ACS; however, there was
no genetic association. Unstable angina patients showed the highest ApoA-I levels (males: 176.3 mg/dL;
females: 209.1 mg/dL).
Conclusion: The rs670, rs5070 and rs693 polymorphisms are not genetic susceptibility factors for ACS in
Mexican population and had no effect on their apolipoprotein concentrations. In our population, ApoA-I,
ApoB and HDL-C could be better biomarkers of cardiovascular risk and could indicate if statins doses
reduce atherogenic particles properly.
© 2017 Elsevier España, S.L.U. All rights reserved.

夽 Please cite this article as: Casillas-Muñoz F, Valle Y, Muñoz-Valle JF, Martínez-Fernández DE, Reynoso-Villalpando GL, Flores-Salinas HE, et al. Polimorfismos de los
genes APOA1 y APOB y concentraciones de sus apolipoproteínas como biomarcadores de riesgo en el síndrome coronario agudo: relación con la efectividad del tratamiento
hipolipemiante. Med Clin (Barc). 2018. https://doi.org/10.1016/j.medcli.2017.07.026
∗ Corresponding author.
E-mail address: imey 99@yahoo.com (J.R. Padilla-Gutiérrez).

2387-0206/© 2017 Elsevier España, S.L.U. All rights reserved.

MEDCLE-4252; No. of Pages 7

G Model
ARTICLE IN PRESS
2 F. Casillas-Muñoz et al. / Med Clin (Barc). 2017;xxx(xx):xxx–xxx

Palabras clave: Polimorfismos de los genes APOA1 y APOB y concentraciones de sus

Síndrome coronario agudo apolipoproteínas como biomarcadores de riesgo en el síndrome coronario
Riesgo aterogénico agudo: relación con la efectividad del tratamiento hipolipemiante
Apolipoproteína AI
Apolipoproteína B
r e s u m e n
Tratamiento de reducción de lípidos

Antecedentes y objetivo: Las alteraciones en el metabolismo de los lípidos contribuyen al síndrome coro-
nario agudo (SCA). Se ha demostrado que los polimorfismos rs670, rs5070 y rs693 modifican el riesgo de
enfermedad cardiovascular. La apolipoproteína A-I (ApoA-I) desempeña un papel principal en el trans-
porte inverso del colesterol; la apolipoproteína B (ApoB) contribuye a la acumulación de colesterol en la
placa. El objetivo de este estudio fue investigar la asociación entre los polimorfismos rs670 y rs5070 de
APOA1 y el polimorfismo rs693 de APOB con SCA y los niveles circulantes de estas proteínas, e investigar
si ApoB/ApoA-I podría introducirse como parámetro independiente predictor de riesgo de la enfermedad
cardiovascular y como biomarcador del tratamiento de reducción de lípidos en la población mexicana.
Métodos: Se incluyó a 300 pacientes con SCA y 300 sujetos control (SC).
Resultados: Ni las frecuencias genotípicas ni las alélicas de los polimorfismos rs670, rs5070 y rs693 refle-
jaron diferencias estadísticamente significativas entre los grupos. Los niveles séricos de ApoA-I (195 frente
a 161,4 mg/dl; p < 0,001) y ApoB (167 frente a 136,9 mg/dl; p < 0,001) fueron significativamente superiores
en los SC en comparación con los SCA; sin embargo, no existió asociación genética. Los pacientes con angina
inestable reflejaron los niveles más elevados de ApoA-I (varones: 176,3 mg/dl; mujeres: 209,1 mg/dl).
Conclusión: Los polimorfismos rs670, rs5070 y rs693 no constituyen factores de susceptibilidad genética
para SCA en la población de México y no tienen efecto sobre las concentraciones de sus apolipoproteínas.
En nuestra población, ApoA-I, ApoB y c-HDL podrían constituir unos mejores biomarcadores del riesgo
cardiovascular, y podrían indicar si las dosis de estatinas reducen debidamente las partículas aterogénicas.

© 2017 Elsevier España, S.L.U. Todos los derechos reservados.

Introduction In this study we evaluated some polymorphisms of APOA1 and

In 2012, 17.5 million people died from cardiovascular diseases
(CVDs) around the world. Among these deaths, 7.4 million were due
to coronary heart disease, a representing 12.4% of the global mor-
tality rate.1 In Mexico, ischemic heart disease is the leading cause
of death in the elderly and ranks second in the general population.2
According to the Instituto Nacional de Estadística y Geografía (INEGI),
there were 88,144 deaths (13.4% of deaths in the Mexican popula-
tion) from ischemic heart disease in 2015.3
The time elapsed after an ischemic event such as in Acute Coro-
nary Syndrome (ACS) is critical because patients face a higher risk
for recurrent events or even death.4 More specific measures to esti-
mate the status and vulnerability of atherosclerotic plaques as well
as the efficacy of drugs and diet in lowering lipids levels are needed.
Furthermore, it is urgent to revise the predictive potential of risk
biomarkers commonly used in medical practice.
Diverse studies of genome-wide association (GWA) have iden-
tified candidate loci of susceptibility for cardiovascular diseases
including apolipoproteins genes.5 Indeed, it has been found that
some polymorphisms in APOA1 and APOB genes modify the risk of
cardiovascular events in different populations.6,7
It is well known that the Apo B/ApoA-I ratio is the main fac-
tor influencing the risk of myocardial infarction. This conclusion
was reached by INTERHEART case–control study that calculated the
odd ratios for the top 9 risk factors after analyzing almost 30,000
individuals from 52 countries.8 A related attempt to predict fatal
myocardial infarction is the AMORIS prospective study of >175,000
Swedish individuals, although its database did not contain any
information about risk factors, the authors found that apoB serum
concentration and ApoB/ApoA-I ratio were the strongest predic-
tors of fatal outcome myocardial infarction.9 Afterwards, Walldius
and Jungner took advantage of the usual lower ApoA-I values in
men to propose different cut-off values for the ApoB/ApoA-I ratio:
<0.9 in women and <0.8 in men. Accordingly, these authors con-
sidered that any value greater than the respective cut-off implies
a high risk.10 Later, Lima et al. combined the results of the INTER-
HEART and AMORIS studies and proposed a more simplified risk
calculation.11
APOB genes and apolipoprotein concentrations as biomarkers of
risk in Acute Coronary Syndrome and their relationship with lipid-
lowering therapy effectiveness. Furthermore, we analyzed the Apo
B/ApoA-I ratio as a possible independent predictor of ischemic
events in adults with and without ACS from Western Mexico and
compared such ratio with range values proposed by INTERHEART
and AMORIS studies.
Materials and methods
Study design and participants
We studied 600 genetically unrelated individuals from West-
ern Mexico. Ethnicity was defined as those having at least two
generations of ascendants born in Mexico. These subjects had the
following characteristics:
(1) Three hundred patients older than 45 years with ACS, diag-
nosed according to the American College of Cardiology (ACC)
criteria.12 Result of diagnosis, Biomarkers and routine bio-
chemical test measures were obtained. Samples were collected
during the first 24 h after admission to satisfy diagnosis with
more specificity.13 Classical risk factors, as defined by ACC, were
categorized as present or absent.
(2) Three hundred Control subjects (CS) older than 45 years. They
responded to a questionnaire on their medical history and
lifestyle characteristics with absence of previous cardiovascu-
lar diseases as the main exclusion criteria. They denied active
infections or receiving any treatment.
All subjects were recruited at “Hospital de Especialidades del
Centro Médico Nacional de Occidente del Instituto Mexicano del
Seguro Social (CMNO-IMSS).” Subjects with overlapping heart dis-
orders or other diseases such as familial hypercholesterolemia, as
well as genetically related individuals were excluded.
G Model
ARTICLE IN PRESS
F. Casillas-Muñoz et al. / Med Clin (Barc). 2017;xxx(xx):xxx–xxx
The study was conducted in accordance with the Declaration
of Helsinki. An informed written consent was obtained. Ethical
approval was granted by the Ethic and Biosafety Committee of
the Centro Universitario de Ciencias de la Salud, CUCS, UdeG (C.I.
069-2012).
Genetic analysis of polymorphisms
Genetic analysis of −75 G>A (rs670) and 83C>T (rs5070)
polymorphisms of APOA1 gene
The fragment of DNA containing both rs670 and rs5070
polymorphisms was amplified by polymerase chain reaction-
restriction fragment length polymorphism (PCR-RFLP)
technique using the following primers sequences: Forward:
5 -AGGGACAGAGCTGATCCTTGAACTCTTAAG-3 ; Reverse: 5 -

TTAGGGGACACCTAGCCCTCAGGAAGAGCA-3 . PCR amplification
was carried out in a total volume of 20 ␮L containing 8 ng/␮L of
gDNA, 0.04 U/␮L of Taq DNA polymerase (Invitrogen, Carlsbad, CA,
USA), 1× of buffer, 4 nM of each primer, 5 mM of MgCl2 , and 2 mM
of dNTP. The thermocycling conditions had an initial denaturation
step of 5 min at 94 ◦ C and were followed by 35 cycles at 94 ◦ C, 57◦
C, and 72 ◦ C (30 s for each stage) and the final extension step of
5 min at 72 ◦ C. Following PCR, the presence of a 435-bp product
was visualized on 6% polyacrylamide gel after electrophoresis
silver staining.
The 434-bp fragment obtained was digested with the restric-
tion enzyme MspI. 4 ␮L of PCR product was digested with 5 units
of MspI restriction enzyme during 1.5 h at 37 ◦ C. The digested PCR
product was rune under electrophoresis on 6% polyacrylamide gel
which was visualized with silver staining. There are 3 restriction
sites of recognition for MspI in the 434-bp fragment in APOA1 gen,
two of which include both polymorphisms and the third is a con-
stitutive site which gives a fragment of 180 bp and a fragment of
254 bp. When a G to A transition at −75 bp takes place, there is
no restriction site and it produces a fragment of 180 bp instead
of 114 and 66 bp; similarly, for 83C>T, when a C to T transition
takes place, the +83 bp restriction site is absent and a fragment of
254 bp is produced instead of 209 and 46 bp. The genotypes of both
polymorphisms were interpreted using this information.
Genetic analysis of 2487C>T (rs693) polymorphism of APOB gene
SNP Genotyping Assay for rs693 polymorphism was performed
® allele frequencies showed statistically significant differences
using the allelic discrimination method with a VIC dye-labeled
TM
probe, FAM dye-labeled probe, and two target-specific primers
(context Sequence of primers: ACATTCGGTCTCGTGTATCTTC-
® (Table 3). However, it is important to highlight the power of the
TAG[A/G]GTCTCTCGGAATTTGGCCTTCATGT). VIC is the probe to
TM
detect Allele 1 (wild type) sequence and FAM is the probe to
detect Allele 2 sequence. Note: context sequence is noted using the
reverse strain.
The preparation of the reaction mix was as following: we use
®
12.5 ␮L of 2× TaqMan Master Mix, 0.75 ␮L of 40× Assay Working
Stock, 8.0 ␮L of Nuclease-free water and 4.0 ␮L of a solution con-
taining 5 ng/␮L of DNA to accomplish a total volume per well of
25 ␮L.
® ence serum levels of ApoA-I or ApoB in our population, but we
The thermal cycling conditions were set up in a Light Cycler 96
device as following: we use a holding time for enzyme activation
during 10 min at 95 ◦ C and finally 40 cycles for denaturation and
annealing/extension (95 ◦ C, 15 s; 60 ◦ C, 60 s respectively).
SNP genotyping quality control
The 25% of the samples were double-genotyped for all polymor-
phisms with a concordance rate of 100%.
3
Apolipoprotein analysis
Serum levels of ApoA-I and ApoB were measured in 300 patients
and 300 CS by immunoturbidimetry (Biosystems S.A., Costa Brava,
Barcelona, Spain) using a computerized Mindray BS 120 device.
Other biochemical analysis
Total cholesterol (TC), low density lipoprotein-cholesterol (LDL-
C), high density lipoprotein-cholesterol (HDL-C), triglycerides
(TGC), glucose and C-reactive protein (CRP) levels were measured
in patients and CS using standard enzymatic methods (Biosystems
S.A., Costa Brava, Barcelona, Spain).
Statistical analysis
The statistical analysis was carried out using SPSS statisti-
cal package version 22.0 and Excel 2010. The 2 test was used
to compare discrete variables and to test the Hardy-Weinberg
equilibrium. The data for continuous variables were expressed
as means ± standard deviation (SD) and median comparison were
evaluated by Mann–Whitney U test. The odds ratio (OR) was the
measure of association for genotype, allele frequencies and for risk
factors, cutoff of significance was p < 0.05. A binary multivariate
logistic regression was performed to determine adjusted risk of
independent categoric variables (including ApoB/ApoA-I ratio) over
the dependent variable ACS.
Results
Clinical variables
Demographic and biochemical parameter information for both
groups (300 ACS and 300 CS) is shown in Table 1. Men tended to
triple the cases of ACS (221 men and 79 women); CS were in a 1/1
ratio (144 men and 156 women). The most common risk factors in
ACS were hypertension (64.4%), sedentary lifestyle (50.5%) and dia-
betes mellitus (50.2%, Table 2). All patients were under treatment,
95.9% of them received acetylsalicylic acid; 92.5% statins and 90.8%
clopidogrel among others (Table 2).
Genotype and allele frequencies
Genotype distributions of rs670, rs5070 and rs693 polymor-
phisms were in accordance with Hardy-Weinberg equilibrium
(p = 0.154, 0.435 and 0.660 respectively). Neither genotype nor
between groups, pointing out these polymorphisms are not suscep-
tibility genetic markers for ACS in the Western Mexican population
study is weak (␤ = 15%) and these findings must be taken carefully.
There was no linkage disequilibrium (LD) between the two sites
evaluated in APOA1 gene (D = 0.387, r2 = 0.003, p = 0.38), thus these
genetic variants must be analyzed individually.
ApoA-I and ApoB serum levels
We analyzed if rs670, rs5070 and rs693 polymorphisms influ-
did not find any association (data not shown). However, ApoA
levels from patients were decreased when compared with CS
(161.4 mg/dL vs 195.1 mg/dL, p <0.001); the levels of ApoB were
decreased as well (136.9 mg/dL vs 167.0 mg/dL; p < 0.001) (Table 1).
Atherogenic risk (Apo B/ApoA-I) was calculated by gender in each
group (since the ratios are different for each gender as suggested
by the INTERHEART study). We found that women had an athero-
genic risk ratio of 0.75 and men had a ratio of 0.85 in ACS. In our CS
group, women had a risk ratio of 0.83 and men presented a ratio of
G Model
ARTICLE IN PRESS
4 F. Casillas-Muñoz et al. / Med Clin (Barc). 2017;xxx(xx):xxx–xxx

Table 1
Demographic and clinical characteristics in ACS and CS groups.

Parameter CS ACS p* Reference values

Mean (SE) Mean (SE)

Age (years) 55.6 (10.0) 62.8 (10.9) NS –

Weight (kg) 75.0 (16.7) 75.5 (14.0) NS –
Height (cm) 167 (16.6) 165 (15.8) NS –
BMI 26.9 (5.3) 27.4 (4.3) NS
Total cholesterol (mg/dL) 171.2 (95.3) 115.3 (34.4) <0.001 150–199
Fasting glucose (mg/dL) 117.8 (89.8) 138.7 (57.6) <0.001 75–105
Triglycerides (mg/dL) 116.5 (63.5) 89.1 (29.2) <0.001 <200
LDL-C (mg/dL) 73.1 (32.0) 43.5 (17.5) <0.001 <130
HDL-C (mg/dL) 40.0 (20.0) 19.7 (10.4) <0.001 >40
PCR (mg/L) 3.8 (7.3) 19.9 (15.1) <0.001 1–10
APOA-I (mg/dL) 195.1 (25.2) 161.4 (28.4) <0.001 94–178
APOB (mg/dL) 167.0 (34.2) 136.9 (33.6) <0.001 63–133
APOB/APOA-I 0.9 (0.2) 0.9 (0.5) 0.347

CS: control subject; ACS: acute coronary syndrome; BMI: body mass index, CK: creatine phosphokinase, CK-MB: creatine phosphokinase isoform MB.
*
p = Mann–Whitney U. NS: non significance.

Table 2
Risk factors and treatments by ACS and CS groups.

Risk factors CS ACS Treatmenta ACS

n % n % n %

HBP 81 (29.1) 190 (64.4) NSAID’s with antithrombotic activity (acetylsalicylic 283 95.9%
acid)
Sedentarism 37 (13.3) 149 (50.5) Statins 273 92.5%
DM2 48 (17.2) 148 (50.2) Antiplaquetary drugs (Clopidogrel) 268 90.8%
Smoking 32 (11.5) 143 (48.5) Antihypertensives (captopril, enalapril, losartan, 227 76.9%
valsartan, furosemide and spironolactone)
FHCD – – 125 (42.4) Anticoagulants (heparin, andenoxaparine) 200 67.8%
Dyslipidemia 33 (11.8) 123 (41.7) Beta blockers 170 57.6%
Obesity 25 (9.0) 83 (28.1) Nitrates (Isosorbide) 63 21.4%
Overweight 36 (12.9) 114 (38.6) – – –
Recurrent infarction – – 41 (13.9) – – –

CS: control subjects; ACS: acute coronary syndrome; FHCD: family history of cardiovascular disease; HBP: high blood pressure; NSAID’s: nonsteroidal anti-inflammatory
drugs.
a
There were no Drugs used by CS.

Table 3 0.88. According to INTERHEART and AMORIS recommendation, the

Allele and genotype distribution of APOA1 and APOB polymorphisms in CS and ACS.
range ratio for low cardiovascular risk in males must be between
CSn = 300 (%) ACSn = 300 (%) OR (IC) p 0.40 and 0.69; moderate risk most be 0.70 to 0.89 and high risk
75 G>A APOA1 (rs670) 0.90 to 1.10. In females, the range ratio for low cardiovascular risk
Genotype is between 0.30 and 0.69; moderate risk is 0.60 to 0.79 and high
G/G 157 (52.3) 143 (47.7) – – risk is 0.80 to 1.00.
G/A 113 (37.7) 125 (41.7) 1.214 (0.864–1.707) 0.26 We stratified serum data according gender and groups and we
A/A 30 (10.0) 32 (10.6) 1.171 (0.678–2.024) 0.57
found that ApoA-I serum levels were higher in Females of both
Allele 2n = 600 (%) 2n = 600 (%)
G 427 (71.2) 411 (68.5) – – groups (Fig. 1); afterwards we stratified ACS by diagnosis and we
A 173 (28.8) 189 (31.5) 1.135 (0.887–1.453) 0.31 found that male patients with Unstable Angina (UA) had statisti-
+83 C>T APOA1 (rs5070) cally higher serum levels of ApoA-I compared with Non-ST Segment
Genotype
Elevation Myocardial Infarction (NSTEMI, p = 0.03) and patients
C/C 275 (91.7) 276 (92.0) –
C/T 25 (8.3) 24 (8.0) 0.957 (0.533–1.716) 0.88 with ST Segment Elevation Myocardial Infarction (STEMI, p = 0.03).
T/T 0 0 – – In females, patients with UA had statistically higher serum levels of
Allele ApoA-I than patients with STEMI (p = 0.03, Fig. 2). In patients, ApoB
C 575 (95.8) 576 (96.0) – – levels were similar by gender and diagnostic thus they were not
T 25 (4.2) 26 (4.0) 0.958 (0.541–1.698) 0.88
stratified.
2488 C>T APOB (rs693)
Genotype A binary multivariate logistic regression was performed to
C/C 110 (36.7) 121 (40.3) – – determine if ApoB/ApoA-I ratio is an independent parameter pre-
C/T 142 (47.3) 142 (47.4) 0.909 (0.642–1.287) 0.59 dictor of risk in our population adjusted by risk factors (Table 4).
T/T 48 (16.0) 37 (12.3) 0.701 (0.425–1.156) 0.16
For this task, we categorized this ratio and it was divided in quin-
Allele
C 362 (60.3) 384 (64.0) – –
tiles (the bottom quintile being the reference for comparison to
T 238 (39.7) 216 (36.0) 0.856 (0.677–1.081) 0.19 the other quintiles). The presence of overweight (OR: 4.208) obe-
CS: control subjects; ACS: acute coronary syndrome; OR: odds ratio; n: sample size;
sity (OR: 4.938), diabetes mellitus type 2 (OR: 3.43), dyslipidemia
CI: confidence interval; p: probability value. (OR: 2.453), high blood pressure (OR: 2.433) and smoking (OR:
5.286) are strong predictors of ACS (p < 0.001); ApoB/ApoA-I ratio
showed a marginal statistical significance only when the third quin-
tile was compared against the first but in a protection way (OR:
0.233).
G Model
ARTICLE IN PRESS
F. Casillas-Muñoz et al. / Med Clin (Barc). 2017;xxx(xx):xxx–xxx 5

250

240 p=1.9 x 10 -7 -4
p=0.5 x 10
230

220

ApoA-I (mg/dI)
210

200

190

180

170

160

150

M
F

F
M
CS, Md (H): 187.7 mg/dI ACS, Md (H): 164.7 mg/dI
Md (M): 202.4 mg/dI Md (M): 180.7 mg/dI

Fig. 1. Comparison of ApoA-I levels between gender in control subjects (CS) and acute coronary syndrome (ACS). M: male; F: female. Md: median.

260 p=0.015 Discussion

250
The crucial role of ancestry in ACS is highlighted by the 3-
240
p=0.03 fold higher risk documented for individuals with family history of
230 coronary atherosclerosis.14 Zdravkovic et al. determined that the
220 heritability of cardiovascular disease was 38% in women and 57%
ApoA-I (mg/dI)

p=0.03 in men. These researchers concluded that the underlying cause of

210
cardiovascular disease was the atherosclerotic process which was
200
the result of an interaction between the aging process and intrinsic
190 or extrinsic factors such as some polymorphisms in genes of lipid
180 metabolism.5
Although the biological mechanism is unknown, the role
170
of −75G>A and 83C>T polymorphisms of APOA1 gene in lipid
160 metabolism and other risk factors related to cardiovascular dis-
150 ease are ineffable. In an Indian population, Dawar et al., found
an association of these polymorphisms with myocardial infarc-
M

tion and described associated variations in the values of HDL and

UA, Md (M): 176,3 mg/dI; Md (F): 209,1 mg/dI
ApoA-I.15 Both polymorphisms were significantly associated with
NSTEMI, Md (M): 171,3 mg/dI; Md (F): 173,3 mg/dl coronary artery disease in terms of number of affected vessels.16 In
another study, the −75A and 83T alleles showed significant asso-
STEMI, Md (M): 161,8 mg/dI; Md (F ): 173,9 mg/dI ciation with hypertension whereas the 83C allele was associated
with obesity and hypertension in the presence of cardiovascular
Fig. 2. Comparison of ApoA-I and ApoB serum levels between subgroups in acute
disease.17 Likewise, the −75GA genotype conferred an increased
coronary syndrome. M: male; F: female. Md: median. UA: unstable angina, NSTEMI:
non-ST segment elevation myocardial infarction. STEMI: ST segment elevation risk for atherogenesis and dyslipidemia to adult Turks.18 In con-
myocardial infarction. trast, we did not find direct association of −75 G>A (rs670) and
83C>T (rs5070) polymorphisms of APOA1 gene with ACS or with
Table 4
Binary multivariate logistic regression to determine if ApoB/ApoA-I ratio is an inde- any variation in serum levels of HDL or ApoA-I that conveys to an
pendent predictor parameter of risk in our population. increased risk for cardiovascular disease.
Annotations into HaploRev v.4 allowed us to infer about the
Risk factor p OR 95% I.C.
clinical impact of these non-coding variants: the rs670 variant
Inferior Superior overlapped with a motif located in enhancers in 12 different tissues
APOB/APOA-I (1 vs 2) 0.784 1.103 0.549 2.217 and it also had a correlation with DNase I hypersensitive sites
APOB/APOA-I (1 vs 3) 0.045 0.479 0.233 0.983 (DHSs) across 18 different cell types; the provided enrichment
APOB/APOA-I (1 vs 4) 0.074 0.525 0.259 1.065 analyses of these enhancer sequences identified several known
APOB/APOA-I (1 vs 5) 0.345 0.704 0.339 1.460
Overweight <0.001 4.208 2.459 7.203
cell-type specific bound proteins (FOSL2, FOXA1, FOXA2, HEY1,
Obesity <0.001 4.938 2.692 9.061 HNF4A, HNF4G, P300, POL2, RAD21, RFX5, SP1, SREBP1, TBP,
DM2 <0.001 3.430 2.063 5.7047 TCF12 and TCF4).19 Afterwards, we searched for human chipseq
Dyslipidemia 0.010 2.453 1.441 4.176 experiments and we found that some of these transcription factors
HBP <0.001 2.433 1.511 3.920
(FOXA1, FOXA2, HNF4A, HNF4G) are liver-specific regulators.20
Smoking <0.001 5.286 3.132 8.923
The rs5070 variant overlapped with a motif located in enhancers
Dependent variable: ACS. APOB/APOA-I: ratio Apolipoproteína B/Apolipoprotein A-
in 11 different type of tissues, it has also a correlation with DNase
I; (1 vs 2): first quintile vs second quintile, (1 vs 3): first quintile vs third quintile,
(1 vs 4): first quintile vs fourth quintile, (1 vs 5): first quintile vs fifth quintile. ACS:
I Hypersensitive Sites (DHSs) on Hepatocellular Carcinoma Cell
acute coronary syndrome, DM2: diabetes mellitus type 2, HTA: high blood pressure. Lines (HEpG2), although there was not overlapping with binding
G Model
ARTICLE IN PRESS
6 F. Casillas-Muñoz et al. / Med Clin (Barc). 2017;xxx(xx):xxx–xxx
proteins sites.19 According with these results we can conclude that
both genetic variants are under high transcriptional regulation in
liver and the different phenotypes observed on other populations
(not ours) could be explained by the global effect of these tran-
scription factors over hepatocellular regulation. Unfortunately, at
the best of our knowledge, there are not cellular or animal models
focusing in the genetic variants we are studying to explain the
specific biological function in hepatic regulation.
Regarding 2488 C>T polymorphism of APOB gene, a meta-
analysis showed that this polymorphism gives a significant risk
toward the development of Cardiovascular Hearth Disease (CHD)
in Han Chinese population (p = 0.013), overall allelic OR (95% CI)
was 2.25 (CI 1.40–3.62).21 This polymorphism has also been related
with dyslipidemias: heterozygotes 2488 CT have showed twofold
increase in the risk of dyslipidemia and the homozygous TT showed
4 times higher risk to develop it.22 The polymorphic site located at
2488 in exon 26 of APOB gene, involves a silent variation at the
third nucleotide of codon threonine at amino acid 2488, so there
is not amino acid change.23 This silent variation is only 600–900
residues of the two domains of the LDL-C receptor binding site of
apolipoprotein B; therefore, this SNP has been proposed to be in
linkage disequilibrium with polymorphisms affecting this binding
regions; variations in this site may lead to a different affinity to
the LDL receptor and therefore it may have a different catabolism
for LDL-C.24 To the best of our knowledge there is no database or
program that analyze the possible biological function of this poly-
morphism.
Quantification of apolipoproteins in the estimation of coronary
risk
We did not find any association between genotypes and serum
levels of ApoA-I or Apo-B and other biochemical parameters.
Nonetheless, in vitro studies are needed in order to assess the role
of such variants over their transcriptional and translational prod-
ucts. However, the sole quantification of apolipoproteins has been
applied in the estimation of coronary risk and has served on the
characterization of several classes of dyslipidemia.25
In our whole population, men had lower ApoA-I values than
women as previously described,10 We corroborated this sex dif-
ference with a linear regression analysis adjusted by risk factors
(p = 0.0008). This sex difference has been attributable to a higher
basal synthesis of Apoa-I in women26 and estrogen-progestin
replacement therapy in women which increases HDL-C and Apoa-
I.27 Unfortunately, we did not register this drug consumption in
females, indeed this is one of our study limitations. By diagnosis, we
found that males with UA had higher levels of Apoa-I than NSTEMI
and STEMI and females with UA had higher levels than STEMI
(Fig. 2); it is speculated that HDL-C decrease immediately after an
infarction due to inflammatory response and utilization of choles-
terol for tissue repairing and hormonal synthesis28 ; we assume that
as Apoa-I is the main apolipoprotein of HDL-C, it decreased by the
same compensatory mechanisms, although we have not found the
same with HDL-C probably because this measure is more fluctuat-
ing due to several medical and environmental factors.29
In our study, patients had levels of HDL-C of 19.7 mg/dL below
the acceptable lower-level threshold (levels must be over 40),
reflecting an eminent risk due to atherosclerosis. The plasma LDL-C
is the measure most established as a predictor of Coronary artery
disease, however some epidemiological studies have proposed that
the quantification of ApoB and ApoA-I are better predictors of
coronary events and have shown that the ratio Apo B/ApoA-I is
an independent parameter predictor for cardiovascular disease.30
ApoB represents the number of particles that contribute to the
accumulation of cholesterol in the plaque and it is present in
low density lipoproteins (LDL), intermediate density lipoproteins
(IDL) and very low density lipoproteins (VLDL),31 ApoA contributes
directly to the clearance of cholesterol of tissues (such as the
atherosclerotic plaque)32 ; therefore Apo B/ApoA-I ratio has been
proposed as an atherogenic risk biomarker.
The INTERHEART study also was conducted in Latin American
population. This study found that variables associated with an
increased risk of myocardial infarction were: stress psychosocial
(OR, 2.81; 95% CI, 2.07 to 3.82), history of hypertension (OR, 2.81;
95% CI, 2.39 to 3.31), diabetes mellitus (OR, 2.59; 95% CI, 2.09 to
3.22), current smoking (OR, 2.31; 95% CI, 1.97 to 2.71), increased
ratio of waist/hip (OR for the first against third tertile of 2.49; 95%
CI, 1.97 to 3.14), and increased ratio of ApoB/ApoA-I (OR for the first
against the third tertile of 2.31; 95% CI, 1.83 to 2.94). This study con-
cluded that one of the main factors that contribute to cardiovascular
risk in the population were abnormal lipids.33
According to INTERHEART and AMORIS, we can conclude that
in our group of patients, women had a moderate atherogenic risk
ratio of 0.75 (moderate risk proposed values: 0.60 to 0.79), likewise
men who had a ratio of 0.85 (moderate risk proposed values: 0.70 to
0.89). In our CS group, women had an elevated atherogenic risk ratio
of 0.83 (high risk values: 0.80–1.00) and men presented a moderate
risk with a ratio of 0.88.
The present results suggest that underestimation of ApoB/ApoA-
I and therefore risk reduction in our ACS group compared to CS
group may be primarily related to changes in the balance of the
apolipoprotein particles due to lipid lowering drugs as the samples
were obtained after hospitalization and medication; even so, the
predictive risk given by ApoB/ApoA-I ratio, according with INTER-
HEART and AMORIS values, is maintained in both groups. These
findings are supported by Walldius et al, as they found that statins
reduced ApoB and increased ApoA-I levels, which in turn leads to
a reduction in apoB/apoA-I ratio by about 20–40%.34
As it is observed in Table 1, LDL-C levels were shown to be
reduced in our ACS group most probably because of lipid-lowering
therapy, so those levels have lost predictive power; however, the
predictive value given by Apo B/Apo A-I is maintained (high risk
ratio: CS: 0.9 ± 0.2, ACS: 0.9 ± 0.5).
We have extrapolated our results to INTERHEART and AMORIS
values, which have been obtained and adapted after a broad
prospective study in individuals (our study had a transversal design
and furthermore it has been applied to assess the risk after ther-
apy in patients and to assess the risk in control subjects without
therapy at only one point time); even so, on the one hand we can
say that predictive value for risk given by Apo B/Apo A-I in our ACS
group is moderated (in comparison with LDL-C levels which are
shown very lowed) and for the other hand, we can say that our CS
group maintains a significantly higher ratio and then we can follow
up this group until the onset of acute event to estimate the real
predictive risk according to INTERHEART and AMORIS. Our results
could mean that for our ACS group, lipid-lowering drugs doses are
still not enough to reduce the levels of atherogenic particles.
In the binary multivariate logistic regression analysis,
ApoB/ApoA-I ratio showed statistical significance only when
the third quintile was compared against the first quintile but there
was no risk calculated (OR: 0.479), although these data could be
misrepresented as lipid values in patients are biasing the risk
due to lipid-lowering therapy. According to this analysis, this
ratio is not a predictor of ACS in our population; furthermore,
our analysis has a cross sectional design so we do know the real
behavior of Apob and ApoA-I levels during time until the presence
of the variable outcome. However, reference values proposed by
INTERHEART and AMORIS could be more robust and could be used
to determine the atherogenic risk in our population as the risk
observed in our population in both genders and in both groups, is
maintained even after therapy.
G Model
ARTICLE IN PRESS
F. Casillas-Muñoz et al. / Med Clin (Barc). 2017;xxx(xx):xxx–xxx
Summarizing, this study has shown that the polymorphisms
studied in APOA1 and APOB genes have not any contribution to risk
in ACS and they have no effect on their apolipoprotein concentra-
tions; furthermore, ApoB/ApoA-I ratio was not a predictor of risk for
cardiovascular disease in our population, but we have found that
other biochemical parameters such as. ApoA-I, ApoB and HDL-C
could be better biomarkers of cardiovascular risk than other mea-
surements commonly accepted in medical practice such as LDL-C
and could indicate if doses of statins are adequate to reduce the
levels of atherogenic particles.
Funding
This study was supported by grant no. PROSNI-2016 to Jorge
Ramón Padilla-Gutiérrez.
Conflict of interest
The authors declare that there is no conflict of interests regard-
ing the publication of this paper.
References
1. World Health Organization. Cardiovascular diseases (CVDs) [Internet]. WHO;
2017. Available from: http://www.who.int/mediacentre/factsheets/fs317/en/
[accessed 17.07.16].
2. Jerjes-Sanchez C, Martinez-Sanchez C, Borrayo-Sanchez G, Carrillo-Calvillo J,
Juarez-Herrera U, Quintanilla-Gutierrez J. Third national registry of acute coro-
nary syndromes (RENASICA III). Arch Cardiol Mex. 2015;85:207–14.
3. Principales causas de mortalidad por residencia habitual, grupos de edad
y sexo del fallecido [Internet]. Available from: http://www.inegi.org.mx
/est/contenidos/proyectos/registros/vitales/mortalidad/tabulados/pc.asp?t=
14&c=11817 [accessed 13.09.17].
4. Rosenson RS, Brewer HB, Rader DJ. Lipoproteins as biomarkers and therapeutic
targets in the setting of acute coronary syndrome. Circ Res. 2014;114:1880–9.
5. Zdravkovic S, Wienke A, Pedersen NL, Marenberg ME, Yashin AI, de Faire U.
Heritability of death from coronary heart disease: a 36-year follow-up of 20 966
Swedish twins. J Intern Med. 2002;252:247–54.
6. Reguero JR, Cubero GI, Batalla A, Alvarez V, Hevia S, Cortina A, et al. Apolipopro-
tein A1 gene polymorphisms and risk of early coronary disease. Cardiology.
1998;90:231–5.
7. Ye SQ, Kwiterovich PO. Influence of genetic polymorphisms on responsiveness
to dietary fat and cholesterol. Am J Clin Nutr. 2000;72 Suppl.:1275s–84s.
8. Yusuf S, Hawken S, Ounpuu S, Dans T, Avezum A, Lanas F, et al. Effect
of potentially modifiable risk factors associated with myocardial infarc-
tion in 52 countries (the INTERHEART study): case–control study. Lancet.
2004;364:937–52.
9. Walldius G, Jungner I, Holme I, Aastveit AH, Kolar W, Steiner E. High
apolipoprotein B, low apolipoprotein A-I, and improvement in the prediction
of fatal myocardial infarction (AMORIS study): a prospective study. Lancet.
2001;358:2026–33.
10. Walldius G, Jungner I. The apoB/apoA-I ratio: a strong, new risk factor for car-
diovascular disease and a target for lipid-lowering therapy – a review of the
evidence. J Intern Med. 2006;259:493–519.
11. Lima LM, Carvalho M, Sousa MO. Apo B/apo A-I ratio and cardiovascular risk
prediction. Arq Bras Cardiol. 2007;88:e187–90.
12. Amsterdam EA, Wenger NK, Brindis RG, Casey DE, Ganiats TG, Holmes DR,
et al. 2014 AHA/ACC guideline for the management of patients with non-
ST-elevation acute coronary syndromes: executive summary. A report of the
7
American College of Cardiology/American Heart Association Task Force on Prac-
tice Guidelines. Circulation. 2014;130:2354–94.
13. Antman E, Bassand J-P, Klein W, Ohman M, Lopez Sendon JL, Rydén L, et al.
Myocardial infarction redefined—a consensus document of The Joint European
Society of Cardiology/American College of Cardiology Committee for the redef-
inition of myocardial infarction. J Am Coll Cardiol. 2000;36:959–69.
14. Lloyd-Jones DM, Nam BH, D’Agostino RB, Levy D, Murabito JM, Wang TJ,
et al. Parental cardiovascular disease as a risk factor for cardiovascular dis-
ease in middle-aged adults: a prospective study of parents and offspring. JAMA.
2004;291:2204–11.
15. Dawar R, Gurtoo A, Singh R. Apolipoprotein A1 gene polymorphism (G-75A and
C+83T) in patients with myocardial infarction: a pilot study in a north Indian
population. Am J Clin Pathol. 2010;134:249–55.
16. Heng CK, Low PS, Saha N. Variations in the promoter region of the apolipoprotein
A-1 gene influence plasma lipoprotein(a) levels in Asian Indian neonates from
Singapore. Pediatr Res. 2001;49:514–8.
17. Chen ES, Mazzotti DR, Furuya TK, Cendoroglo MS, Ramos LR, Araujo LQ, et al.
Apolipoprotein A1 gene polymorphisms as risk factors for hypertension and
obesity. Clin Exp Med. 2009;9:319–25.
18. Coban N, Onat A, Guclu-Geyik F, Komurcu-Bayrak E, Can G, Erginel-Unaltuna
N. Gender-specific associations of the APOA1 −75G>A polymorphism with
several metabolic syndrome components in Turkish adults. Clin Chim Acta.
2014;431:244–9.
19. Ward LD, Kellis M. HaploReg: a resource for exploring chromatin states, conser-
vation, and regulatory motif alterations within sets of genetically linked variants.
Nucleic Acids Res. 2012;40:D930–4, http://dx.doi.org/10.1093/nar/gkr917
20. Wang J, Zhuang J, Iyer S, Lin X, Whitfield TW, Greven MC, et al. Sequence fea-
tures and chromatin structure around the genomic regions bound by 119 human
transcription factors. Genome Res. 2012;22:1798–812.
21. Chen Y, Lin M, Liang Y, Zhang N, Rao S. Association between apolipoprotein B
XbaI polymorphism and coronary heart disease in Han Chinese population: a
meta-analysis. Genet Test Mol Biomarkers. 2016;20:304–11.
22. Rodrigues AC, Sobrino B, Genvigir FD, Willrich MA, Arazi SS, Dorea EL, et al.
Genetic variants in genes related to lipid metabolism and atherosclerosis, dys-
lipidemia and atorvaestatina response. Clin Chim Acta. 2013;417:8–11.
23. Zhao WY, Huang JF, Wang LY, Li HF, Zhang PH, Zhao Q, et al. Association of the
apolipoprotein B gene polymorphisms with essential hypertension in Northern
Chinese Han population. Biomed Environ Sci. 2007;20:260–4.
24. Leren TP, Berg K, Hjermann I, Leren P. Further evidence for an association
between the Xbal polymorphism at the apolipoprotein B locus and lipoprotein
level. Clin Genet. 1988;34:347–51.
25. Wieland H. The clinical relevance of apolipoprotein determination. In: Rosseneu
M, Widhalm K, Jarausch J, editors. Apolipoproteins in lipid disorders [Inter-
net]. Viena: Springer; 1991 [accessed 25.04.15]. p. 63-8. Available from:
http://link.springer.com/chapter/10.1007/978-3-7091-9148-4 6.
26. Schaefer EJ, Zech LA, Jenkins LL, Bronzert TJ, Rubalcaba EA, Lindgren FT, et al.
Human apolipoprotein A-I and A-II metabolism. J Lipid Res. 1982;23:850–62.
27. Rodriguez-Alemán F, Torres JM, Cuadros JL, Ruiz E, Ortega E. Effect of
estrogen-progestin replacement therapy on plasma lipids and lipoproteins in
postmenopausal women. Endocr Res. 2000;26:263–73.
28. Correia LC, Twickler MT, Sposito AC. Mechanistic insights and clinical relevance
of the interaction between acute coronary syndromes and lipid metabolism.
Semin Vasc Med. 2004;4:197–202.
29. Rader DJ, Hovingh GK. HDL and cardiovascular disease. Lancet.
2014;384:618–25.
30. Sierra-Johnson J, Fisher RM. Is it time to discard the apo B:apo A-I ratio as a
predictor of cardiovascular disease? Nat Rev Cardiol. 2008;5:18–9.
31. Chan DC, Watts GF. Apolipoproteins as markers and managers of coronary risk.
QJM. 2006;99:277–87.
32. Libby P, Ridker PM, Hansson GK. Progress and challenges in translating the
biology of atherosclerosis. Nature. 2011;473:317–25.
33. Lanas F, Avezum A, Bautista LE, Diaz R, Luna M, Islam S, et al. Risk factors for
acute myocardial infarction in Latin America: the INTERHEART Latin American
study. Circulation. 2007;115:1067–74.
34. Walldius G, Aastveit AH, Jungner I. Stroke mortality and the apoB/apoA-I ratio:
results of the AMORIS prospective study. J Intern Med. 2006;259:259–66.