99

［Japanese Journal of Water Treatment Biology Vol.43 No.2 99 111 2007］

Degradation of the Cyanobacterial Hepatotoxin

Microcystin by Bacteria Isolated
from a Monoxenic Culture
of the Flagellate Monas guttula
NAOSHI FUJIMOTO1, NAOKI OHNO1, KUNIHIRO TANAKA1, ITARU NARAHARA1,
AKIHIRO OHNISHI1, MASAHARU SUZUKI1, NORIO IWAMI2,
MOTOYUKI MIZUOCHI3, and YUHEI INAMORI3
1
Faculty of Applied Bioscience, Tokyo University of Agriculture
/1 1 1 Sakuragaoka, Setagaya-ku, Tokyo 156 8502, Japan
2
Department of Environmental Systems, Meisei University
/2 1 1 Hodokubo, Hino, Tokyo 191 8506, Japan
3
Independent Administrative Institution National Institute for Environmental Studies
/16 2 Onogawa, Tsukuba-shi, 305 8506, Japan

Abstract
Microcystins are a group of cyclic heptapeptide hepatotoxins produced by the
cyanobacteria. Two microcystin-degrading strains of bacteria (MG and MG ) were
isolated from a monoxenic culture of Monas guttula preying on Microcystis viridis. Both
strains were related to Sphingopyxis and Novosphingobium groups based on phylogenetic
analysis of S rDNA. Degradation of microcystin by these strains was tested under the
following conditions: temperature from to ℃, pH from . to . , three different
microcystin analogs and initial microcystin concentrations from to μg･l– . The rate
of microcystin RR degradation by strain MG significantly increased at ℃, whereas
the effect of temperature on the degradation rate by strain MG was small. Both strains
could degrade microcystin under alkaline pH. Both strains could degrade microcystin RR,
YR and LR. The degradation rate of microcystin RR by the two strains was faster than
the degradation rates of microcystin YR and LR. Both strains could degrade microcystin
LR at all initial concentrations.

Key words: Microcystis, Monas guttula, predation, microcystin-degrading bacteria,

16S rDNA

center in Caruaru, Brazil that resulted from

INTRODUCTION
Microcystins are a group of cyclic
heptapeptide hepatotoxins produced by the
cyanobacteria Microcystis, Anabaena,
Planktothrix and Nostoc1 – 2). The mass
occurrence of toxic cyanobacteria in eutrophic
lakes and reservoirs worldwide causes the
death of animals and poses a health hazard
for humans. Many patients died from an
outbreak of acute liver failure at a dialysis
the use of microcystin-contaminated water
for dialysis treatment3). The microcystins
have also been implicated as relating to
cancer through animal experiments and a
retrospective cohort study4 – 5). In 1998, the
World Health Organization recommended a
provisional guideline value of 1 μg l–1 for
microcystin LR6). Globally, many people
might be exposed to toxins in areas where
there is no effective system for treating water
100
contaminated with cyanobacterial toxins. To
avoid exposure to these toxins, technologies
for removing cyanobacteria and their toxins
from water are necessary.
Several bacterial strains with microcystin-
degrading activity have been isolated.
Bacterial degradation of microcystin LR was
confirmed in surface water samples, and the
microcystin-degrading strain Sphingomonas
MJ PV was subsequently isolated7 – 8). The
microcystin-degrading bacterium MD 1 strain
was isolated from Lake Kasumigaura, Japan
and was proved to be related to Sphingomonas
on the basis of 16S rDNA sequence analysis9).
The strain MD 1 could degrade microcystin
LR, YR and RR. A bacterium isolated from a
hypertrophic lake (strain Y2) was shown to
be phylogenetically distinct from any
established species of Sphingomonas based
on 16S rDNA sequence analysis10). The Y2
strain was characterized using chemo-
taxonomic and phenotypic analysis and was
proposed to be a new genus and species,
Sphingosinicella microcystinivorans11).
The enzymatic pathway for bacterial
degradation of microcystin LR has also been
determined8). Bourne et al. cloned and
screened the gene library of Sphingomonas
MJ PV and detected the microcystin
degrading gene clusters, mlrA, mlrB, mlrC
and mlrD12). The enzyme encoded by mlrA
can cleave the ADDA Arg peptide bond in
microcystin LR and open the cyclic structure.
Linearized microcystin LR is degraded to
individual amino acides by the peptidases
encoded by mlrB and mlrC. The gene mlrD
encodes the transporter protein that allows
microcystin uptake into the cell. Saito et al.
discovered the existence of a gene homologous
to mlrA in the microcystin-degrading strains
MD 1 and Y213).
In the biological treatment process for
drinking water, some studies demonstrate
degradation of microcystin. Slow sand
filtration has been shown to be an effective
treatment for eliminating microcystins from
drinking water14). Ho et al. reported that
biological sand filters could degrade
microcystin LR, and a microcystin-degrading
gene was detected in the biofilm15).
Degradation of microcystin has been
demonstrated using a biofilm attached to the
Japanese J. Wat. Treat. Biol. Vol.43 No.2
honeycomb tube medium in a water treatment
facility16). Xie et al. demonstrated that a bio-
ceramic filter and moving-bed biofilm reactor
could be used to effectively remove
microcystins from Yellow River water17).
In a biological process for treating lake
and reservoir water, it is believed that
removal of microcystin-producing cyano-
bacteria may depend on several processes
such as biofilm adsorption, predation by
protozoa and metazoa and sedimentation of
sloughed biofilm. Microcystins might be
released by lysis of cyanobacteria or excreted
intact by protozoa and metazoa, followed by
degradation of dissolved microcystin by
microcystin-degrading bacteria in biofilms.
However, the mechanism of microcystin
removal in a microbial ecosystem consisting
of cyanobacteria, their predators and bacteria
has yet to be determined.
The flagellate Monas guttula, existing in
biofilms at lake water treatment plants, was
isolated from the water of Lake Kasumigaura,
Japan. M. guttula has been cultured in a
suspension of Microcystis viridis because M.
guttula preys on M. viridis. The M. guttula
culture also contains co-existing bacteria as
they are not removed during the isolation
process. A simultaneous decrease in the
concentration of microcystins has been
observed when M. guttula preys on
Microcystis18). Moreover, when purified micro-
cystin is added to the suspension in a
predation experiment, the microcystin con-
centration decreases prior to the growth of
M. guttula, suggesting that the co-existing
bacteria contribute to the degradation of
microcystin. In the present study, microcystin-
degrading bacteria were isolated from a
monoxenic culture of M. guttula, and the
characteristics of microcystin degradation
were examined to clarify the mechanism of
microcystin removal and the role of
microcystin-degrading bacteria in cultures of
M. guttula.
MATERIALS AND METHODS
Cyanobacteria and protozoa used An
isolate of M. viridis from Lake Kasumigaura
was obtained from the National Institute for
Environmental Studies, the Independent
Administrative Institution (culture collection
 Microcystin-Degrading Bacteria Isolated from Culture of Protozoa
No. NIES 102). This strain is axenic and
known to produce three microcystins,
microcystin RR, YR and LR18).
M. viridis, prey of M. guttula, was
cultivated in M 11 medium consisting of 100
mg of NaNO3, 75 mg of MgSO4･7H2O, 40 mg
of CaCl2 2H2O, 20 mg of Na2CO3, 1 mg of
FeSO4･7H2O and 1 mg of Na2･EDTA･2H2O
in 1 liter of Milli Q water, for two weeks at
30℃. The pH was adjusted to 8. Light was
supplied continuously with fluorescent bulbs
at a photon fluence rate of 0.39×1016 quanta･
cm–2･s–1 (2,000 lx).
Protozoa used in this study were isolated
from surface water of Lake Kasumigaura in
autumn. Droplets of lake water and sterilized
water were placed on a glass slide to isolate
protozoa under the microscope. An individual
protozoan cell in lake water on a glass slide
was drawn into a capillary pipette and
transferred to a droplet of sterilized water.
The individual protozoan cell in a droplet of
sterilized water was again drawn into a
capillary pipette and transferred to another
droplet of sterilized water. This washing
process was repeated a few times, and
ultimately the individual protozoan cell was
transferred to a suspension of M. viridis in a
test tube. This culture was incubated at 30℃
in total darkness. A clone culture in which
the protozoa grew from an individual cell
was subcultured periodically by transferring
a small amount of culture at the stationary
phase to a new suspension of M. viridis.
Characteristics of the isolated protozoan were
consistent with those of M. guttula: spherical
to ovoid, 14–16 μm long, free-swimming or
attached, longer flagellum about one to two
times the body length19). Thus, the isolated
protozoan was identified as M. guttula. The
clone culture of M. guttula was used to
isolate microcystin-degrading bacteria.
Isolation of microcystin-degrading bacteria
One milliliter of M. guttula culture was
added to a 10 ml suspension of M. viridis
and was cultured at 30℃ in total darkness
for ten days (to stationary-phase). The
stationary-phase M. guttula culture was then
filtered through a membrane filter (pore size:
5 μm, Minisart, Sartorius) to remove the M.
guttula from the suspension. Two milliliters
101
of the filtrate containing the co-existing
bacteria were then inoculated into 8 ml
liquid medium9) (5 mg Ca(NO3)2･4H2O, 10 mg
KNO3, 5 mg NaNO3, 5 mg Na2SO4, 5 mg
MgCl2･6H2O, 0.5 mg Na2EDTA･2H2O, 0.05
mg FeCl3･6H2O, 0.5 mg MnCl2･4H2O, 0.05
mg ZnCl2, 0.5 mg CoCl2･6H2O, 0.5 mg
Na2MoO4･2H2O and 2mg H3BO3 in 1 liter of
Milli Q water) in a test tube. Subsequently,
1 ml of 10 mg･l–1 microcystin LR (Wako Pure
Chemical Industries, Ltd.) was added to the
test tube. The bacteria in the liquid medium
that contained microcystin were cultured at
30℃ with shaking (130 rpm, Monosin, Taitec).
The concentration of microcystin LR was
determined by HPLC. When the microcystin
concentration decreased to less than 10% of
the initial concentration, the culture was
diluted and streaked onto a solidified GYP
medium plate, which consisted of 5 g of
peptone, 2.5 g of yeast extract, 1 g of glucose
and 15 g of agar in 1 liter of Milli Q water,
in order to isolate single colonies. To assess
the ability of the isolated bacterial strains to
degrade microcystin, each colony was then
inoculated in liquid medium containing 1
mg･l–1 of microcystin LR, cultured at 30℃
and the microcystin LR concentration was
monitored.
Phylogenetic analysis PCR was per-
formed directly on bacterial colonies (colony
PCR). PCR amplification of the 16S rDNA
gene was conducted using primers 20F (5’
AGTTTGATCATGGCTCA 3’, positions 10 26)
and 1540R (5’ AAGGAGGTGATCCAACGCA
3’, positions 1541 1522) (Escherichia coli
numbering system20)), designed to generate
an amplification product of approximately
1500 base pairs21). For colony PCR, isolated
colonies were picked from plates with a
bamboo stick and suspended in 20μl of PCR
reaction solution. A 20 μl reaction volume
contained 1.6 μl of a 2.5 mM of dNTP, 2 μl
buffer, 2 μl (20 pmol) of each primer solution,
12.35 μl H2O, and 0.05 μl (0.25U) of TaKaRa
Ex Taq polymerase (Takara Bio, Inc.).
Thermal cycling was performed at 95℃ for 3
min followed by 30 cycles of 95℃ for 30 s,
55℃ for 30 s, and 72℃ for 1 min (PTC 200,
MJ Research). The amplified products were
purified using 20% polyethyleneglycol and
102
separated by 1% agarose gel electrophoresis
(Mupid 2, Advance Co.). After staining with
ethidium bromide, amplification was
confirmed by UV illumination (Printgraph,
Atto).
DNA was sequenced with an ABI
PRISM310 (Applied Biosystems) using the
BigDye Terminator Cycle Sequencing Ready
Reaction kit (Applied Biosystems). For 16S
rDNA gene sequencing, primers 20F, 1540R,
350F (5’ CCTACGGGCAGCAGT 3’, positions
341 358), 800F (5’ GTAGTCCACGCCGTAA
ACGA 3’, positions 800 819), and 900R (5’
CGGCCGTACTCCCCAGGCGG 3’, positions
898 879) were used. The sequencing reactions
(20 μl) contained 8μl of Premix (Applied
Biosystems, diluted 1:10 with sequencing
buffer), 3.2 μl of primer, 7.8 μl of H2O, and 1
μl of template DNA. The template DNA was
prepared by diluting PCR products to 2–5
ng･μl–1. Thermal cycling was performed at
96℃ for 2 min followed by 90 cycles of 96℃
for 10 s, 50℃ for 5 s, and 60℃ for 4 min
(PTC 200, MJ Research). After sequencing, a
composite sequence consisting of approxi-
mately 1500 base pairs was determined using
AutoAssembler (Applied Biosystems). Related
sequences were obtained using the FASTA
sequence search program22) of the DNA Data
Bank of Japan (DDBJ).
The 16S rDNA sequences determined were
aligned with 16S rDNA gene sequences of
other strains using CLUSTAL X software23).
Some positions, including gaps and alignment
uncertainties, were omitted from the analysis.
Evolutionary distance matrices were
calculated using the algorithm of Jukes &
Cantor24) with the DNADIST program within
the PHYLIP package25). A phylogenetic tree
was constructed by the neighbor-joining
method26) as implemented within the
NEIGHBOR program of the PHYLIP package.
The stability of relationships was assessed
by a bootstrap analysis of 1000 data sets
using the programs SEQBOOT, DNADIST,
NEIGHBOR and CONSENSE of the PHYLIP
package.
Effect of temperature, pH and initial
microcystin concentration on the rate of
microcystin degradation by the isolated
bacteria The isolated bacteria were grown
Japanese J. Wat. Treat. Biol. Vol.43 No.2
in PY medium (pH 7.0), which consisted of 5
g of peptone and 2.5 g of yeast extract in 1
liter of Milli Q water, at 30℃ for 24 h.
Bacteria in the late logarithmic growth phase
were centrifuged at 6400 ×g for 20 min
(Hitachi Koki Co., CR22GII). The supernatant
was decanted, and the pelleted bacteria were
resuspended in 0.05 M PBS buffer (pH 7).
This washing procedure was repeated three
times with centrifugation as above. Washed
bacteria were inoculated in M 11 medium or
glycine NaOH buffer at an optical density of
0.3 at 660 nm. The glycine NaOH buffer was
used for pH 8.8 and 10. Bacterial suspension
(9 ml) was mixed with 1 ml of 10 mg･l–1
microcystin to establish an initial concen-
tration of 1000 μg･l–1 9). The culture volume
was consequently set at 10 ml.
To investigate the effect of temperature on
the microcystin degradation rate, the test
tubes containing the above bacterial sus-
pension and microcystin RR were shaken
(130 rpm, Monosin, Taitec) in water baths
and kept at a constant temperature of 20, 25
or 30℃. The pH was 7.6 in these samples.
To investigate the effect of pH on
microcystin degradation, four pH values
between 6.8 and 10 were evaluated. To
achieve pH 6.8 and 7.6, the pH of the M 11
medium was adjusted by adding 0.1 M HCl
and 0.1 M NaOH. To achieve pH 8.8 and 10,
50 mM glycine NaOH buffer was used. Test
tubes containing the bacterial suspension
and microcystin RR were shaken (130 rpm)
in a water bath kept at a constant
temperature of 25℃.
The effect of glycine on microcystin RR
degradation by the two strains was evaluated
to assess the effect of glycine NaOH buffer
on microcystin RR degradation in the pH
experiment. Washed bacteria were inoculated
in M 11 medium with and without 50mM
glycine (pH 7.6), and microcystin RR was
added. As above, the bacterial suspension
was shaken and degradation of microcystin
RR was evaluated.
To investigate the degradation of
microcystin RR, YR and LR, the test tubes
containing bacterial suspension and each
microcystin were shaken (130 rpm) in water
baths kept at a constant temperature of
25℃. The pH was 7.6 in these samples.
 Microcystin-Degrading Bacteria Isolated from Culture of Protozoa
The above degradation experiments that
assessed the effects of temperature, pH, and
microcystin analogs were performed in
triplicates.
To investigate microcystin degradation
under various initial microcystin LR
concentrations, the bacterial suspension and
microcystin LR solution were mixed to
achieve an initial microcystin concentration
of 20 to 890 μg･l–1 for strain MG 15 and 17
to 917 μg･l–1 for strain MG 22. The test
tubes were shaken (130 rpm) in a water
bath kept at a constant temperature of 25℃.
This experiment was repeated twice at each
microcystin concentration. The pH was 7.6 in
these samples.
In all degradation experiments, the
bacterial suspensions were removed from the
test tubes periodically and the residual
microcystin concentration was measured
using HPLC. Initial and final bacterial
numbers were determined by DAPI staining
and counting27) using fluorescence microscopy
(BZ 8000, Keyence). The bacterial suspension
was diluted with sterilized Milli Q water,
and DAPI stock solution (Sigma Co.; 10
μg･ml–1 in sterilized Milli Q water) was
added (final concentration, 1μg･ml–1). DAPI
stained bacteria were trapped by vacuum
onto a black membrane filter (pore size: 0.2
μm, Advantec). Filters were then air-dried
and mounted on glass microscope slides with
non-fluorescence immersion oil (Olympus
Co.). DAPI stained bacteria were enumerated
under UV excitation. The rate of microcystin
degradation was calculated by dividing the
amount of microcystin degraded in the first
30 min or 1 h by the initial cell count.
Statistically significant differences were
determined by one-way analysis of variance
(ANOVA) and Tukey’s honestly significant
difference (HSD) post hoc test based on the
ANOVA using Kaleida Graph version 3.6
(Synergy Software).
Microcystin analysis Microcystins were
analyzed using HPLC. The mobile phase
consisted of 60% / 40% methanol / 0.05M
phosphate buffer (pH 3.0). Water samples
obtained from the microcystin degradation
test were filtered through a membrane filter
(pore size: 0.2 μm, DISMIC 25cs, Advantec).
103
Microcystins in the filtrates were analyzed
by HPLC and a UV/VIS detector (239 nm,
Waters 2417). A Symmetry C18 5μm column
(Waters Co., 4.6 by 150 mm) was used. The
toxins were identified and measured by
comparing their UV spectra and peak areas
with those of samples spiked with purified
microcystin YR, RR and LR standards (Wako
Pure Chemical Industries, Ltd.).
RESULTS
Isolation of microcystin-degrading bacteria
from a M. guttula culture and phylogenetic
analysis of isolated bacteria Twenty-five
strains of bacteria were isolated from a M.
guttula culture. Colonies were randomly
selected from the media. These strains were
named MG 1 through MG 25, and their
ability to degrade microcystin LR was tested;
two strains, MG 15 and MG 22, degraded
approximately 70% of the available micro-
cystin LR in 7days. The other 23 strains of
bacteria did not degrade microcystin LR in 7
days.
The 16S rDNA gene sequences of strains
MG 15 and MG 22 that we determined were
continuous stretches of 1433 and 1402 bp,
respectively. Searches for similarity with the
FASTA sequence search program indicated
that the closest relative of MG 15 and MG
22 was alpha proteobacterium F0813 (100.0%
and 99.7% identity, respectively, GenBank
accession number AF235997).
The 16S rDNA similarity values of strains
MG 15 and MG 22 with the type species of
the representative genera of the family
Sphingomonadaceae were 93.2 and 93.3 with
Sphingobium chlorophenolicum ATCC 33790T
(X87161), 94.6 and 94.3 with Novosphingobium
subarcticum KF1T (X94102), 94.4 and 94.1
with Sphingopyxis terrae IFO 15098T
(D13727), and 93.6 and 93.3 with
Sphingopyxis macrogoltabida IFO 15033T
(D13723), respectively. The 16S rDNA
similarity values of strains MG 15 and MG
22 with the microcystin-degrading bacteria
were 93.2 and 92.9 with Sphingosinicella
microcystinivorans Y2 (AB084247), 93.6 and
93.4 with Sphingomonas sp. MD 1
(AB110635), and 92.4 and 92.3 with
Sphingomonas sp. MJ PV ACM 3962
(AF411072), respectively.
104 Japanese J. Wat. Treat. Biol. Vol.43 No.2

The phylogenic tree based on the sequences minutes of incubation, whereas the decrease
of the bacteria isolated in this study, the of microcystin RR by strain MG 22 was
microcystin-degrading bacteria isolated linear during 1 h of incubation. The initial
previously, and related strains, is shown in degradation rate of microcystin RR by strain
Fig. 1. The two strains MG 15 and MG 22 MG 15 increased as temperature increased
were nested in the clusters of Sphingopyxis (Table 1). An optical density of 0.3 corre-
species and Novosphingobium species. sponded to cell density of 6.5 × 108 cells･ml–1
for both strains. The degradation rates of
Effect of temperature on microcystin microcystin in all experiments were calculated
degradation by isolated bacteria Micro- by dividing the microcystin degradation rate
cystin RR degradation by the novel bacterial by the cell density. The rate of degradation
strains MG 15 and MG 22 was evaluated at 30℃ by strain MG 15 was significantly
between 20 and 30℃. Microcystin RR different from that at 20 and 25℃ (p＜0.05).
decreased after the start of the experiment The initial degradation rate of microcystin
at each temperature assayed (Fig.2). Strain RR by strain MG 22 increased slightly with
MG 15 degraded microcystin RR faster than increasing temperature, but this apparent
strain MG 22. The decrease of microcystin increase was not statistically significant.
RR by strain MG 15 was linear during 30

Sphingomonas sp. IFO 15915 (AB033949)

778
Sphingopyxis chilensis S37 (AF367204)
804

976 Sphingopyxis macrogoltabida IFO 15033T (D13723)

993 Sphingomonas sp. IFO 15917 (AB033950)

Sphingopyxis terrae IFO 15098T (D13727)

359

MG-15
1000
MG-22
501

Sphingomonas sp. MJ-PV ACM-3962 (AF411072)

1000
Sphingomonas sp. MD-1(AB110635)
913

615
Novosphingobium subarcticum KF1T (X94102)

Sphingomonas agrestis HV3 (Y12803)

468
Sphingobium japonicum UT26 (AF039168 )
1000

1000 Sphingobium chlorophenolicum ATCC 33790T (X87161)

298
Sphingobium yanoikuyae EC-S01 (AB120764)

Sphingomonas parapaucimobilis IFO 15100T (D13724)

1000
Sphingomonas sanguinis IFO 13937T (D13726)
998

892 Sphingomonas sp. IFO 15496 (AB033946)

Sphingomonas echinoides ATCC 14820T (AB021370 )

Sphingosinicella microcystinivorans Y2 (AB084247)

Rhodospirillum rubrum ATCC 11170T (D30778)

0.01

Fig. 1 Phylogenetic relationships between isolated bacterial strains MG 15 and MG 22, currently known microcystin-
degrading bacteria7)9)11) and closely related strains. The tree is based on a distance matrix analysis of the 16S
rDNA sequences (accession numbers given in parentheses). Numbers at the nodes indicate bootstrap values,
derived from 1000 samples. Scale represents one substitution per 100 nucleotide positions. Strains in bold form
are microcystin-degrading bacteria.
 Microcystin-Degrading Bacteria Isolated from Culture of Protozoa 105

100 Effect of pH on microcystin degradation by

isolated bacteria Microcystin RR degra-
Microcystin RR remaining (%)

80 dation by MG 15 and MG 22 was evaluated

between pH 6.8 and 10. Microcystin RR
60 decreased after the start of the experiment
at each pH (Fig. 3). The microcystin RR
40 concentration decreased to less than 20%
after 9 h in the presence of strain MG 15 at
each pH, but more than 20% of the microcystin
20
remained after 9 h of incubation with strain
MG 22 at pH 6.8 and 10. No change in pH
0
0 2 4 6 8 10 was observed in samples containing glycine
Time (h) NaOH buffer after 9 h. The pH changed
a) MG-15 slightly in the samples containing M 11
medium initiated at pH 6.8 or 7.6 after 9 h
100 (samples initiated at pH 7.6 changed to 7.3
for MG 15, and to 7.5 for MG 22; samples
Microcystin RR remaining (%)

80
initiated at pH 6.8 changed to 7.2 for both
strains). The initial degradation rate of
microcystin RR was calculated (Table 2). The
60
degradation rate was the highest at pH 7.6
and 8.8 for strain MG 15 and at pH 8.8 for
40
strain MG 22, and the rate was the lowest
at pH 10 for both strains. ANOVA showed
20 that the pH affected the degradation rate by
both strains (p＜0.0001). The degradation
0 rate by strain MG 15 was significantly
0 2 4 6 8 10
Time (h)
different at each pH (p＜0.05, Table 2) except
for between the degradation rates at pH 7.6
b) MG-22
and 8.8. In the case of strain MG 22, the
Fig. 2 Degradation of microcystin RR from an initial degradation rate was significantly different
concentration of 1000 μg l–1 over a 9 h period at each pH (p＜0.001) except for between the
by strains MG 15 and MG 22 as a function of
degradation rates at pH 6.8 and 10.
temperature (pH 7.6). Error bars indicate
standard deviations (n=3). Addition of 50 mM glycine did not affect
○ 20℃ ● 25℃ ◇ 30℃ the degradation rate of microcystin RR for
strain MG 15 (without glycine: 6.27 ± 0.58
(×10–4pg･cell–1･h–1), with glycine: 5.85±0.33
Table 1 Initial degradation ratea of microcystin RR by (×10–4pg･cell–1･h–1), but glycine significantly
strains MG 15 and MG 22 as a function of enhanced the degradation rate for MG 22
temperature.
(p＜0.0001) (without glycine: 5.0±0.18
20℃ 25℃ 30℃ (×10–4pg･cell–1･h–1), with glycine: 8.12±0.53
(×10–4pg･cell–1･h–1)).
MG 15 9.81 ± 0.73 12.2 ± 0.83 26.4 ± 8.08b
MG 22 3.90 ± 1.14 5.58 ± 0.43 5.98 ± 2.64 Degradation of microcystin RR, microcystin
a
Rates are expressed as ×10–4 pg microcystin･cell–1･h–1 YR and microcystin LR This experiment
measured at pH 7.6 and represent the mean±standard examined the degradation rate of three
deviation (n=3).
b
Value is significantly different (p＜0.05) from the other microcystin analogs by strains MG 15 and
values of MG 15. MG 22. Microcystin RR was degraded faster
than microcystin YR and microcystin LR by
both strains (Fig. 4). In the test for strain
MG 15, the degradation rates of microcystin
YR and microcystin LR were the same (Table
106 Japanese J. Wat. Treat. Biol. Vol.43 No.2

100 100
Microcystin RR remaining (%)

Microcystin remaining (%)

80 80

60 60

40 40

20 20

0 0
0 2 4 6 8 10 0 2 4 6 8 10
Time (h) Time (h)
a) MG-15
a) MG-15

100
100
Microcystin RR remaining (%)

Microcystin remaining (%)

80
80

60
60

40
40

20
20

0
0 0 2 4 6 8 10
0 2 4 6 8 10
Time (h)
Time (h)
b) MG-22
b) MG-22

Fig. 3 Degradation of microcystin RR from an initial Fig. 4 Degradation of microcystin RR, YR and LR from
concentration of 1000 μg l–1 over a 9 h period an initial concentration of 1000 μg l–1 over a 9 h
by strains MG 15 and MG 22 as a function of period by strains MG 15 and MG 22 (25℃, pH
pH (25℃). Error bars indicate standard 7.6). Error bars indicate standard deviations
deviations (n=3). (n=3).
○ pH 6.8 ● pH 7.6 ○ microcystin RR ● microcystin YR
◇ pH 8.8 △ pH 10 ◇ microcystin LR

Table 2 Initial degradation ratea of microcystin RR by Table 3 Initial degradation ratea of microcystin RR, YR
strains MG 15 and MG 22 as a function of and LR by strains MG-15 and MG-22.
pH.
MC RR MC YR MC LR
pH 6.8 pH 7.6 pH 8.8 pH 10
MG-15 12.2 ± 0.83 4.06 ± 1.07 4.06 ± 0.15
MG 15 6.99 ± 0.15b 8.75 ± 0.28c 8.19 ± 0.83c 4.43 ± 0.33d
MG-22 5.58 ± 0.43 3.27 ± 0.67 2.60 ± 0.24
MG 22 2.80 ± 0.25b 5.07 ± 0.19c 7.54 ± 0.18d 2.20 ± 0.5b aRates are expressed as ×10–4 pg microcystin･cell–1･h–1
aRates are expressed as ×10–4 pg microcystin･cell–1･h–1 measured at 25℃, pH 7.6 and represent the mean±standard
measured at 25℃ and represent the mean±standard deviation (n=3).
deviation (n=3).
b, c, d There is a significant difference (p＜0.05) between

values marked with different superscript letters.

 Microcystin-Degrading Bacteria Isolated from Culture of Protozoa 107

3). The degradation rate of microcystin RR l–1 for strain MG 15 and 17 to 917 μg･l–1 for
by MG 15 was three times higher than that strain MG 22. In all of the experiments, the
of microcystin YR and microcystin LR. In the microcystin LR concentration decreased (Fig.
test for strain MG 22, microcystin LR had 5). Microcystin LR degradation over time was
the lowest degradation rate. calculated as the average of results from two
experiments. The initial degradation rate of
Degradation of microcystin LR as a function microcystin LR was calculated based on
of initial microcystin concentration Micro- degradation during 1 h of incubation and
cystin LR degradation by the novel bacterial was plotted against the initial concentration
strains MG 15 and MG 22 was evaluated at (Fig. 6). The degradation rate of microcystin
initial concentrations between 20 to 890 μg･ LR increased as initial microcystin LR
concentration increased. The difference in
the degradation rate between strains MG 15
1000 and MG 22 also increased with concentration.
The microcystin LR degradation rate did not
800 plateau at the highest microcystin LR
Microcystin LR (µg L–1)

concentration for either MG 15 or MG 22.

600
DISCUSSION
400 Isolation and phylogenetic analysis of
microcystin-degrading bacteria isolated from a
culture of M. guttula Phylogenetic analysis
200
of the 16S rDNA gene sequences and
parsimony methods indicated that the
0
0 2 4 6 8 10 currently known species of the genus
Time (h) Sphingomonas can be divided into four
a) MG-15 clusters, and three new genera
Novosphingobium, Sphingopyxis and
1000
Sphingobium have been proposed28). According
to the phylogenetic tree, microcystin-
800
Microcystin LR (µg L–1)

4
Degradation rate of microcystin LR

600
(×10–4 pg cell–1 h–1)

400 3

200
2
0
0 2 4 6 8 10
Time (h)
1
b) MG-22

Fig. 5 Degradation of microcystin LR from varying

initial concentrations over a 9 h period by 0
strains MG 15 and MG 22 (25℃, pH 7.6). 0 200 400 600 800 1000
a) MG 15
○ 20 μg l–1 ● 41 μg l–1 Initial microcystin LR concentration (µg L–1)
△ 77 μg l–1 ■ 165 μg l–1
◇ 337 μg l–1
b) MG 22
◫ 890 μg l–1 Fig. 6 Initial degradation rate of microcystin LR (×10–4
pg cell–1 h–1) by strains MG 15 and MG 22 as
○ 17 μg l–1 ● 40 μg l–1 a function of initial microcystin LR concentration
△ 81 μg l–1 ■ 173 μg l–1 (μg l–1) (25℃, pH 7.6).
◇ 345 μg l–1 ◫ 917 μg l–1 ○ MG 15 ◆ MG 22
108
degrading strains Sphingomonas sp. MJ PV7)
and Sphingomonas sp. MD 19) were associated
with the Novosphingobium group. Strains
MG 15 and MG 22 exhibited low similarity
values of less than 95% with the Sphingopyxis
and Novosphingobium groups. In the
phylogenetic tree, strains MG 15 and MG 22
were separated from the Sphingopyxis cluster
with a low bootstrap value of 359. These low
similarity values and low bootstrap value
could not specify the phylogenetic group, and
it was shown that strains MG 15 and MG 22
were related to the Sphingopyxis and
Novosphingobium groups.
Two of the 25 strains isolated were shown
to degrade microcystin, suggesting that many
bacterial species may be present in the M.
guttula culture and that microcystin-
degrading bacteria such as strains MG 15
and MG 22 may play an important role in
microcystin degradation.
We previously studied growth of the
protozoan ciliate Trithigmostoma cucullulus
preying on Planktothrix agardhii (PCC 7821,
obtained from Institut Pasteur) which
produces microcystin RR in cell. With growth
of T. cucullulus, P. agardhii decreased due
to predation. Simultaneously dissolved
microcystin RR increased (unpublished data).
Consequently, we surmised that T. cucullulus
ingested trichomes of P. agardhii and that
microcystin RR was excreted intact by T.
cucullulus after P. agardhii had been
consumed. In the case of M. guttula used in
this study, it was presumed that M. guttula
prey on M. viridis and that microcystin was
excreted intact as was seen for T. cucullulus.
M. guttula has been maintained for more
than ten years in a microcystin-producing
culture of M. viridis. In the M. guttula
culture, microcystins might be released from
M. viridis cells by predation and autolysis,
so it is presumed that microcystin-degrading
bacteria either survived or had accumulated
over a long period by utilizing microcystin.
This hypothesis might be supported by the
finding of Park et al. that the microcystin-
degrading strain Y2 can use microcystin as a
carbon and energy source10).
In water purification plants, biological
treatments such as biological filtration and
submerged filter bed processes have been
Japanese J. Wat. Treat. Biol. Vol.43 No.2
installed to remove algae and dissolved
organic matter. In such biological processes,
a biofilm consisting of bacteria, protozoa and
metazoa becomes attached to the media
made of sand, plastic and ceramic and
thereby purifies water. Saito et al. reported
that when the biofilm was sampled and then
added to M. viridis suspension, Monas spp.
increased with a concominant decrease of M.
viridis; microcystin also decreased16). Thus,
Monas spp. and microcystin-degrading
bacteria might exist in the biofilm and
contribute to the purification. Ho et al.
examined removal of 2 methylisoborneol,
geosmin and microcystin LR by biological
sand filtration. They reported that a homolog
of the gene mlrA was detected in the biofilm
forming on the sand15). These findings suggest
that when using biological processes to treat
lake and reservoir water contaminated with
Microcystis, protozoa such as M. guttula can
prey upon Microcystis and that excreted
microcystin can be degraded by microcystin-
degrading bacteria.
Characteristics of microcystin degradation
by the isolated bacteria Initial cell density
for each strain was 6.5 × 108 cells･ml–1.
After 9 h, cell density tended to stay constant
or decrease (data not shown). During
degradation experiments over 9 h, 1000 μg･l–1
of microcystin may not have been sufficient
to support the bacteria because no growth
was observed.
The effect of temperature on microcystin
degradation differed for the two strains. The
rate of microcystin RR degradation by strain
MG 15 increased at 30℃, whereas no
significant difference was observed in the
rate of degradation by strain MG 22 at each
temperature. The difference in the effect of
temperature on microcystin degradation rate
between the two strains might be due to
activity of compounds involved in degradation
in cells. The degradation rate of microcystin
RR by strain Y2 increased with an increase
in temperature from 5 to 30℃10). Generally,
algal blooms occur at temperatures above
20℃. Indeed, both of the microcystin-
degrading strains MG 15 and MG 22 could
degraded microcystin at temperatures at
which algal blooms occur.
 Microcystin-Degrading Bacteria Isolated from Culture of Protozoa
Strains MG 15 and MG 22 could also
degrade microcystin at pH levels ranging
from 6.8 to 10. The initial degradation rate
of microcystin RR peaked at pH 7.6 and 8.8
for strain MG 15 and at pH 8.8 for strain
MG 22. Enhancement of the degradation
rate at pH 8.8 might be due to the effect of
glycine for strain MG 22. The precise trend
along the pH gradient could not be evaluated
for strain MG 22; however it was shown
that the degradation rate for the two strains
was high at pH 7.6 and 8.8. Saitou et al.
reported the characteristics of the microcystin-
degrading bacteria Sphingomonas sp. MD 1,
for which the percentage of microcystin LR
degraded peaked at pH 7.2 (more than 98%)
and decreased as pH increased9). At pH 9,
the percentage degraded was approximately
less than 30%. Strains MG 15 and MG 22
degraded 90% and more than 70% of
microcystin RR, respectively, at pH 10. This
suggests that compounds involved in
degradation of microcystin are active under
alkaline condition for strains MG 15 and
MG 22. In eutrophic lakes in summer, the
pH increases up to 9 or 9.5 because of
photosynthesis29). Further investigation of the
growth as a function of pH is necessary to
surmise microcystin degradation under the
alkaline conditions present in eutrophic
lakes.
The initial degradation rate of microcystin
RR was the highest of the three microcystins
for both bacterial strains. The rates of
microcystin YR and microcystin LR deg-
radation were same for strain MG 15,
whereas the rate of microcystin YR
degradation was higher than that of
microcystin LR for strain MG 22. The
degradation observed for strain MG 22
toward the three microcystins was similar to
that of activity of Sphingomonas sp. MD 19).
Park et al. reported that the rate of
microcystin RR degradation by strain Y2 is
about twice as high as that of microcystin
LR at an initial concentration 3 to 20 mg･l–1
and that the rate of microcystin YR
degradation is about 10 times higher than
that of microcystin LR at an initial
concentration of 22 mg･l–1 10). The microcystin
LR degradation rate was the lowest among
the three analogs for strains MD 1, Y2,
109
MG 15 and MG 22, whereas the bio-
degradability of microcystin YR and RR
tended to be different between species. Jones
et al. reported that a cell-free extract of
Sphingomonas sp. MJ PV could degrade both
microcystin RR and microcystin LR at similar
rates7). Further investigation of the
degradation rate of each microcystin analog
using cell-free extracts of strains MG 15 and
MG 22 is necessary to establish bio-
degradability of each microcystin analog.
In the experiment that examined the
degradation rate as a function of initial
microcystin LR concentration, the rate of
degradation by both strains did not reach a
saturation point. Park et al. investigated the
effect of initial concentration of microcystin
RR (4, 7, 18 and 37 mg･l–1) and LR (3, 5, 10
and 20 mg･l–1) on the degradation rate by
strain Y210). For both microcystins, the
degradation rate tends to be saturated at
approximately 20 mg･l–1.
At the initial microcystin LR concentrations
of less than 400 μg･l–1, the degradation rate
of microcystin LR by strain MG 15 was
slightly higher than that of MG 22. At
approximately 900 μg･l–1, however, the
degradation rate by strain MG 15 was
substantially higher (Fig. 6). This suggested
that high activity or a high level of
degradation-associated compound was present
in the MG 15 strain. Park et al. reported
that the microcystin concentration during
the warm season in Lake Suwa, Japan,
ranged 0.11 to 184 μg･l–1 30). Microcystin LR
decreased to the detection limit within 9 h
from an initial concentration of 20, 41, 77
and 165 μg･l–1for strain MG 15, and from
17, 40, 81 and 173 μg･l–1 for strain MG 22.
These results indicated that each of the
bacterial strains identified in this study could
degrade microcystin at the actual
concentration that occurs in lakes and
reservoirs.
CONCLUSIONS
In the research of the isolation of
microcystin-degrading bacteria from a
monoxenic culture of M. guttula, and the
characteristics of microcystin degradation,
the following results were obtained.
(1) Two microcystin-degrading strains of
110
bacteria (MG 15 and MG 22) were isolated
from a monoxenic culture of Monas guttula
preying on Microcystis viridis.
(2) Strains MG 15 and MG 22 were related
to Sphingopyxis and Novosphingobium groups
based on phylogenetic analysis of 16S rDNA.
(3) The rate of microcystin RR degradation
by strain MG 15 significantly increased at
30℃, whereas the effect of temperature on
the degradation rate by strain MG 22 was
small.
(4) Strains MG 15 and MG 22 could degrade
microcystin RR under alkaline pH.
(5) Strains MG 15 and MG 22 could degrade
microcystin RR, YR and LR. The degradation
rate of microcystin RR by the two strains
was faster than the degradation rates of
microcystin YR and LR.
REFERENCES
1 ）Carmichael, W. W., Beasley, V. R., Bunner, D.
L., Eloff, J. N., Falconer, I. R., Gorham, P.,
Harada, K., Krishnamurthy, T., Yu, M. J.,
Moore, R. E., Rinehart, K., Runnegar, M.,
Skullberg, O. M., and Watanabe, M. F.:
Naming of cyclic heptapeptide toxins of
cyanobacteria (blue-green algae), Toxicon,
26, 971 973 (1988)
2 ）Sivonen, K., Namikoshi, M., Evans, W. R.,
Carmichael, W. W., Sun, F., Rouhiainen, L.,
Luukkainen, R. R., and Rinehart, K. L.:
Isolation and characterization of a variety
of microcystins from seven strains of the
cyanobacteria genus Anabaena, Appl.
Environ. Microbiol., 58, 2495 2500 (1992)
3 ）Carmichael, W. W., Azevedo, S. M. F. O., An,
J. S., Moloca, R. J. R., Jochimsen, E. M., Lau,
S., Rinehart, K. L., Shaw, G. R., and
Eaglesham, G. K.: Human fatalities from
cyanobacteria: chemical and biological
evidence for cyanotoxins, Environ. Health
Perspect., 109, 663 668 (2001)
4 ）Nishiwaki-Matsushima, R., Ohta, T.,
Nishiwaki, S., Suganuma, M., Kohyama, K.,
Ishikawa, T., Carmichael, W. W., and Fujiki,
H.: Liver tumor promotion by the
cyanobacterial cyclic peptide toxin micro-
cystin LR, J. Cancer Res. Clin. Oncol.,
118, 420 424 (1992)
5 ）Zhou, L., Yu, H., and Chen, K.: Relationship
between microcystin in drinking water
Japanese J. Wat. Treat. Biol. Vol.43 No.2
and colorectal cancer, Biomed. Environ.
Sci., 15, 166 171 (2002)
6 ）World Health Organization: Guidelines for
drinking-water quality, 2nd ed. Addendum
to Volume 2, Health criteria and other
supporting information, Geneva, Switzer-
land: WHO (1998)
7 ）Jones, G. J., Bourne, D. G., Blakeley, R. L.,
and Doelle, H.: Degradation of the cyano-
bacterial hepatotoxin microcystin by
aquatic bacteria, Nat. Toxins, 2, 228 235
(1994)
8 ）Bourne, D. G., Jones, G. J., Blakeley, R. L.,
Jones, A., Negri, A. P., and Riddles, P.:
Enzymatic pathway for the bacterial
degradation of the cyanobacterial cyclic
peptide toxin microcystin LR, Appl.
Environ. Microbiol., 62, 4086 4094 (1996)
9 ）Saitou, T., Sugiura, N., Itayama, T., Inamori,
Y., and Matsumura, M.: Degradation
characteristics of microcystins by isolated
bacteria from Lake Kasumigaura, Journal
of Water Supply: Research and Technology
AQUA, 52, 13 18 (2003)
10）Park, H. D., Sasaki, Y., Maruyama, T.,
Yanagizawa, E., Hiraishi, A., and Kato, K.:
Degradation of the cyanobacterial
hepatotoxin microcystin by a new
bacterium isolated from a hypertrophic
lake, Environ. Toxicol. 16, 337 343
(2001)
11）Maruyama, T., Park, H. D., Ozawa, K.,
Tanaka, Y., Sumino, T., Hamana, K., Hiraishi,
A., and Kato, K.: Sphingosinicella
microcystinivorans gen. nov., sp. nov., a
microcystin-degrading bacterium, Int. J.
Syst. Evol. Microbiol., 56, 85 89 (2006)
12）Bourne, D. G., Riddles, P., Jones, G. J.,
Smith, W., and Blakeley, R. L.: Charac-
terisation of a gene cluster involved in
bacterial degradation of the cyanobacterial
toxin microcystin LR, Environ. Toxicol.
16, 523 534 (2001)
13）Saito, T., Okano, K., Park, H. D., Itayama, T.,
Inamori, Y., Neilan, B. A., Burns, B. P., and
Sugiura, N.: Detection and sequencing of
the microcystin LR degrading gene, mlrA,
from new bacteria isolated from Japanese
lakes, FEMS Microbiol. Lett., 229, 271
276 (2003)
14）Grutzmacher, G., Bottcher, G., Chorus, I.,
and Bartel, H.: Removal of microcystins by
slow sand filtration, Environ. Toxicol. 17,
 Microcystin-Degrading Bacteria Isolated from Culture of Protozoa
386 394 (2002)
15）Ho, L., Hoefell, D., Aunkofer, W., Meyn, T.,
Keegan, A., Brookes, J., Saint, C., and
Newcombe, G.: Biological filtration for the
removal of algal metabolites from drinking
water, Water Sci. Technol.: Water Supply,
6, 153 159 (2006)
16）Saito, T., Sugiura, N., Itayama, T., Inamori,
Y., and Matsumura, M.: Biodegradation of
Microcystis and microcystins by indigenous
nanoflagellates on biofilm in a practical
treatment facility, Environ. Technol., 24,
143 151 (2003)
17）Xie, S. G., Tang, X. Y., Wu, W. Z., Wen, D. H.,
and Wang, Z. S.: Biological pretreatment of
Yellow River water, J. Environ. Sci., 17,
557 561 (2005)
18）Iwami, N., Inamori, Y., Sugiura, N., and
Matsumura, M.: Degradation characteris-
tics of toxic Microcystis viridis by
mastigophora, Monas guttula using aquat-
ic large scale microcosm, J. Jpn. Soc.
Water Environ.,19, 140 146 (1996) (in
Japanese)
19）Kudo, R. R.: Protozoology, Springfield
Illinois USA: Charles C. Thomas Publisher,
314 p. (1977)
20）Brosius, J., Palmer, J. L., Kennedy, J. P., and
Noller, H. F.: Complete nucleotide sequence
of a 16S ribosomal RNA gene from
Escherichia coli, Proc. Natl. Acad. Sci.
USA, 75, 4801 4805 (1978)
21）Ishikawa, M., Nakajima, K., Yanagi, M.,
Yamamoto, Y., and Yamasato, K.:
Marinilactibacillus psychrotolerans gen.
nov., sp. nov., a halophilic and alkaliphilic
marine lactic acid bacterium isolated from
marine organisms in temperate and
subtropical areas of Japan, Int. J. Syst.
Evol. Microbiol. 53, 711 720 (2003)
22）Pearson, W. R., and Lipman, D. J.: Improved
tools for biological sequence analysis,
Proc. Natl. Acad. Sci. USA, 85, 2444 2448
(1988)
23）Thompson, J. D., Gibson, T. J., Plewniak, F.,
111
Jeanmougin, F., and Higgins, D. G.: The
ClustalX windows interface: flexible
strategies for multiple sequence alignment
aided by quality analysis tools, Nucleic
Acids Res., 24, 4876 4882 (1997)
24）Jukes, T. H. and Cantor, C. R.: Evolution of
protein molecules, In: Munro, H. N.,
editor, Mammalian Protein Metabolism,
Vol. 3, New York: Academic Press, p 21
132 (1969)
25）Felsenstein, J.: PHYLIP. Phylogeny in-
ference package, Cladistics, 5, 164 166
(1989)
26）Saitou, N. and Nei, M.: The neighbor-joining
method: a new method for reconstructing
phylogenetic trees, Mol. Biol. Evol., 4,
406 425 (1987)
27）Yamaguchi, N., Kenzaka, T., and Nasu, M.:
Rapid in situ enumeration of physiologically
active bacteria in river waters using
fluorescent probes, Microbes Environ., 12,
1 8 (1997)
28）Takeuchi, M., Hamana, K., and Hiraishi, A.:
Proposal of the genus Sphingomonas
sensu stricto and three new genera,
Sphingobium, Novosphingobium and
Sphingopyxis, on the basis of phylogenetic
and chemotaxonomic analysis, Int. J. Syst.
Evol. Microbiol., 51, 1405 1417 (2001)
29）Shitara, K., Nomura, M., Chiba, N., Fujimoto,
N., Nakano, K., and Nishimura, O.: Char-
acteristics of water quality stratification
related to the water-bloom occurrence in
Urushizawa dam lake, Environ. Eng. Res.,
42, 487 493 (2005) (in Japanese)
30）Park, H. D., Iwami, C., Watanabe, M. F.,
Harada, K., Okino, T., and Hayashi, H.:
Temporal variabilities of the concentrations
of intra- and extracellular microcystin
and toxic Microcystis species in a
hypertrophic lake, Lake Suwa, Japan
(1991 1994), Environ. Toxicol. Water
Qual., 13, 61 72 (1998)
(Submitted 2007. 1. 11)
(Accepted 2007. 3. 22)