Renormalizing is caused by remote correlations in the location

of FC particles, visually expressed in coherence of the cluster and

presence of a large number of empty spaces inside the cluster.
It can be explained in the following way. Let photon, incident
onto a cluster with wavelength of about 𝝀-range of a typical
cluster 𝑳 to be captured by some relatively large FC cavity
(resonant cavity). This capturing leads to the increase of
− −
the effective dielectric penetrability of the cluster 𝜀 ( 𝜀 increases
near any electromagnetic resonance [Boren, Hoffman, 1986]).
−
Increase in 𝜀 value, in turn, initiates photon’s wavelength
𝝀
reduction because 𝝀𝒊𝒏𝒕 = −
. Photon with renormalized
√
𝜺
wavelength 𝝀𝒊𝒏𝒕 finds another cavity of a smaller size. This new
−
capturing stimulates increase of 𝜺 value again and new reduction
of 𝝀𝒊𝒏𝒕 and so on. Eventually, all FC cavities could be filled with
renormalized photons, including those with a wavelength λint→0.

Fig. 11. Photon

“retention” between
the source and
the detector whilst
elastic scattering
on FC.

Fig. 12. Physical

explanation of photon
“retention”.

The physics of light localization in fractal systems and

the calculation scheme are described below. In between
the source and the detector of the radiation, there is always
a photon, which is circling in a locked loop (Fig. 11). Intertwined
stiff Antoine’s rings on the photon’s path retain the photon there
(Fig. 12). The rings are formed as the result of numerous photon
renormalizations in FC particles-monomers. Then, we calculate

196
the interaction amplitude of a virtual photon pair, photons
located inside the area, marked as FC (fractal cluster) in Fig. 12.
One of them corresponds to the upper “edge” and the second –
to the lower. Typical processes causing this amplitude can be seen
in Fig. 12 (when ignoring the undulatory lines of real photons).
Interaction amplitude can be found by solving the relevant Bethe-
Salpeter equation. One can show that the virtual part of this
amplitude describes photon “retention” and localization
in the system.
The resulting calculation leads to the following expression
for the differential cross-section of the elastic light scattering
by the cluster [Maksimenko, 1999]:
2
𝑑𝜎 1 + 2(𝑒𝑖 𝑒𝑓 ) 3−2𝐷 𝑁 𝜔 4 𝑅6 1 𝑑
= 𝑁 𝐷 2 |𝜀 − 1|2 4 [− 𝛿(β)
𝑑𝑛𝑓 60 𝑐 β 𝑑β
4𝑡03 sinβ 𝑡0 (1)
+𝑖 ]
(3 − 𝐷)𝑁 2 β 𝑡0
𝜔𝐿𝑐 0
where β = 2 𝑐
sin 2 , 𝜃 - dissipation angle,
𝜹(𝒙)- Dirac delta-function,
𝒄– light speed in vacuum,
𝒆– single polarization vectors of the incident (i) and scattered (f)
quanta,
𝝎 – frequency of the incident light,
𝒏𝒇 – singular vector in scattered photon direction,
𝑵 >> 𝟏 – a number of particles in a correlation block,
𝜺 – dielectric permeability of the particles substance and
𝑹 – radius of particle-monomer.
Parameter 𝒕𝟎 has a weak dependancy on 𝑫. Virtual part
of the cross-section describes “absorbtion”, determined
by localization. When 𝑫 < 𝟑/𝟐, this cross-section is very large.
When 𝜣 ≠ 𝟎, differential cross-section of scattering becomes
purely virtual. This means, that when 𝜣 ≠ 𝟎 there is no scattered
by cluster light beam at all! Any photon, scattered “sidewase” is
captured by the cluster and starts fluctuating along corresponding
𝑛⃗𝑓 .
The singularity of forward scattering is another surprising
197
factor of expression (1) for 𝑑𝜎/𝑑𝑛⃗ 𝑓 . Taking into account
the connection
𝑑𝜎
𝐽𝑛𝑓 = 𝐼
𝑑𝑛⃗ 𝑓
between the beam of scattered in direction 𝒏
⃗ 𝒇 of radiation 𝑱𝒏𝒇 and
the density of the incident light radiation 𝑰, one can see that
singularity in the cross-section means that there is a possibility
for an ultimate “current” of photons in the system, even at the
zero density of the beam of incident radiation. Singularity 𝑑𝜎/𝑑𝑛⃗ 𝑓
in forward direction describes forced light radiation from
the cluster. This is a typical “laser” effect.
Coherency of the induced radiation is provided for “zero-
dimensionality” of localized Antoine’s photons, the ability
to concentrate large in quantity on a small scale. The physical
cause of coherent release of these photons is simple and
illustrative. Any photon, scattered “sidewise” is captured
by the cluster and begins to oscillate in it along the direction
of scattering without a right to exit the cluster. Antoine’s rings,
intertwined with corresponding rings of the localized photon,
are formed on its trajectory. This very intertwinement “retain”
such photon in a cluster. Most of the rings belong to the photon
scattering at zero angle – virtual part 𝑑𝜎/𝑑𝑛⃗ 𝑓 has its maximum
value when 𝜽 = 𝟎 (see equation (1)). And at the same time,
only such a photon has a chance to break through from
the cluster, which is described by the real part of the cross-
section. This photon, hooked up by its rings with corresponding
rings of the localized photons, pulls them outside (Fig. 13). This is
how, by means of Antoine’s rings, it is possible to understand
the nature of the induced light radiation.
We anticipate that such kind of effects, in particular –
localization of light, take place in the system of correlated mirrors
of apparatus described here. Here, the localization is possible
between any two out of the entire pool of omnifarious
combinations of mirror.
The spectrum of excitations in any system is largely

198
determined by its boundaries or surface. A common example of
such excitations are plasmon-polaritons on metal surfaces or
surface plasmons in small metal particles. Is it possible “to read”
spectrums (specific to these kind of excitations) and to record
them on some data storage unit for the purpose of long-term
storage and subsequent reading? We are going to discuss
perspectives and problems of such studies.

Fig. 13. Physical cause

of the induced light
emission, localized
in a cluster

As is known, when a photon is reflected from a flat surface,

its polarization state does not change – this is forbidden
by isotropy of the task in relation to rotations in the surface’s
plane. It would seem that during light reflection from a flat plate
with two walls, the situation would not change. However, it is not
so, if we consider localization of light between the boundaries of
the plates. Such effects can be observed whilst light scattering is
in a strictly backwards direction in even and consistent ensembles
of the smallest particles [Maksimenko et al. 1992] This relates
to the possibility of a scattered backwards photon “to pull out”
another photon localized in a system. In this case, polarization
of the reflected light can change. The reason for a scattered
backwards photon to “pull out” a localized photon, as we know it,
is not related to the photon-photon interaction (which can be
disregarded in this example) but is related to intertwinement
of Antoine’s rings of both scattered and localized photons.
This effect, combined with rotational-oscillating and

199
polarizational characteristics of the scanned objects, can be used
for effective extraction from the object of (localized in it) its own
excitations or its “spectrum”. Let’s review a scheme given
in Fig. 14.

Fig. 14. Scheme of the typical experiment of recording Polarized-Radio-

Wave-Spectrum of scanned objects, e.g. crystalized minerals.
The picture shows the laser, referred to earlier, and crystal,
which spectrum we intend to “pull out”. The standard laser
construction had undergone one addition modification. The semi-
transparent plate (positioned at a Brewster's angle in relation
to the laser’s axis) has been removed from the laser. This semi-
transparent plate was designated to filter parasitic light from
other sources than the main polarization. This was done in order
to allow the light (that was reflected from the crystal and has
changed its polarization as a result of “pulling-out” localized
photons from the crystal) to re-enter into the resonator and then
repeat its route multiple times. We expect the effectiveness of
“pulling out” of localized photons (which are recording
information about the object) to be high enough for experimental
observation. Later, these delocalized photons can localize again
but this time in the system of laser mirrors. After this, we remove
200
the crystal, but the “spectrum” of its excitations, localized
in the laser, as we expect, would be active for a while. The system
would reproduce spectral memory about the object – the object
that by this time has already been removed from the exposition
zone. The role of crystal can be utilized by any system where field
localization is possible. For example, by biological objects,
namely, genetic structures which have a fractal liquid crystal
packaging. Perhaps, these were the types of spectral memory
effects that we observed in our experiments (Fig. 15).

Fig. 15. Polarized Laser-Radio-Wave Spectrums (PLRS) of a highly

polymeric DNA preparation from calf’s thymus gland (upper spectrum),
and its spectral “trace” on laser mirrors (lower spectrum) after
preparation removal from the laser scanning zone. DNA sodium salt was
dissolved in distilled water at a concentration of 1 mg/ml, then, the drop
was placed on a glass slide and covered by another glass slide, forming
a “sandwich”. This was exposed to the laser beam in the “return beam”
mode (passed through the “sandwich”) back to the resonator,
as described in Fig. 14. Control spectrum of clear glass slides (clear
“sandwich” without preparation) within the same frequency range did not
produce peaks typical for DNA inside the “sandwich”.
We’d like to emphasize that we speak about the possibility
of “reading” with a laser radiation of a fixed frequency ω0,
the whole spectrum of the object – a wide range of frequencies.

201
The fact is that a laser photon with 𝝎𝟎 frequency has
“no preference” for which localized photon “to pull-out” from
the object: with the same 𝝎𝟎 frequency or with another
frequency, if there is any.
An absolutely unexpected application of the light localization
idea can be found in the problem of quantum teleportation –
instant message “transmission” across randomly large distances.
This promising area of research, starting with the works of
[Bennet et al., 1993; Bouwmeester et al., 1997], attracts more and
more attention from biologists. Let’s briefly review the basic
provisions of the “classical” theory of quantum teleportation.
As is well known, any wave function of a pair of photons
(photon 2 and photon 3), where each photon has two polarization
states (horizontal |↔⟩ and vertical ⟨↕| polarizations) can be
considered to be from four basic conditions (the so-called Bell’s
conditions) which form the complete orthonormalized system of
functions [22].
|Φ+ ⟩ = (|↕⟩2 |↕⟩3 + |↔⟩2 |↔⟩3 )/√2

|Φ− ⟩ = (|↕⟩2 |↕⟩3 − |↔⟩2 |↔⟩3 )/√2

|Ψ+ ⟩ = (|↕⟩2 |↔⟩3 + |↔⟩2 |↕⟩3 )/√2

|Ψ− ⟩ = (|↕⟩2 |↔⟩3 − |↔⟩2 |↕⟩3 )/√2 (2)

Condition |Ψ− ⟩ (later it will be of the more interest to us than

the rest) has an interesting property: upon detection of a photon
with a specific polarization, the polarization of another photon
turns out to be the opposite.
The possibility to experimentally distinguish one Bell’s
condition from another is provided by their different symmetries.
Out of four conditions (2), the first three are boson conditions
(their wave function does not change the sign, when particles 2
and 3 are interchanged). The last condition |Ψ− ⟩ is a fermion
condition (when particles 2 and 3 are interchanged, the sign of
the wave function changes). This peculiarity of condition |Ψ− ⟩

202
allows this state to stand out in a number of experiments well
described in literature, experiments, which implement
the interference of two specially prepared light beams
[Bouwmeester et al., 1997].
Taking the chance to work further with condition |Ψ− ⟩, we can
use the following almost classical experimental scheme [Bennet
et al., 1993.; Bouwmeester et al., 1997.; Kadomtsev BB, 1999].
There are two players in the game: Alice and Bob, and a source of
a photon pair, described by condition |Ψ− ⟩. Alice’s task is to
transfer photon 1 ( that she has ) to Bob, located anywhere away
from her. However, Alice does not use the usual classical method,
and proceeds as follows. Alice and Bob simultaneously receive
a pair of photons 2 and 3, described by the condition |Ψ− ⟩23 .
Alice receives photon 2, and Bob - photon 3. Alice "mixes" photon
1 and 2. Herein, in one case out of four, she is able to observe
the condition
|Ψ− ⟩12 = (|↕⟩1 |↔⟩2 − |↔⟩2 |↕⟩1 )/√2 .
Soon as she discovers this condition, photon 3 immediately
goes into the initial state of photon 1. This happens for
the following reason. Alice’s observation of conditions
|Ψ− ⟩12 means that under a certain condition of photon 1, photon 2
will have the opposite polarization state. Since photons 2 and 3
are also in a condition |Ψ− ⟩23 , photon 3 will be in a condition which
is orthogonal to condition of photon 2, i.e. in the condition of
photon 1. Thus, the photon 1 teleportation happens from Alice to
Bob, regardless of the distance between them. Teleportation
occurs instantaneously.
The fact is that during this type of teleportation,
the polarizational state of teleported photon 1 is not known
to Alice, as photon 1 “mixes” with photon 2, resulting in the state
|Ψ− ⟩12 .
The described teleportation procedure is flawless from
the point of view of quantum mechanics formalism. Nevertheless,
the physical meaning of these basic Bell’s conditions is still
unclear, and there is still no clarity in the resolution of Einstein-

203
Podolski-Rosen’s paradox (remember, that these conditions were
in the first place introduced to describe this EPR-paradox)
[Einstein, Podolsky, Rosen, 1935]. How can one understand that
when measuring polarization ↔ of one of the photons, which is
for example in a condition |Ψ− ⟩, the polarization of another
photon instantaneously becomes ↕, despite of the long distances
between them, and knowing that any kind of information about
the condition of the second photon can be received by us
after a certain time period?
Photon pairs, described by conditions (2) or by their linear
combinations, are usually called EPR-photon pairs or entangled
photons. Until we fully comprehend the physical cause for these
instant correlations in photons properties, we will not understand
the physics of teleportation, regardless of the immaculacy
of all logical derivations.
Surprising, as it may seem, the problems of the EPR-paradox
and teleportation can be approached differently – from
the position of the existance of localized light. One version of
the EPR-paradox is further described below. Let’s consider,
for example, s-scattering of a photon by spherical particle, that is,
the scattered wave is spherically isotopic (see Fig. 16). Let
the scattered photon approach a detector at the point A (Alice).
This act of registration allows us to conclude, that at the very
same moment this scattered photon reaches a detector at point B
(Bob), which is located at any distance from point A. Wherein,
any information from B to A can be transmitted only after
a certain period of time. If we exclude the possibility of signal
propagation at superluminal speed, this case may be explained
in the following way. What if the registration act of light’s arrival
at point A is not related to the scattered photon, but related to
a localized “long” photon, after it was knocked out from the AB
“channel”? We “capture” its “left end”. Then, there is nothing
strange about the fact that simultaneously, at point B, registration
occurs of its “right end”. There is no superlumenal signal
propagation, as there is no propagation of a signal at all. A “long”
localized photon is “pulled out” from a cavity by means
of interlocking of stiff Antoine’s rings of localized and scattered
204
photons. This interlocking is similar to what was outlined above,
the interlocking in a fractal cluster.

Fig. 16. Experimental scheme

for scanning, recording and storing
information

Now, let’s assume that there is no photon scattering

on a particle. Yet, there is a “cavity” between Alice and Bob, filled
with a photon, localized in it. Alice sends her photon
into this cavity. This photon captures a localized photon
according to the described above mechanism and presents it to
Bob. Thereby, as a result of Alice’s actions, Bob instantaneously
receives some information (yet, nobody knows what kind of
information, since many properties of localized photons are not
known).
As we can see, in this case, for instantaneous signal
“transmission” instead of EPR-correlated photon pairs, it is
sufficient to have only one localized photon (however, if one
wishes, it may be seen as a pair of interacting virtual photons –
a photon of the upper edge and a photon of the lower edge of
Fig. 1 and 2). Moreover, in [Bouwmeester et al., 1997], an EPR-pair
teleported to Bob the unknown photon from Alice. In our case,
Alice’s photon, after affecting the “left end” of the unknown
to anyone localized photon, presents its “right end” to Bob.
These are the similarities and the differences of the two
mechanisms of teleportation.
Does this teleportation contradict the foundations of special
relativity, postulating that speed of information transmission
cannot exceed the speed of light? Obviously, no. In Bennet-type
teleportation [Bennet et al., 1993; Bouwmeester et al., 1997],
a signal unknown to anyone is instantly transmitted. Within
the framework of our model, there is nothing transmitted at all.
Bob receives what is already located next to him, yet, is not
accessible to him until certain time. The information already pre-

205
exists. Alice instantly “allows” Bob to take it. Therefore,
this modification of quantum teleportation (nonlocality) we call
“permissive” (from the word “permission”). It is noted that such
nonlocality seemingly spreads further, since in our case,
the photons (modulated by the object) instantly or nonlocally
convert into radio waves, storing “photonic polarization
information”. It is also possible that in our experiments,
the photons scanning the object and interfering incident photons,
record the object’s dynamic polarizational hologram (for example
DNA), and tranform it into a bioactive radiowave (isomorphic
to photonic) hologram.
Let’s look at a possible cause of radio wave generation
by a polarized laser-radio-wave spectrometer (PLRS). Here we will
talk about a new mechanism of inelastic light scattering
in electronic systems – in this case in the system of metallic layers
of mirror coatings of the laser resonator, which is the main
element of the spectrometer. This mechanism is different from
traditional combinatory photon scattering. As opposed to
a discrete set of Stokes and anti-Stokes peaks, the spectrum of
the given inelastic dissipated light is continual and occupies
the whole range of frequencies from 0𝜔𝑖 to 2𝜔𝑖 , where 𝜔𝑖 –
the frequency of the incident photon. The physics of
the considered inelastic scattering is very simple. We will state its
main regulatities based on an example of inelastic scattering with
excitation of volumetric and surface plasmons in a small metallic
particle. Electromagnetic modes of the finest metallic particles
are called surface plasmons. They are bound with the oscillations
of particle’s electron conductivity, interacting via coulomb
potential. These modes manifest themselves as distinct
resonances in the spectra of elastic light scattering and light
absorption by small metallic particles. The frequencies of
the surface plasmons, depending on concentration of electrons of
conductivity inside the particles, belong to the border of visible
UV light and is determined by the following formulae:
𝑙
𝜔𝑙 = 𝜔0 √2𝑙+1,

206
where 𝑙 = 1,2,3 …, and 𝝎𝟎 – classical plasma frequency of free
electronic gas;
4𝜋𝑛0 𝑒 2
𝝎𝟎 = √ ,
𝑚

where 𝑛0 - density of conductivity electrons in metal, 𝒆 and 𝒎 –

electron’s charge and mass.
Excitation, where 𝑙 = 1, is called a dipolar surface plasmon,
and excitation with frequency 𝝎𝟎 is called volumetric plasmon.
Such kinds of oscillations exist in thin metal films, which are
usually used for modeling mirror coatings, like the ones used
in the considered laser. Here they are called plasmon-polariton
modes, their properties are different, but at this stage we are
interested only in the physics of the phenomenon.
The classical mechanism of inelastic light scattering
by a particle is the following. A photon flying towards a particle
with the energy ħ𝝎𝒊 excites within this particle a fluctuation
of electronic density, discharging some of its energy ħ𝝎.
The energy of the efferent photon is ħ𝝎𝒇 = ħ𝝎𝒊 − ħ𝝎.
This process is symbolically depicted in Fig. 17.

Fig. 17. Classical

scheme of inelastic
dissipation of
photons.

Fig. 18. Proposed

mechanism of
inelastic scattering of
photons.
The shaded corner depicts the fluctuation of electronic density
𝜹𝝆, which is a superposition of a large number of electron-vacant
pairs, excited by photons. The cross-section of the process is

207
especially large, if a photon manages to “swing” dipole surface
and volumetric plasmons. For a particle with a much smaller size
than the wavelength of an approaching photon, the differential
section of inelastic scattering is [Lushnikov et al., 1982]:
𝑑2 𝜎 1 𝜔02𝑅 3 𝜔𝑓
= 𝑟0 𝜆 0 2 (𝜔𝑖2 + 𝜔𝑓2 − 2𝜔𝑖 𝜔𝑓 cosΘ) ×,
𝑑𝑛𝑓 3𝜋 𝑐 3(𝜔𝑖 −𝜔𝑓) 𝜔𝑖

× [𝜔0 ∫ 𝜎(𝜔𝑖 − 𝜔𝑓 − 𝜔0 )𝑑𝜔𝑓 + 𝜔1 ∫ 𝜎(𝜔𝑖 − 𝜔𝑓 − 𝜔1 )𝑑𝜔𝑓 ] (1)

where 𝒏𝒇 – single vector directed towards the scattered quantum,

𝜽 - scattering angle,
𝑹 – radius of a separate particple in a pair,
𝒓𝟎 and 𝝀𝟎 – classical electon radius and Compton’s wavelength
of the electon, respectively.
If the energy, discharged by the photon, is enough for
excitation of plasmoms ωi – ωf > ω0 , then
𝑑𝜎 𝑟0 𝜆0 𝑅 (𝜔𝑖 − 𝜔0 ) 𝜔02 2
= ( ){ [𝜔 + (𝜔𝑖 + 𝜔0 )2 − 2𝜔𝑖 (𝜔𝑖 − 𝜔0 )cosΘ] +
𝑑𝑛𝑓 6𝜋 𝑐 𝜔𝑖 𝜔0 𝑖
(𝜔𝑖 − 𝜔1 ) 𝜔02
+ ∙ [𝜔2𝑖 + (𝜔𝑖 − 𝜔1 )2 − 2𝜔𝑖 (𝜔𝑖 − 𝜔1 )cosΘ]}
𝜔𝑖 𝜔1 (2)
As we can see from the analysis of expression (1), only
a discrete discharge of photon energy is possible, one that
corresponds to the excitation of a volumetric and dipole surface
plasmon. This is reflected by the presence of the Dirac delta-
functions in the corresponding expression. The cross-section of
the process is smaller than the cross-section of elastic light
scattering by the particle by 𝒓𝟎 𝝀𝟎 𝝀 / 𝑹𝟑 times.
The mechanism we have proposed is principally different.
Let’s assume that between the source of the radiation and
the detector there is a photon, which is constantly “circulating”
in a closed loop, repeatedly exchanging fluctuations of electronic
density with itself; these fluctuations are excited in a system
of diffusers, located between the source and the detector.
The shaded loops describe propagation of electronic density
fluctuation in the system of diffusers – these are the so called
“driving polarized density-density operators” or, simply are
208
correlators of the electronic density. Wavy lines represent
the wave functions of real photons, horizontal lines represent
photon propagators. For example, the upper top of a randomly
odd-numbered loop describes generation of an electronic density
fluctuation by a photon with ωi energy due to photon’s energy
reduction by ω; the lower top of a randomly odd-numbered loop
describes the shut down of electronic density fluctuation due
to photon, receiving back its energy ω. There can be any number
of such loops along a photons trajectory. Our photon exchanges
its energy with itself an infinite number of times in the process
of inelastic scattering. This results in a specific exchange
interaction of the photon with itself, similar to a common
metabolic-exchange interaction in quantum chemistry. This very
interaction retains the photon in the “cavity” between the source
and the detector, substantiating our assumption about possibility
of on first sight such strange, photon “circulation” between
the source and the detector.
The differential cross-section of the given process looks like:
3
𝑑𝜎 1 𝑟0 𝜆0 2 𝑅 (𝜔𝑖 − 𝜔) 𝜔02 2
= (𝑒𝑖 𝑒𝑓 ) ( ) { [𝜔 + (𝜔𝑖 − 𝜔)2 − 2𝜔𝑖 (𝜔𝑖 − 𝜔)cosΘ] +
𝑑𝑛𝑓 4 6𝜋 𝑐 𝜔𝑖 𝜔0 𝑖

+
(𝜔𝑖 − 𝜔) 𝜔02
∙ [𝜔𝑖2 + (𝜔𝑖 − 𝜔)2 − 2𝜔𝑖 (𝜔𝑖 − 𝜔)cosΘ]} (3)
𝜔𝑖 𝜔1

where 𝒆𝒊 and 𝒆𝒇 – the unit polarization vectors and 𝝎 – discharged

frequency.
In between expressions (2) and (3), despite of their superficial
resemblance, there is a fundamental difference. Within
the framework of the classical mechanism, only a discrete
discharge of the incident photon’s energy is possible,
corresponding to the excitation of the volume (with the frequency
𝝎𝟎) and dipole surface plasmon (with the frequency 𝝎𝟏) in
particles. Any other energy discharge is prohibited by the δ-
functions present in equation (1). In regard to the proposed
mechanism, the red shift of the incident photon frequency can be
any within the range. If 𝝎 ≅ 𝝎𝒊 , the result of the process is
the experimentally observed generation of radio waves.

209
 Along with a "red" shift, a “blue” shift of photon frequency is
possible... Thus, the spectrum of inelastic scattered light
(with account of localization) should occupy the entire frequency
range from 0 to 𝟐𝝎𝒊. These kinds of effects are actually observed
in experiments involving gigantic combinatory light scattering
by molecules, adsorbed on the surface of the finest metal particles
– it is called the "gigantic white background", and it still remains
a mystery.
The processes (Fig. 17), where 𝝎 ≅ 𝝎𝒊 , qualitatively explain
the increased background of the radio emission of the given laser.
Quantitative calculation, of course, requires consideration
of the system’s specifics.
Additional theoretical approaches here, possibly,
lie in the effects of the so-called “weak influences” [Chukova,
2002]. Apparently, regenerative and cytoprotective effects in our
experiments have an endoergic character: even weakly absorbed
(by biological preparations) energy of coherent red polarized laser
radiation contributes to growth of Helmholtz free energy,
accumulated in chemical bonds of biological-preparation’s
metabolites, which leads to significant biological effects.
When atoms of informational macromolecules (DNA, RNA,
proteins), interact with the laser beam, they acquire not only
the energy of light quanta, but also the light quanta momentum
of motion quantity. This creates an inverse population of nuclear
Zeeman levels, i.e chemical polarization of nucleuses. The output
of quantum polarization, namely, the number of excess nuclear
spins at the upper Zeeman level per each absorbed quantum of
light can be 30%. An inversely populated protonic-spin system
can release quanta with the energy of 6.5 × 10−26 Jouls, which
correspond to frequencies of about 100Mhz [Buchachenko, 1979].
In advancing the aforementioned, one can think that when bio-
preparations are scanned by the laser beam, there are
combinatory frequencies, occupying the blue and UV range.
Moreover, as we previously suggested in the relevant model of
localized light, there is transformation of frequencies in the range
from 2 omega to zero. [Prangishvili, Gariaev et al., 2000 (b)].

210
Besides that, broadband radio irradiation of the gas discharge in
the laser takes place when bio-preparations are scanned. Taking
this into account, we believe that in our experiments, donor
biological preparations are scanned (“read” by the laser) in
multiple-frequencies. The biochemical metabolites of
the biolocial preparations interacting with dynamically polarized
red light of the scanning laser (and the wide spectrum of
additional radiation), can generate electromagnetic radio
frequency oscillations. In this case, the preparations of pancreas
and spleen “assume” the role of peculiar organ-molecular-
radiostations, where all types of molecules have their own
characteristic frequencies, which may be reinforced
due to stochastic resonances. On the other hand, in treated
diseased animals, certain types of pancreatic molecules,
affected by alloxan, and/or stem cells in their blood can
resonantly absorb such radiation, which carry an informational
component for initiation of biochemical reactions leading to
regeneration of pancreas tissues, and initiation of protective anti-
alloxan processes. This does not exclude the significant role
of the previously discussed mechanisms, related to
teleportational and holographic properties of donor’s bio-
preparations. Considering well known provisions of chemistry
and physics, http://www.chem.msu.su/rus/publ/Buchachenko/buch
5.html, which dictate the quantum scenario for the given genetic-
bio-chemical events. In the ensemble of molecules-products with
an inversed population in Zeeman’s reservoir, energy is
accumulated. This energy may dissipate through heat (via spin-
grid magnetic relaxation), or it can be converted into stimulated
radiation at Zeeman’s nuclear frequency. In this case, the reaction
does, in fact, become a radio frequency emitter, quantum
generator with chemical pumping (similar to chemical lasers).
This new phenomenon – radiation of the chemical reaction - was
predicted theoretically and then later discovered experimentally.
This phenomenon occurs when Zeeman’s reservoir energy
exceeds the generation threshold; then, the motion of the nuclear
spins spontaneously become coherent, and such a coherent
system of nucleuses becomes a quantum generator, radiating

211
within the microwave range. Yet, this is only one aspect of
chemical radio-physics. A chemical reaction may not only be
the generator but also the receiver of microwave radiation.
Reception at the chemical level follows principles of spin
chemistry: resonant microwave radiation stimulates triplet-
singlet conversion of radical pairs (or pairs of other spin carriers)
and changes the output of chemical products. Thus, magnetic-
spin effects make biochemical reactions receivers of microwave
radiation. Moreover, such reception can be performed selectively.
If the microwave pumping involves all radical pairs (biochemical
substrata), then, the total result ultimately leads to a change of
the output of reaction products at resonant frequencies.
This effect is called reaction yield detected magnetic resonance
(RYDMR). If the “pumping” is selective and involves only radical
pairs with magnetic nucleuses, it creates the phenomenon – radio
induced magnetic isotopic effect (RIMIE). And, finally,
if the microwave “pumping” is also selective in respect to
nucleuses’ spin orientation (i.e. involves ensembles of radical
pairs with chosen orientation of the nucleuses’ spins) then,
it brings stimulated polarization of the nucleuses (SPN). This is
related to the so-called spin catalysis. It is notable for reagent’s
spin conversion, induced by a paramagnetic particle –
spin catalyzer. Conversion occurs as a result of metabolic
interaction of a catalyst (ferment) with reagents. Spin catalysis
accelerates recombination of radicals, wax-isomerization of
compounds with double bonds (by a factor of seven to eight),
recombination of spin-polarized atoms and so on. It is possible
that spin catalysis is involved into the bio-chemical processes of
the discussed pancreas’s regeneration and in the cyto-protective
effect. Manipulation with electronic and nuclear spin, lies in
the basis of spin chemistry and chemical radio-physics.
When such manipulations are performed by the chemical reaction
itself, magnetic-spin effects appear, including generation of
microwaves, then the reaction becomes a molecular radiostation.
When manipulation of spin occurs under the influence of
microwaves, secondary magnetic effects are generated.
They serve as indicators of microwave reception. Spin chemistry

212
and chemical radiophysics are closely related, however, they have
their individual goals. Spin chemistry investigates new principles
of chemical reaction management (including management with
microwaves), whereas chemical radiophysics has a significant
practical bio-medical aspect.
The existance of molecular–tissue “radiostations” raises
a principle question about the cause of a highly permeable ability
of modulated broadband electromagnetic radiation (MBER).
Recall, one group of the rats in our experiment were placed in
an isolated concrete laboratory basement and, nonetheless,
the effect of MBER on the animals was authentically and reliably
recorded. If the biologically (morphogenetically) active part of
MBER occupies the microwave range of Zeeman’s reservoir, then,
this region of MBER spectrum would have been filtered by
the concrete walls of the laboratory basement, where the rats
were placed at the time of wave irradiation. Yet, the rats received
the radiation. But how? A possible explanation could be that
the electrons of Zeeman’s levels energies of all metabolites,
including genetic structures, whilst being placed into potential
“energy hole”, experience a super fine Lamb shift of those levels
by about 1000Mhz. This shift is possible due to the existence of
longitudinal photons of atomic nucleuses, generating its
longitudinal (electrostatic) field which dipolarly excites vacuum,
and moving orbital atomic electrons interact with this excitation.
In turn, these electrons have their own electrostatic field,
composed of similar longitudinal photons. Thus, the atomic
system of electrons (alternating in time) induces around itself
a composite alternating longitudinal electric field. This field,
in the form of a longitudinal electric wave (LEW), moves instantly
and infinitely in the entire surrounding environment. Umov-
Poynting vector of this wave equals zero, i.e. a given atomic
system does not emit any impulse-energy. However, there are
vortexes of Maxwell’s longitudinal electric field, described
by the material part of biquaternions [Berezin et al., 2003].
These biquaternions are able to transfer information, which has
a numerical energy equivalent of Shannon and Brillouin.
Produced in such a way LEW, having abnormally (incredibly) high
213
permeability properties, pass almost without attenuation through
various obstacles (metal screens, ferromagnetics, dielectrics,
concrete and so on). Cellular nucleuses and their main component
– DNA – excite solitons [Smelov, 2001] of related electron waves
and solitons of hypersonic oscillation of liquid crystal
chromosomic structures, i.e. electron-vibron oscillations
[Bersuker, 1976] or electron-nucleus wave oscillations of DNA’s
double helix. The electron-vibron waves retransmit (scatter)
the received LEW back into the ether and can be received by other
biosystems, similar to the biosystem, affected by the primary
(LEW) wave of excitation.
Due to the high Q-factor ~1014 of all electron-vibron oscillation
systems, they have high sensitivity, estimated by fractions
of Planck's quanta of energy for one element of a coherent
oscillating chain, which, for example, may be a DNA spiral or
cellular membrane. In open states of a DNA spiral, initiated
by thermal motion in a live cell, electron-vibron oscillations exist
in a form of solitonic (helicoids, spiral, vortical) motions of atoms
in the strand. These are the so-called Salerno-Maslov solitons,
and they are capable of reading information from the “text” of
DNA-RNA sequences. Radiation of such “informational” solitons
is generated by electron-vibron oscillations of DNA and RNA.
Notably, information, scanned from genetic molecules, can be
transmitted to other cells (and beyond biosystems) in a relay
mode according to the mechanism of scattering with LEW’s
frequency fluctuations, radiated into the area of radio- and
acoustic-frequences. Wherein, informational radio-emission of
electron-vibron oscillations in the form of LEW at certain
frequencies, in principle, can direct biochemical processes. And
the oposite is true too: biochemical reactions in preparations,
scanned by polarized laser radiation, can generate
electromagnetic radiofrequency oscillations.
Due to the probable linguistic wave genetic content of vortical
solitonic states, initiated on DNA and RNA molecules in vivo, let’s
consider these processes in more detail.

214
27. MATHEMATICAL MODELING OF SOLITONS ON
DNA12.

Mario Salerno was first to start computer experimention

with solitons on DNA, not only as formal mathematical
structures, he also tried to relate their behavior within a single-
dimensional space of poly-nucleotides with their bio-genetic,
or to be precise, epi-genetic functions. At the same time he
advanced the first soliton theory of DNA proposed by Englander
et al. This model and its further detailed variations including ours
(see below) is introduced in terms of mechanical systems as
a chain of oscillators (DNA bases), connected by elastic non-linear
sugar-phosphate bonds. Following Salerno, our main focus was on
existing already known DNA sequences and their influence on
soliton behaviour. In the first stage we have replicated Salerno’s
experiments, yet on significantly longer DNA fragments. Indeed,
kink-type soliton excitations are sensitive to the site of their
initiation; and their motion along one of DNA strands (when they
are “open” - dsDNA is denatured as a result of temperature
fluctuations) is accompanied by a specific modulation of kinks’
trajectories in time and single-dimensional space of
polynucleotides. Such solitons represent structures emitting
electromagnetic and acoustic fields; their inner oscillating
structure is capable of reflecting and re-transmitting texts and
other linguistic structures of DNA into intracellular and
extracellular space, at least at the level of large blocks of
sequences. Below is an example of the kink’s behaviour on
a fragment of a single stranded DNA of 1020 nucleotides long
from bird sarcoma virus:
(5′-start) GGC CTA TGT GGA GAG GAT GAA CTA CGT GCA CCG AGA
CCT GCG GGC GGC CAA CAT CCT GGT GGG GGA GAA CCT GGT
GTG CAA GGT GGC TGA CTT TGG GCT GGC ACG CCT CAT CGA GGA
CAA CGA GTA CAC AGC ACG GCA AGG TGC AAG TTC CCC ATC AAG
TGG AGA GCC CCC GAG GCA GCC CTC TAT GGC CGG TTC ACC
ATC AAG TCG GAT GTC TGG TCC TTC GGC ATC CTG CTG ACT GAG
CTG ACC ACC AAG GGC CGG GTG CCA TAC CCA GGG ATG GGC

12
[Blagodatskikh, Gariaev et al., 1996; Gariaev, 1997]

215
AAC GGG GAG GTG CTG GAC CGG GTG GAG AGG GGC TAC CGC
ATG CCC TGC CCG CCC GAG TGC CCC GAG TCG CTG CAT GAC
CTT ATG TGC CAG TGC TGG CGG AGG GAC CCT GGA GGA GCG
GCC CAC TTT TCG AGC TAC CTG CAG GCC CAG CTG CTC CCT GCT
TGT GTG TTG GAG GTC GCT GAG TAG TGC GCG AGT AAA ATT TAA
GCT ACA ACA AGG CAA GGC TTG ACC GAC AAT TGC ATG AAG AAT
CTG CTT AGG GTT AGG CGT TTT GCG CTG CTT CGC GAT GTA
CGGGCC AGA TAT ACG CGT ATC TGA GGG GAC TAG GGT GTG TTT
AGG CGA AAA GCG GGG CTT CGG TTG TAC GCG GTT AGG AGT CCC
CTC AGG ATA TAG TAG TTT CGC TTT TGC ATA GGG AGG GGG AAA
TGT AGT CTT ATG CAA TAC TCT TGT AGT CTT GCA ACA TGG TAA
CGA TGA GTT AGC AAC ATA CCT TAC AAG GAG AGA AAA AGC ACC
GTG CAT GCC GAT TGG TGG AAG TAA GGT GTA CGA TCG TGC CTT
ATT AGG AAG GCA ACA GAC CGG GTC TGA CAT GGA TTG GAC GAA
CCA CTG AAT TCC GCA TCG CAG AGA TAT TGT ATT TAA GTG CCT
AGC TCG ATA CAA TAA ACG CCA TTT GAC CAT TCA CCA CAT TGG
TGT GCA CCT GGG TTG ATG GCT GGA CCG TCG ATT CCC TAA CGA
TTG CGA ACA CCT GAA TGA AGC AGA AGG CTT CATT <= 1020 (3′-
ending)
C-region of DNA (1 =>1020 nucleotides) on 3′-end of bird sarcoma virus
contains several “semantically” defined segments such
as the polypeptide-coding segment (between 558 and 675 nucleotides);
PolA (936) - 3′-end of virus RNA, polyadenylation site; 916 nucleotide -
5′-end of virus RNA (“capping site”); Red-segment - (917-936) – short
end replica of the virus genome; Pro – possible component transcription
observation (between 870-900); palindrome – “pin” (870 - 912)13 .
In Fig. 1 and 2 the kinks appear in the form of “mountain
ranges” rather than as steps, as a derivative of Sine-Gordon
equation function. Here the horizontal axis describes the DNA
sequence, and the vertical axis describes the soliton amplitude.
And the third axis, pointed towards the reader, describes time.
One can see how the change of soliton’s initiation location on
certain poly-nucleotide sequences significantly alters the single
wave dynamics (in the form of its rotational-oscillating motions
along the DNA sequence).
The examined molecule region is rich with functionally
(semantically) biologically significant segments, and we
reasonably expect these segments to alter, modulate, that is to

13
Khesin R.B. “The Volatility of the Genome”. Moscow, 1984, p.248

216
introduce “textual” information into single chain DNA or RNA.
This information will be realized in the oscillation spectrum
of the solitonic wave along the polynucleotide chain.

Fig. 1. Effects of nucleotide DNA dynamics by a conforming

perturbation on a soliton wave. Nucleotide sequence – bird sarcoma
virus (first 600 pairs) Epicenter of the perturbation – 400th nucleotide.
y – soliton amplitude; x – polynucleotide length (quantity); z – time.

Fig. 2. Effects of nucleotide DNA dynamics by a conforming

perturbation on a soliton wave. Nucleotide sequence – bird sarcoma
virus (first 600 pairs) Epicenter of the perturbation – 450th nucleotide.
The examined molecule region is rich with functionally
(semantically) biologically significant segments, and we
reasonably expect these segments to alter, modulate, that is

217
to introduce “textual” information into single chain DNA or RNA.
This information will be realized in the oscillation spectrum
of the solitonic wave along the polynucleotide chain.
Such a spectrum will mirror nucleotide sequences and, by doing
so, will perform the role of a genetic information message carrier.
Such modulation of soliton oscillation structure is clearly
observed in the presented graphs. It is plausible to believe that
the spectral composition of soliton oscillation frequencies
appears to be a mechanism for conversion of textual structures of
DNA and RNA into waveform and a means for transmitting
genetic and other messages in a single-dimentional space
alongside poly-nucleotide chains, and (or) in the three-
dimensional genome of a separate cell and/or of the tissue
continuum of the biosystem.
This is how the computer model of soliton dynamic works.
Englender was the first to apply mathematical modeling
to solitons, that was later developed by Salerno. Salerno formally
described rotational oscillations of DNA molecule nucleotides
in order to explain experimental data from hydrogen-tritium
exchange in DNA. In accordance with Engleder’s model,
“open states” (“melting” of DNA double-helix in short segments,
enriched by AT-couples) in the form of localized dislocations can
appear and propagate within DNA strand.
Mario Salerno, continuing the works of Englender in
a simplified version, discovered an influence of nucleotide
sequence on non-linear solitonic dynamics of rotational
oscillations of nucleotides within single-stranded DNA segments,
which form such “open state” regions. Later, Yakushevich,
Fedyanin and Homma et al.. reviewed various generalizations of
Englender’s model, evaluating the specifics of DNA structure,
considering the breakage of hydrogen bonds during base pair
opening, pairedness of DNA strands and other degrees of freedom,
different from rotational. However, the above-mentioned works
hardly said anything about the causes of base pair opening
in DNA. We propose a possible mechanism for this process
in DNA, which is an alternative to Englender’s hypothesis that
thermal noise is the reason for base pair opening. We think that
218
base pair opening in DNA happens with a change in the period of
the DNA spiral (to a large extent this idea belongs to Maslov
M.Yu.). In our model, DNA nucleotides are viewed as oscillators,
suspended on a weightless non-extendable pivot: sugar-
phosphate bonds between neighbouring nucleotides in a strand
are modeled by linear springs; spiralisation along the strand is not
taken into account; hydrogen bonds between complementary
bases are modeled by “gravitational” potential. The Hamiltonian
operator, in accordance to M. Salerno, looks as follows:
(1)
𝑁
1
̅𝑖 (𝜃𝑖+1 − 𝜃𝑖 )2 } + 𝜆𝑖 𝛽 [1 − cos(𝜙𝑖 − 𝜃𝑖 )],
𝐻 = ∑ {𝐼𝑖 (𝜑𝑖2 + 𝜃𝑖2) + 𝐾𝑖 (𝜙𝑖+1 − 𝜙𝑖 )2 + 𝐾
2
𝑖=1

where: θi,φi nucleotides’ rotational angles in different strands,

̅𝑖 constants of elasticity along strands, 𝑵 — number of pairs
𝐾𝑖 , 𝐾
in a strand, 𝑰𝒊 — inertia moment of the bases, 𝜷 — elasticity
constant of the hydrogen bonds bentween complementary bases.
Coefficient 𝝀𝒊 in equation (1) is determined according
to the rule: 𝝀𝒊 = 𝟐 in case of pairs АТ and ТА, 𝝀𝒊 = 𝟑 in case of
pairs GC and CG; 𝜷 = 𝟐 × 𝟏𝟎−𝟑 parameter, determined by
Fedyanin and Yakushevich14 and obtained on the basis of sine-
Gordon equation and experimental data. Later on for the sake of
model simplification, it is considered that 𝐾𝑖 = 𝐾
̅𝑖 = 𝐾, 𝐼𝑖 = 𝐼.

Motion equation for the difference 𝜑𝑖 = 𝜙𝑖 − 𝜃𝑖 , derived from

(1), according to M. Salerno, can be presented as:
𝜑̈ 𝑖 = 𝜑𝑖−1 − 2𝜑𝑖 + 𝜑𝑖+1 − 𝜆𝑖 𝛽sin(𝜑𝑖 ). (2)

𝐼
where substitution was made 𝑡 → √𝐾 𝑡 .

In case of 𝝀𝒊 = 𝝀 = 𝟏 , in the system (2) it is possible to go

to the finite differential sine-Gordon equation:

14
Fedyanin I.A., Yakushevich L.V.// Stud. Biophys. 1984.V.103.P.171

219
 𝜑𝑡𝑡 = 𝜑𝑥𝑥 − sin𝜑, (3)

“continuous analog” of the system (2). This equation has solitonic

solutions, namely, single-solitonic solutions, or kink,
corresponding to dislocation in the DNA strand.
The main assumption of the Englender-Salerno models is that
interaction between complementary bases is described
by the potential
𝑉(𝜑) = 1 − cos(𝜑), (4)

where hydrogen bond breakage is not taken into account.

In our work we look at the following potential:
1 − cos𝜑, cos𝜑 > cos𝐶
𝑉̅𝐶 (𝜑) = {
1 − cos𝐶, cos𝜑 ≤ cos𝐶
Besides that, the viscosity of the water medium is taken into
account (the viscosity of water is γ ~ 1).
We also look at the factors, leading to DNA spiralization;
wherein they are considered to be external forces, determined
by the potential
1 − cos(𝜑𝑖 + 𝐿 ∙ (𝑖 − 1)), cos𝜑 > cos𝐶
𝑉̅𝐶𝐿 (𝜑𝑖 , 𝑖 ) = { ,
1 − cos(𝐶 + 𝐿 ∙ (𝑖 − 1)) cos𝜑 ≤ cos𝐶
2∙𝜋
𝐿= 𝐷
,

where 𝑫 — spiral’s period.

Equations (2) with the potential 𝑉̅𝐶𝐿 (𝜑𝑖 , 𝑖 ) with consideration
of viscocity take the following form:

𝜑̈ 𝑖 = 𝜑𝑖−1 − 2𝜑𝑖 + 𝜑𝑖+1 −

̅𝐶𝐿
𝜕𝑉
(𝜑𝑖 , 𝑖 ). (5)
𝜕𝜑

It is known that DNA spiral period changes according

to humidity. In particular, for a crystalline DNA 𝑫𝟎 = 𝟏𝟎 in,
but in a water medium 𝑫𝟏 varies from 10.3 to 10.6. This is the very
factor causing the phenomenon of spiralization. When the spiral

220
period in DNA is changed (with fixed and locked ends), the result
is tension, related to a lack or excess of spiral turns (necessary for
its relaxed state). If 𝑫𝑫𝒓𝒚 – 𝑫𝑾𝒂𝒕𝒆𝒓 = 𝟎. 𝟓, then, during
transition from dry to moist conditions for a strand of 300 base
pairs long, an excess occurs of 𝟐𝟓𝟎 ∙ 𝑫−𝟏𝑫𝒓𝒚 – 𝑫𝑾𝒂𝒕𝒆𝒓 ≈ 𝟏. 𝟐.
−𝟏

Based on results of numerical modelling, given below, it is

assumed that the change in the spiral period can lead not only
to superspiralization, but also to local divergence of both
complementary DNA strands. Furthermore, during
superspiralization, the tension in the strand is not released
completely, that is why local divergence possibly may take place
simultaneously with superspiralisation.
The system (5) is numerically integrated in the interval
𝑻 ∈ [𝟎. 𝟐𝟎𝟎𝟎] with the increments of 𝜟𝑻 = 𝟎. 𝟏. The initial
conditions were the following:
𝜑𝑖 (0) = 𝜑𝑖𝐷 (0), 𝜑̇ 𝑖 (0) = 𝜑𝑖𝐷 (0), 𝐷 = 𝐷1 ,
Spiral period in the system (5) is 𝑫 = 𝑫𝟏 , the length of
poly(A)-strand is 300 base pairs. That is, the parameters of
the spiral period in the initial conditions and in the system (5) are
different. Thus, the DNA transfer from a crystalline state to
a moist state (close to the in vivo state) was modeled.
The boundary conditions are the follows (we call them "quasi-
cyclic"):
𝜑0 = 𝜑𝑁 − 𝑇, 𝜑𝑁+1 = 𝜑1 − 𝑇, 𝑇 = 𝜑𝑁 = 𝜑1 .
A distunguishing factor of this model is that during
the transition from a state with a spiral period of 10 base pairs
to a state with a spiral period of 10.5 base pairs, almost the whole
strand is denatured ("melted"). The result given below describe
the process of renaturing of such a strand, with the appearence
of dislocations. The following parameters varied in these
experiments:
1) the dissipation γ = 0.1 ... 1,
2) the ratio of the elasticity parameters β / K = 0,1 ... 0.5,
3) the angle of hydrogen bonds breaking C = φcut = 100 ... 200.

221
 Fig. 3 and 4 present the results of numerical integration
of system (5). They show not the function itself φ(x,t),
but the difference φ(x,t) – φD1(x), as the area of the function
change φ(x,t) (approximately from 0 to 160) is too large compared
to the characteristic changes in the system (approximately from 0
to 9).

Fig. 3-4. Describes the nonlinear relationship between "active" and

"frozen» (φi = 0) DNA strands (β – elasticity constant of hydrogen bonds
between complementary bases, λi coefficients in equation (1) are
determined in accordance with the rule: λi = 2 in the case of AT and TA
pairs, λi = 3 in the case of GC and CG pairs; β = 2 x 10-3 - the parameter
obtained earlier (see above) and determined on the basis of sine-Gordon
equation.

The horizontal part of the graphs correspond to non-

dislocated/undenatured DNA segment (double strand) with a
spiral period D1. The inclined part of the graphs in Fig. 3(a), 4(a)
222
corresponds to dislocation.
Based on this model, we can assume that
1) the ability to form dislocations in this model is strongly
dependent on φcut. When φcut = 20o dislocation took place
in all cases;
2) the ability to form dislocation also depends strongly
on the parameter β/K. In all cases, when parameter β/K is large
(β/K = 0.5), in Fig. 1(a) and 2(a), dislocation took place.
Comparison of Fig. 3(a) and 4(g) also provides evidence for this.
As additional calculations show, the influence of γ on effect is less
pronounced. Dislocation is formed or not formed regardless of the
γ value (γ = 1 or γ = 0.1). For larger values of γ, the dislocation
occurs slower than for smaller values.
3) Figures 3(a), 4(c, d), show that the dislocation has a kink-like
form.
The dislocation width depends on the parameters β/K
(the greater β/K, the smaller the dislocation width) and φcut
(the greater φcut, the smaller the dislocation width).
Further developing the models of soliton excitations in DNA
(together with Maslov et al.), we applied conditions, where DNA
strands are modeled by a set of rovibronic oscillators, suspended
on a weightless non-extendable pivot; for simplicity
of spiralization, strands are not taken into account, and
rovibronic degrees of freedom of one of the strands are considered
"frozen".
In this case, the Hamiltonian operator for the "active" strand is
as follows:

𝐻 = 𝐻0 + 𝐻1 + 𝐻2 (1)
𝑁
1
𝐻0 = ∑ 𝐼𝜑𝑖2 ,
2
𝑖=1
𝑁
1
𝐻1 = ∑ 𝐾(1 − cos ∆ 𝜑𝑖2 ),
2
𝑖=1

223
 𝑁

𝐻2 = ∑ 𝜆𝑖 𝛽 [1 − cos 𝜑𝑖 ]
𝑖=1

where: N - the number of base pairs in the strand; H0 –

Hamiltonian, describing own monomers’ oscillations (φi -
rotation angles of nucleotides in the strand, I – inertia moment
of the bases); H1 – Hamiltonian, characterizing non-linear-
periodic bond between the oscillators (K - constant of strand
elasticity, Δ𝜑𝑖 = 𝜑𝑖+1 − 𝜑𝑖 ), H2 – Hamiltonian.
1
For small Δφi Hamiltonian 𝐻1 = 2 ∑ 𝐾Δ𝜑𝑖,2 which coincides
with the corresponding part of the general Hamiltonian, used
earlier (see above). In this case the equations of motion for φi,
derived from (1) have the form:

𝜑𝑖 = 𝜑𝑖−1 − 2𝜑𝑖 + 𝜑𝑖+1 − 𝜆𝑖 𝛽 sin(𝜑𝑖 ) (2)

1
where there was a replacement of 𝑡 ′ → √𝐾 𝑡 .

If 𝝀𝒊 = 𝝀 in the system (2), we can go to a finite differential

of sine-Gordon equation:

𝜑𝑡𝑡 = 𝜑𝑥𝑥 − sin𝜑, (3)

"continuous analog" of the system (2). This equation has soliton

solutions, namely, single-soliton-solution, or kink, which
describes the dynamics of the dislocations distribution in
the strand. In accordance with (1), a system of nonlinear
equations of motion is written as follows:

𝛽 (4)
𝜑̈ 𝑖 = sin(𝜑𝑖−1 − 𝜑𝑖 ) + sin(𝜑𝑖+1 − 𝜑𝑖 ) − 𝜆𝑖 sin(𝜑𝑖 )
𝐾

As you can see, systems (2) and (4) are significantly different.
Note, however, that executed numerical modeling of dynamics
for the systems (2) and (4) showed the following: if we choose
224
a single-soliton solution of its "continuous analog" (3) - kink
(see above) as initial conditions for numerical integration (2),
there will be critical similarities in the solution types.
However, when the initial conditions are given in the following
form:

0 𝐴(𝑥 − 𝑥0 ) < 0
0(
𝜑(𝑥, 0) = 𝜑 𝑥) = {𝐴(𝑥 − 𝑥0 ) 0 ≤ 𝐴(𝑥 − 𝑥0 ) ≤ 2𝜋,
2𝜋 𝐴(𝑥 − 𝑥0 ) > 2𝜋
0 𝐴(𝑥 − 𝑥0 ) < 0
𝜑̇ (𝑥, 0) = 𝜑̇ 0 (𝑥) = {1 0 ≤ 𝐴(𝑥 − 𝑥0 ) ≤ 2𝜋,
0 𝐴(𝑥 − 𝑥0 ) > 2𝜋
(5)

where 𝝋𝟎 (𝒙) – “step” function with a 2π step height and the angle
of the inclination of the shoulder A, the difference in
the dynamics of given systems was revealed (compare Figures 1,
2, and 3.).
More precisely, systems (2) and (4) were numerically
integrated by the Runge-Kutta method of order 4 with initial
conditions, specified in the form (7), in the interval T∈ [0,750]
with an increment of ΔT = 0.1. The border conditions - "quasi-
cyclic":
𝜑0 = 𝜑𝑁 − 𝑇, 𝜑𝑁+1 = 𝜑1 − 𝑇, 𝑇 = 𝜑𝑁 = 𝜑1 .
λi = 2 (poly-A-sequence). The system parameter β/K = 0.1.
The parameter A (angle of the inclination of the shoulder
of the function φ0 (x)) was varied.
Numerical integration of the system (2) showed that two
solitary waves are formed, moving from right to left along
the strand with a constant velocity. The first wave has a quasi-
kink form, and the second wave has a quasi-briser form, wherein,
the velocity of the first wave exceeds the one of the second.
Both waves, due to “quasi-cyclic” border conditions, after
arriving to the left end, appear in the right end without any
changes in their form. A quasi-kink wave, traversing along
225
the chains of pendulums, changes the coordinate of each
pendulum to a certain angle (the pendulum makes a full cycle).
Therefore, traversing through the closed-loop chain of
pendulums 𝑲 times, it changes the coordinate of each pendulum
by the angle 𝑲 × 𝟐𝝅. This explains the “shoulder-like” form of
the graphs. Fig 2. shows the integration results for system (4)
under the same conditions. The figure shows that the same two
solitary waves are formed – quasi-kink and quasi-briser. Yet,
the principal distinction from the previous case is that in the very
beginning the quasi-kink wave moves with a negative
acceleration, so that as a result its velocity turns out to be slower
than the velocity of the quasi-briser. Note, that these experiments
were conducted on homogeneous poly-A-sequence; so the change
of the quasi-kink velocity cannot be explained by the influence of
non-homogeneous nature of the strand. This effect is explained
by non-linear interaction between its monomers.
Fig. 3 illustrates the results of integration for the system (4)
with similar conditions, except that A=2. In this case, only
a quasi-kink wave is realized and its negative accelation in
the beginning eventually makes it move in the direction opposite
to initial. With implementation of the system (2) under similar
conditions also only a quasi-kink wave is formed. And its velocity
does not change in comparison with the case shown in Fig 1.
Importantly, under appropriate conditions in a system of DNA
or RNA type, over excited rovibronic states may take place.
In quantum language this would be similar to a re-population
of highly located quantum levels compared to the base levels
(realization of population inversion). In this case, an attractive
idea may come to mind, an idea that the invention of a bio-
solitonic laser (BSL) on DNA molecules15 may be possible.
However, in the theory of biopolymer dynamics, it is well
known that conformational motions are realized according
to the mechanism of limited diffusion, due to the strong influence

Note also the idea of J.N. Zhivlyuk, associated with the creation of lasers based
15

on the phase transitions of bio-macromolecules (personal correspondence).

226
of dissipative forces from the micro-environment. For this reason,
the solution to the problem for the creation of a bio-solitonic laser
(on DNA) looks quite problematic. At least, for the proof of
∆𝑥
the idea it is necessary to fulfil the conditions 𝜏 ≈ < 𝜏𝑑𝑖𝑠𝑠 ,
𝑣
where ∆𝑥 and 𝑣 - soliton width and velocity respectively, 𝜏𝑑𝑖𝑠𝑠 -
dissipation time. If ∆𝑥 = 5A and 𝑣 = 105 𝑐𝑚/𝑠 (the velocity of
sound), we get 𝜏𝑑𝑖𝑠𝑠 > 5 × 1013 s. Note that the characteristic time
of the dissipation due to water hydrodynamic forces is 𝜏𝑑𝑖𝑠𝑠 =
1012 ÷ 1010 s and attenuation time, determined by the processes
within the molecule itself is 𝜏𝑑𝑖𝑠𝑠 = 1011 ÷ 109 s [Shaitan, 1994;
Chernavsky et al., 1986].
There is also another complication, related to self-
concordance between biosolitons and electromagnetic wave
reradiation. Let us remember that mathematical modeling in this
case was conducted on monotonous poly-A-DNA and therefore,
it was unclear whether heterogenic natural DNA sequence has
any influence on the dynamics of solitonic excitation in a
molecule. To test this, as earlier, a DNA C-region from the 3′-end
of bird sarcoma virus was used as a testing ground for soliton
initiation at various segments of the polymer. This time
the function derivative was calculated to better illustrate
the motion of solitons.
Similar to Fig. 1-3, Fig. 5-7 distinctly shows significant
modifications in solitons’ behavior when altering parameter A.
This is especially evident in Fig. 7, where the solitonic wave
travels, similar to the one in Fig. 5-6, at first to the left and then
sharply turns to the right. This has a certain biological
significance. Soliton as a potential DNA “reader” must “review”
prolonged contextual zones, rather than get stuck, fluctuating
sinusoidally on the same “words” - locuses of DNA and RNA.

227
Fig. 5. Results of numerical modelling of excitation propagation dynamics
in DNA based on system (2) where parameter A=1. a) Side view b) Above
view.

Fig. 6. Results of a numerical modelling of excitation propagation

dynamics in DNA based on system (4) where parameter A=1. a) Side
view b) Above view.

Fig. 7. Results of numerical modelling of excitation propagation dynamics

in a DNA based on system (4) where parameter A=2. a) Side view b)
Above view.
Considering non-linearity of co-valent bonds in the sugar-
phosphate DNA backbone, then, we observe additional features
of solitons’ behavior (Fig. 8-10): the shift of a solitonic wave

228
initiation area within the birds sarcoma virus DNA-fragment
between the 200th and 500th nucleotide, then, these are additional
rotational waves of oscillations, propogating in both directions
from the main excitation wave. Bouncing back from the fixed DNA
ends (in vivo nucleosomes act as fixators), they return to
the central excitation and further modulate it. Such additional
waves play a role of “informants” about nucleotide composition
and bases’ sequence in the scanned segment of DNA or RNA, and
this information can be “memorized” on the level of return
of the Ferni-Pasta-Ulam Problem and be used by
the chromosomal biocomputer for making appropriate
“decisions”.
A substantial feature, DNA “scanning” by solitons is especially
well seen in Fig. 8-10. This is the presence of additional (besides
the main one) trajectories of solitons with rich modulation.
Such additional modulated solitons’ trajectories (with a kink and
briser structure) can bear additional subtle nuances of
distribution of wave genetic information along the DNA and RNA
strands.

Fig. 8. DNA solitonic excitation, taking into account non-linearity

of co-valent bonds in the sugar-phosphate DNA backbone. Nucleotide
sequence – bird sarcoma virus (first 600 base pairs). Excitation center –
200th nucleotide.

229
Fig. 9. Same as in Fig.8, but excitation center – 400th nucleotide

Fig. 10. Same as in Fig. 8,9, but excitation center – 500th nucleotide

230
28. ANTENNA MODEL.

Earlier, we have noted [Gariaev, Maslov et all, 1996 (a);

Gariaev, Maslov et al., 1996 (b)], that proteins are the main
molecules (if not the primary molecules), which perceive external
electromagnetic fields as regulatory fields. This is especially true
for metalloproteins. Functioning of some biological macro-
molecules (namely, ferments) is largely determined by processes,
taking place in the active centres, surrounded by biopolymer
strands with a linguistic topology. Taking such a view on
informational bio-macro molecule structure, it is natural
to assume that their interaction with physical fields, external in
relation to the biosystem and internal (organismic) radiations,
leads to excitation of dipolar-active oscillations of monomers,
forming the given biopolymer strands, and the latter in turn
induce oscillation in the active centre. In other words, such
system will work as a kind of antenna. These excited oscillations
may lead to bio-macro-molecule transformation into other
conforming (topological, linguistic) state.
This concept is valid for a whole set of functionally vitally
important bio-macro-molecules, for example, chlorophyll,
haemoglobin, myoglobin and so on. These macromolecules have
in common two structural features:
1) there is an ion in their geometrical centre (in the case
of chlorophyll – magnesium, in the case of haemoglobin – iron);
2) four pyrrole rings (pseudo flat structure) are symmetrically
placed near the ion.
Other types of polymers, valid for the antenna model, could be
represented by relatively simple cycles, such as valinomycin
(potassium ions’ carrier) and complex supramolecular
chromosome structures, DNA of which contains highly organized
associates of such metals as magnesium, calcium, nickel, cobalt,
copper, iron, zinc and others. Wherein, their role is not clear and
mainly reduced by researchers to neutralization of OH-groups of
polynucleotide phosphoric acid remnants. It seems to us that
metals functions in DNA and RNA are substantially broader and
231
are realized in accordance with linguistic and/or energy
interaction with physical fields, endogenous and exogenous in
relation to the biological system. The same is valid for proteins
without a porphyrin centre, which still in a specific way bind
metals. For example, these could be site-specific proteins with
“zinc-fingers” type of domain, which participate in gene
regulation are often are far away from those directing proteins.
Metal atoms of DNA and proteins can resonantly interact via
electromagnetic channels within the framework of this antenna
model. Let us define the concept of antenna model.
External energy (in particular, related to resonant interaction
of high-frequency electromagnetic radiation with proteins)
reaches the periphery, that is onto the ensemble of sub-units (not
necessarily identical in structure). As the result of active
“conversation”, predetermined by bio-chemical bonds between
the peripheral acceptors (which have received encoded energy)
and the associate-centre (in this case, the ion of heme-containing
proteins’ metal), the latter receives the energy (information) and
this initiates a biological action. The degree of bio-macro-
molecules reactive ability depends, to a large extent, on the level
of excitation of the central sub-units. Let’s look at the potential
mechanisms of physical fields wave interactions with the active
centres of informational bio-macro-molecules within
the framework of proposed antenna model.
As an example of the simplest model for illustration
of the antenna effect, let’s consider a 2-dimentional closed
(cyclic) monomeric strand. In the centre of this cyclic strand,
there is an active centre, related to the monomers of the strand by
dipole-dipole interaction.
Let’s mark the coordinate shifts of monomers as 𝒙𝟏 , … , 𝒙𝑵′ , and
the shift of the active centre as y. For the potential function
we have:

232
 𝜉𝑥 3 𝜉𝑦
𝑈(𝑥1 , … , 𝑥𝑁 , 𝑦) = ∑ [𝜔𝑥2 𝑥𝑘2 + 𝑥𝑘 ] + 𝜔𝑦2 𝑦 2 + 𝑦 3 +
3 3
𝑘
2
𝜔𝑥𝑥 (1)
+∑ [(𝑥𝑘 − 𝑥𝑘−1 )2 + (𝑥𝑘 − 𝑥𝑘+1 )2 ] +
2
𝑘
𝜉𝑥𝑥
+ ∑𝑘 [(𝑥𝑘 − 𝑥𝑘−1 )3 + (𝑥𝑘 − 𝑥𝑘+1 )3 ] + ∙∙∙
3

The first two terms in (1) correspond to the oscillations

of monomers (the second term takes into account
the anharmonicity); the last two terms are responsible
for communication between the monomers, remaining members
are responsible for interaction between the monomers and
the active centre.
The equation of motion can be written as:
𝜕𝑈 𝜕𝑈 (2)
𝑥̈ 𝑘 + 2𝜆𝑥̇ 𝑘 = + 𝑓 (𝑡), 𝑦̈ + 2𝜆𝑦 = ,
𝜕𝑥𝑘 𝜕𝑦
where 𝑓 (𝑡) = 𝑓0 cos𝜔𝑡 external monochromatic force, acting only
on monomers, λ - coefficient of attenuation, introduced
phenomenologically (for the sake of simplicity, considered to be
the same for monomers and for the active center).
With regard to (1), the system of equations (2) takes the form:
𝑥̈ 𝑘 + 𝜆𝑥̇ 𝑘 = −𝜔𝑥2 𝑥𝑘 − 𝜉𝑥 𝑥𝑘2 − 𝜔𝑥𝑥
2 (
𝑥𝑘−1 − 2𝑥𝑘 + 𝑥𝑘+1 ) +
(3)
2 (
+𝜔𝑥𝑦 𝑦 − 𝑥𝑘 ) + 𝜉𝑥𝑦 (𝑦 − 𝑥𝑘 )2 + 𝑓 (𝑡),
𝑦̈ + 𝜆𝑦̇ = −𝜔𝑦2 𝑦 − 𝜉𝑦 𝑦 2
𝑁 𝑁
2 ∑(
− 𝜔𝑥𝑦 𝑦 − 𝑥𝑘 ) + 𝜉𝑥𝑦 ∑ (𝑦 − 𝑥𝑘 )2 ,
𝑘=1 𝑘=1

𝑥𝑘 + 𝜆𝑥𝑘 + (𝜔𝑥2 + 𝜔𝑥𝑦

2 )𝑥 2
𝑘 − 𝜔𝑥𝑦 𝑦 =

2 ( 2
= −𝜔𝑥𝑥 𝑥𝑘−1 − 2𝑥𝑘 + 𝑥𝑘+1 ) + 𝜔𝑥𝑦 𝑥𝑘 + 𝜉𝑥𝑦 (𝑦 − 𝑥𝑘 )2 +
𝑓(𝑡),

233
 𝑁

𝑦 + 𝜆𝑦 + (𝜔𝑦2 + 𝜔𝑥𝑦
2 2 ∑
𝑁)𝑦 − 𝜔𝑥𝑦 𝑥𝑘 = 𝜉𝑦 𝑦 2
𝑘=1
𝑁
(4)
− 𝜉𝑥𝑦 ∑ (𝑦 − 𝑥𝑘 )2 .
𝑘=1

Let’s introduce the common coordinate for the ensemble

of monomers:
𝑁
(5)
𝑥 = ∑ 𝑥𝑘
𝑘=1

Then, the system of equations (4) in the linear approximation

takes the form:
𝑥̈ 𝑘 + 𝜆𝑥̇ 𝑘 + 𝜔12 𝑥𝑘 − 𝜔02 𝑦 (6)
= −Ω20 (𝑥𝑘−1 − 2𝑥𝑘 + 𝑥𝑘+1 ) + 𝜉𝑥 𝑥𝑘2 + 𝑓(𝑡),
𝑦̈ + 𝜆𝑦̇ + 𝜔22 𝑦 − 𝜔02 𝑥 = 0,
where:
𝜔12 = 𝜔𝑥2 + 𝜔𝑥𝑦
2
,
𝜔22 = 𝜔𝑦2 + 𝑁𝜔𝑥𝑦
2
,
𝜔02 = 𝜔𝑥𝑦
2
,
Ω20 = 𝜔𝑥𝑥
2
,
N – is the number of monomers.
Taking into account (5), we have
𝑥 + 𝜆𝑥 + 𝜔12 𝑥 − 𝑁𝜔02 𝑦 = 𝑁𝑓(𝑡), (7.1)
𝑦 + 𝜆𝑦 + 𝜔22 𝑦 − 𝜔02 𝑥 = 0. (7.2)
From (7.2) follows
1
( 2 ) (8)
𝑥= 2 𝑦 + 𝜆𝑦 + 𝜔2 𝑦 = 0.
𝜔0

Substitution of (8) into (7.1) gives

𝑦 (4) + 2𝜆𝑦 3 + (𝜔12 + 𝜔22 + 𝜆)𝑦 (2) + 𝜆(𝜔12 + 𝜔22 )𝑦 (1)
+(𝜔12 𝜔22 + 𝑁𝜔04 )𝑦 = 𝑁𝜔04 𝑓(𝑡). (9)

234
The corresponding characteristic equation has the form (after
substituting 𝒚 = 𝒆𝒌𝒕 into the homogeneous equation):
(𝑘 2 + 𝜆𝑘 + 𝜔12 )(𝑘 2 + 𝜆𝑘 + 𝜔22 ) = 𝑁𝜔04 (10)

Denoting 𝑧𝑘 = 𝑘 2 + 𝜆𝑘, we get

𝑧 2 + (𝜔12 + 𝜔22 )𝑧 + 𝜔12 𝜔22 − 𝑁𝜔04 = 0,
so that
1
𝑧1,2 = − (𝜔12 + 𝜔22 ) ± √(𝜔12 + 𝜔22 )2 + 𝜔12 𝜔22 − 𝑁𝜔04 . (11)
2

In the future, we assume these statements to be validated:

𝜔12 <
𝜔12 𝜔22
, √𝜔12 + 𝜔22 . (12)
√𝑁

The first condition corresponds to the case of weak interaction

between monomers and the active center, the second corresponds
to the small attenuation of monomer oscillators.
For our values we have
𝜆 𝜆2 𝜆 𝜆2 (13)
𝑘1,2 = − 2 ± √Ω12 − 4
, 𝑘3,4 = − 2 ± √Ω12 − 4
,.

where collective frequences are introduced:

1⁄
1⁄ 2
1 1 2
Ω1 = { (𝜔12 + 𝜔22 )2 + [ (𝜔12 − 𝜔22 )2 + 𝑁𝜔04 ] } ,
2 4
1⁄
1⁄ 2
1 1 2
Ω2 = { (𝜔12 + 𝜔22 )2 − [ (𝜔12 − 𝜔22 )2 + 𝑁𝜔04 ] } . (14)
2 4

We are interested in the forced oscillations (the external force

𝑓0 cos𝜔𝑡):
𝑦 = 𝐴cos𝜔𝑡 + 𝐵sin𝜔𝑡. (15)
Substitution of (15) into (9) and equating corresponding
coefficients, where cos𝜔𝑡 and sin𝜔𝑡, lead to the system of
algebraic equations:

235
 𝐴(𝜔2 + 𝛼2 𝜔2 + 𝛼0 ) − 𝐵 (2𝜆𝜔3 + 𝛼1 𝜔) = 𝐹0
{ ,
𝐴(2𝜆𝜔3 + 𝛼1 𝜔) − 𝐵(𝜔4 + 𝛼2 𝜔2 + 𝛼0 ) = 0
where:
𝛼0 = 𝜔12 𝜔22 + 𝑁𝜔04 ,
𝛼1 = 𝜆(𝜔12 +𝜔22 ),
𝐹0 = 𝑁𝜔02 𝑓0 .
As a result we get
𝐹0
𝑦= cos(𝜔𝑡 + 𝜑),
√𝑝2 +𝑞 2

𝑝 = (𝜔2 − 𝜔12 )(𝜔2 − 𝜔22 ) + 𝜆2 𝜔2 + 𝑁𝜔04 ,

𝑞 = 𝜆𝜔(2𝜔 − 𝜔12 − 𝜔22 ),
𝑞
where tan𝜑 = 𝑝.

After simple but cumbersome transformations for the forced

oscillations of the active center, we get:

𝑦=
𝑁𝜔02𝑓0cos(𝜔𝑡+𝜑 )
. (16)
2 2
√(𝜔 2−Ω21 )(𝜔 2−Ω22 )+𝜔 2𝜆2 [𝜔 2 𝜆2 +(𝜔 2 −Ω21 ) +(𝜔 2−Ω22 ) ]

From (16) we see that the highest amplitude of the forced

oscillations of the active center is achieved under condition
of a collective resonance: of either ω = Ω1, or ω = Ω2.
In any of these cases, for the forced fluctuations amplitude
we have:

𝑦=
𝑁𝜔02𝑓0
. (17)
2
𝜔𝜆√𝜔 2𝜆2 +(Ω21 −Ω22 )

From (17) it follows that the greatest effect of the resonant

swing of the active center is achieved under condition of a greater
number of “antenna” peripheral subunits, under the condition
of a higher value of the coefficient describing the intercation
of the active center with monomers, and under condition
of the lowest coefficient of attenuation and the smallest
disbalance of collective modes.
It is also easy to identify the "choreography" (the dynamics
236
of forced oscillations) of the individual monomer units.
In accordance with (6), the equation for kth monomer can be
written as:
𝑥̈ 𝑘 + 2𝜆𝑥̇ 𝑘 + 𝜔02 𝑥𝑘 = Ω20 (𝑥𝑘−1 − 2𝑥𝑘 + 𝑥𝑘+1 ) (18)
+𝜔02 𝑦 + 𝑓(𝑡).

Introducing the collective coordinates

𝑁
2 sin𝑚𝑘𝜋
𝑧𝑚 = √ ∑ 𝑥 , 𝑚 = 1, … 𝑁
𝑁+1 𝑁+1 𝑘
𝑘−1

and applying the method from linear algebra, for the forced
oscillations of monomers we obtain:

𝑥𝑘 = √
2
∑𝑁
sin𝑚𝑘𝜋
[𝑓0 cos(𝜔𝑡 + 𝛿𝑚1 ) + 𝑦0 cos(𝜔𝑡 + 𝛿𝑚2 )]. (19)
𝑁+1 𝑚−1 2 )2+𝜆2 𝜔 2
√(𝜔 2−𝑣𝑚

where

𝑚𝜋
2
𝑣𝑚 = 𝜔02 + Ω20 sin2 ,
2𝑁+1
𝑚 = 1, … 𝑁,
𝜋 𝜋 𝑁
2 sin 2 𝑚 ∙ sin 2 𝑁 + 1
𝑠𝑚 = √ ∙ 𝜋 𝑚
𝑁+1 sin 2 𝑁 + 1

𝑦0- is determined from (16).

Thus, within the framework of antenna model, the maximum
effect of an external monochromatic field 𝑓 (𝑡) = 𝑓0 cos𝜔𝑡 is
realized under the condition of collective resonance:
Ω1 = 𝜔, Ω2 = 𝜔 .
Repeating the arguments of section 2, we can make
the following conclusions:
1) When the the external signal amplitude modulation is realised,
there are additional possibilities for resonant influence on bio-
237
macro-molecules at the frequencies:
𝜔,
Ω1,2 = {𝜔 + Ω,
𝜔 − Ω.
2) Consideration of non-linearity during quadratic relation
for a monochromatic signal introduces an additional resonance
at the second harmonic 𝜴𝟏,𝟐 = 𝟐𝝎.
3) Consideration of non-linearity during the amplitude
modulation determines a number of resonant possibilities:
𝜔,
2𝜔,
Ω1,2 = { 2𝜔 ± Ω,
2(𝜔 ± Ω).
Thus, when the resonant electromagnetic field affects
the bio-macro-molecules with the active centre (containing metal
atoms), collective wave effects play a significant role. In this case,
the properties of the very radiation predetermine wide
possibilities for regulatory effects on bio-macro-molecule
dynamics in general, and, hence, regulatory effects on biological
processes, in which they are involved, thus, directly or indirectly
realizing directing and (or) disorganizing signals.

238
29. THE WAY FORWARD.

Analysing the present state of genetics, I appeal mainly to logic

and common sense, operating with well-known scientific data
with F. Crick’s triplet model of the protein code at the core.
This model contains a strategic gap, in a form of a purely logical
hole the size of Mont Blanc. And surprisingly, this Mont Blanc
seems to be unseen. At the same time everyone admits that
the code contains codon synonyms, which are subject
to Lagerkvist’s “two out of three” method.
I postulate a very simple and logically correct idea that
the triplet protein code, in addition to synonyms, contains
homonyms. Lagerkvist’s method, based on F. Crick’s experiments
and Wobble Hypothesis states: anticodons ‘read’ codons by
the first two nucleotides, the third nucleotide oscillates, wobbles,
is random, i.e., represents a "steric crutch." This method is valid
for synonyms, and this was quite clear without Lagerkvist.
But will Lagerkvist’s method be valid for non-synonyms
(homonyms, according to my theory)? Will this rule of “anticodon
– codon reading” apply to homonyms? F. Crick had nothing to say
in this regard. Lagerkvist, the author of the “two out of three”
method, also has nothing to say. Nothing is found in the scientific
literature either.
Not long before his death, in his book, F. Crick confessed that
he actually did not understand his own model: “although
the genetic code has certain regularities—in several cases it is the first
two bases that encode one amino acid, the nature of the third being
irrelevant—its structure otherwise makes no obvious sense.”
What are these cases when it does not have any sense? I am sure
that F. Crick ran into amino acid-stop ambiguity codon-
homonyms. F. Crick probably saw this and realized that such
ambiguity reveals a significant, fundamental deficiency in his
model. But what did this mean to F. Crick personally? It meant
and means that using the canonical table of the code suggested by
him, all organisms, including Humans, will ingloriously die
at the moment of selection of amino acids and stop positions
when ribosomes meet codons-homonyms. What did F. Crick do,
239
realizing all this? Nothing. And why would you do anything?
All went well. The proteins (seemingly disregarding
the homonyms of the template-RNA) are successfully synthesized
in vitro and in vivo, and the Noble Prize had already been received.
What else may you wish for? However, there was a problem
of a personal nature - scientific conscience. Only before his death
F. Crick voiced a thought about the un-deciphered aspect
of "no obvious sense" in the code [F. Crick “What Mad Pursuit?”
A Personal View of Scientific Discovery ISBN 10: 0465091385,
ISBN 13: 9780465091386, 1990].

In short, the problem was actually ignored; nobody wanted

to be more saintly than the Pope of Rome (Crick). Lagerkvist
in the Proceedings of the National Academy of Sciences tried
to state something reasonable and came up with the “Two out
of Three” method, already obvious to all [Ulf Lagerkvist, 1978].
By doing so, he patched the obvious (homonymous) contradiction
and obscured the problem, stating the knowingly unacceptable:
these homonyms are rare (when in fact, they are 50% of
the code!), so there is no big deal… A cancerous tumor of
misunderstanding was anointed with iodine...
240
 Let’s admit, the ignorance of homonym problem turned out
to be very costly. The first warning signals were the questionable
safety of transgenic foods and the mass deaths of honeybees
in transgenic crops in the United States.
Acknowledging this, we have to admit that the Genetics and
Molecular Biology which do not consider the real linguistic,
mental component (with codon-homonyms as a vector),
such Genetics and Molecular Biology is in fact nothing more than
a colossus with feet of clay (weak in the knees). However,
there have been, and there are minds capable of fundamental and
thorough analysis of the protein code without shading. Deceased
Yu. B. Rumer, came close to the problem of homonyms in his last
work [Konopelchenko, Rumer, 1975] and suggested
interpretations of Crick’s Wobble Hypothesis on ‘codon-
anticodon’ recognition. His interpretation essentially introduced
the concept of the probability character of codon recognition.
V.I. shCherbak, close to this field of mathematical genetics, also
demonstrated that the genome uses the language of mathematics.
In other words, the genome has quasi-intellect. This fundamental
idea is very much disliked by orthodox materialists, and some of
them went to all means and lengths, going far beyond the scope
of scientific ethics and science, to present counterarguments.
But all this is just the prelude. The main show is still ahead.
We have reviewed the synthesis of proteins and found that
we don’t clearly understand, we miss the mental, the main
operating component of the genome. This component in itself has
a wave quantum foundation. That is the main point. After 80 years
of stagnation in this field, since the pioneering research
of Gurwitsch, Lubishchev and Beklemisheva, now we evidence
a clear and powerful breakthrough, driven by the works
of Jiang Kan Jen, Mosolov, Budagovsky, Kaznacheev-Mihailova-
Trofimov, Burlakov et al., the brilliant work of Daniel Fels in PLoS
ONE. And finally, our works, based not on bare empiricism, but on
physics-mathematics and theoretical-genetic analysis, which laid
the foundation for the creation of a pilot model for a quantum
biocomputer – a model of the genetic apparatus functioning
on the wave level. This quantum biocomputer allowed us at
241
a higher level, with more competence and complexity, confirm
earlier known facts about the distant transmission of working
wave genetic information.
Yet, there is still some dissatisfaction in regard to the triplet
genetic protein code model. Suggested by us amendments to this
model about the functions of codon-homonyms have a purely
logical character. Can our righteousness be proven
experimentally? Can we prove that codon-homonyms represent
a linguistic vector, which in its own fashion consciously direct
the biosynthesis of proteins? This is of fundamental importance,
but not easily done. I assume, that it is possible.
Let’s consider an article “Coding-Sequence Determinants
of Gene Expression in Escherichia coli” by the authors Grzegorz
Kudla, Andrew W. Murray, David Tollervey and Joshua B. Plotkin
[www.sciencemag.org SCIENCE VOL 324 10 APRIL 2009]. This is
a well-written high-standard article, but it contains
a fundamental mistake that is very significant. The authors used
a library of modified (mutant) genes of the so-called green
fluorescent protein (GFP). They introduced these mutant genes
into E. coli and using fluorescence, analyzed GFP synthesis.
The key data and, at the same time, the main demonstration of
their errors, are presented in the table below.
The authors present the aligned sequences of 15 synthesized
GFP genes, erroneously believing that for the third nucleotide
mutations they only used codons-synonyms. A simple reference
to the canonical table of the genetic code is enough to prove this.
The authors write that they worked only with synonymous
(syn-codons), introducing mutations to the third codon
nucleotides in GFP genes. Naturally, they expected that
all proteins synthesized by E. coli with these genes should be
identical. To quote the authors: “We synthesized a library of green
fluorescent protein (GFP) genes that varied randomly in their
codon usage, but encoded the same amino acid sequence.
By placing these constructs in identical regulatory contexts and
measuring their expression, we isolated the effects of
synonymous variation on gene expression”.
242
 It will be true, indeed, if you use a replacement for the third
nucleotide in syn-codons. And that is confirmed by the authors
in their protocols. In that particular case, it was possible to say
that they obtained the "same amino acid sequence" in
the synthesized GFPs. But in fact, the authors used for their
manipulations not only syn-codons, but also homonymous
codons (See Fig. 1b). And here comes another author’s oversight,
an inexcusable one. There was no control of peptide sequences of
synthesized proteins. Instead, the authors looked only at
the fluorescence of the synthesized proteins. And this
fluorescence varied significantly. Why was it variable?
The authors believe that fluorescence variations of produced GFP
could be explained by changes in their primary and secondary
structures. They have not verified this fact either. The authors
side-tracked, showing what was already previously known –
a strong correlation between the type of the secondary structure
of mRNA and fluorescence. This provided them with a simple
mechanistic explanation that substantial folding of mRNA,
encoding GFP proteins, impedes the translation initiation, and
therefore, impedes GFP synthesis. This is trivial and this is not
the main point. The main point is that the authors introduced
mutations for the third position, including into the codon-
homonyms, erroneously considering them to be synonyms.
Paradoxically, this error provokes the idea to check codon-
homonyms role in protein synthesis. Following the hypothesis
about the semantic (or in reality, mRNA- textual) orientations
of the cells genome, then, these manipulations with mutagenesis
were changing the texts (contexts) of at least some of the mRNA
pool of the obtained GFP genes library. And consequently, due to
different contexts, the meaning (semantics) of the codons-
homonyms were also different compared to the original genes.
If this is truly the case, it s logical to expect the substitution
of amino acids (at least in the part of the synthesized GFP)
compared to the control, when, let me remind you, in reality
the authors didn’t perform any (control). Substitutions of amino
acids in synthesized, allegedly silent mutant GFP, could have gone
two ways.

243
Fig. 1B. An example of alignment, demonstrating the variety of
sequences amongst 15 synthetic GFP genes. Long columns represent
the first two nucleotides (doublets) in codons, which did not mutate.
These are the doublets of GG, GA, GC, AC, TA families. Shorter columns
represent the third (wobbling) nucleotides in codons, which randomly
mutated.

1st (canonical). As for example in the homonymous TT family,

TTG → TTT substitution in homonym leads to Leu → Phe
substitution, or in any other homonymous codon families - AT,
TA, CA, AA, GA, TG, AG, if substitution is done for the third
nucleotide.
2nd (contextual, hypothetical). When the substitution
for the third nucleotide in some codon-homonyms changes
the contextual landscape of remaining intact codon-homonyms
and, consequently, they can no longer remain obscure and
undefined, they get their exact meanings. In this case, tRNA
interprets codon- homonyms according to the context of
the entire mRNA. This allows for an unambiguous selection of
a particular amino acid or a stop. It is this path proves the codon-
homonym-semantic (mental) vector of protein synthesizing
system of the cell and its entire genome.
Analysis of Fig. 1b, proposed by authors, suggests that they,
contrary to their assertion, worked not only with syn-codons,
but also with homonymous codons. DNA sequences in obtained
15 mutant genes (from 94 to 123 nucleotide) contain six syn-
244
codons and four homonymous codons. The last ones belong to GA
and TA families. GA is responsible for the selection of Asp and
Glu, TA is responsible for the selection of Tyr and Stop (depending
on the context, modified by mutant codon-homonyms).
The mutants were obtained by the authors in the following
synonymous families - GG, GC, AC. And this is only for 15
synthetic genes (out of 154 in total).
However, we should be careful, thinking that working only
with homonym-mutant genes in the third nucleotide will
necessarily lead to success. We do not know the required length
of the genetic text and the required proportion of homonyms and
synonyms for some codon-homonyms to produce different code
meanings. A lot of experimental work is required with many
different genes. Linguistic Genetics, as a component of Wave
Genetics, is in its infancy.

Let’s summarize the proposed methodology for the codon-

homonyms’ role verification
The initial canonical statement - “amino acids and stops are
coded only by the first two bases of (two out of three) codons,
the third base is not involved in the coding and may be any
of the four” - is evident from the table of the standard code.
‘Any’ means that in all codon families, the third nucleotide
position is monotonous and the same - T,C,A,G. And this
contrasts with the unique combinatorics of the bases of the first
two positions in all codons.

Formulation of the problem

Ribosome selection of the synonymous codons (amino acids and
stops) is simple and redundant (isoacceptor tRNA’s). In case
of homonymous (ambiguous) codons, the ribosome (or rather
the protein synthesizing apparatus and the entire cell) faces
the task of selecting one of two different amino acids, as well
as the task of selecting an amino acid or stop. How are these
fundamental tasks resolved in vivo?

245
 Hypothesis
In homonymous situations (when ribosomes meet non-
synonymous codons with weak, according to Yu. B. Rumer, two-
sign roots - meaningful doublets of bases), the selection is based
on the facts that:
- the genetic apparatus and the entire cell represent
a biocomputer, capable of elementary acts of consciousness-
intelligence,
- capable of reading and comprehending mRNA as a real (non-
metaphorical) linguistic structure, namely, as a text (context),
- capable of making a decision on the selection of amino acids
(stops) on the basis of a simple comprehension of the meaning
and purpose of the mRNA (protein) in the organization
of biochemistry and other higher functions, including quasi-
consciousness.

Example of experimental proof of the hypothesis

GFP gene consists of 240 codons. The authors
of the aforementioned article randomly introduced silent
mutations for the third base position in synonymous codons of
154 genes, with no change to the first and the second base
positions. Notably, the synthesized structures were placed
in identical regulatory contexts and the expression of such
modified genes was determined in E. coli cells. As expected,
these genes did not cause any changes in the structure and
fluorescence of GFP, expressed in E. coli. Though these genes
affected the yield of GFP; the yield of proteins was also affected
by variations of the secondary mRNA structure, caused
by substitution of bases. Remember, that the code meaning
of synonymous codons in each family does not depend on the type
of the third (3') base. The same rule should apply to the families
of homonymous codons, though it is not declared anywhere.
In this case, automatically, there comes the problem
of ambiguous selection of amino acids and stops by the ribosome.
In this situation, it seems logical to introduce a mutation
for the third position of bases for some homonymic codons.

246
The "two out of three" reading method of homonymic codons
by anticodons must be valid (See The Table of The Code), but this
contradicts the ambiguity of the code assignments of their coding
doublets (the first two codon bases). That is why, the other part
of homonymous codons must change the code’s meaning,
depending on the modified context and mRNA meaning (due to
mutations in the third base). For this reason, one can expect
a change in the primary structure of expressed by E. coli GFP,
which will not be identical to the original GFP, not only
in structure but also in functionality, as well as in fluorescence.

It should be noted that the quantitative aspect of these kinds

of experiments is unknown, namely, what should be the ratio
of synonymous and homonymous codons within mRNA. You can
only be confident that the number of codon-homonyms should
be more than one. If there is one homonym or a small number
of homonyms, then, their unambiguous reading probably will be
determined by the secondary mRNA structure.

247
30. FINAL COMMENTS.
In his memoires in the book “What
A Mad Pursuit”, F. Crick says
in a nutshell: “An important point
to notice is that although the genetic code
has certain regularities—in several cases
it is the first two bases that encode one
amino acid, the nature of the third being
irrelevant—its structure otherwise makes
no obvious sense.” The key point of this
phrase is that, if we do not accept
the idea of wobbling for the 3rd
nucleotide in the code model, then,
the model completely loses its sense.

The biggest question is, what are the ‘several cases’ that Crick
had in mind? He doesn’t give any answer, neither does Lagerkvist,
neither does anyone else. Ulf Lagerkvist though tried to classify
the codon families but made it in a strange fashion [Lagerkvist,
1978]. He divided them into 2 groups:
1) "Strong mixed codon interactions":
5 synonyms and 2 non-synonyms (homonyms);
2) "Weak mixed codon interactions":
2 synonyms and 5 homonyms.
What are the strengths and weaknesses of these groups?
Why both groups contain mixed codons, e.g. why they contain
both synonyms and homonyms? The author does not provide
any clarifications to these questions. And the main reason for
this, is that neither F. Crick, nor anyone after him, tried
to understand the functions of non-synonymous codons, e.g.
homonyms, to my definition. This has remained their blind spot.
U. Lagerkvist was the first who tried to exacerbate the problem
by pointing at the dangerous ambiguity of non-synonyms,
with dangerous errors in protein synthesis, but limited himself
to the incorrect statement about the alleged rare occurrence

248
of codons – non-synonyms. The problem here is that F. Crick,
neither in his Wobble Hypothesis nor anywhere else, answers
the key question: does the wobbling of the third nucleotide occur
in all codons or only in synonymous ones? And this state
of uncertainty is still there nowadays, causing confusion
in understanding the true motives of the triplet protein code
operation. I believe that now it is time to say that wobbling
of the third nucleotide is inherent to all 64 codons, or indeed,
it will lead us to a dead end.
Yet, there is one more uncertainty in understanding the code
function. How are amino acids (and stops) selected
in non-synonymous codons? The key vector here is the context
orientations of ribosomes on mRNA. It’s easy to notice but it
hasn’t been noticed so far that under the condition of the 3rd
nucleotide wobbling in all codons, for example, the family of
coding doublets AG encodes SIMULTANEOUSLY Ser and Arg.
Wherein, they are synonymous pairwise and they redundantly
encode only Ser and only Arg. Here the choice is simple: there are
isoacceptor tRNAs. But triplets AGT and AGC (Ser)
HOMONIMOUSLY oppose the AGA and AGG (Arg) triplets within
the AG family. Hence, these TWO pairs can code both, Ser and
Arg. And here it is NECESSARY to make a CHOICE - either Ser,
or Arg – the same one tRNA cannot accommodate the two
different amino acids. The selection becomes possible due to
contextual orientations of the ribosome on mRNA. Such inner
synonymous-homonymous duality of codons-homonyms (with
additional paired synonyms) is fundamental. The biological
function of such dualism (within the families of homonymous
codons) perhaps, is to ensure even higher flexibility of the code
in combining synonymy and homonymy.
You may argue, saying that my proof of the double
synonymous-homonymous degeneracy of the genetic code is not
direct enough or, basically, is indirect. My argument is based on
pure logic. The direct argumentation will be to verify the
existence of total collinearity of the codons and amino acids,
on a representative sample of a few large proteins and their
mRNA’s. Such careful and tedious work has not been performed
249
yet, apart from the single and poorly convincing case of sickle-cell
anemia. If the concept of synonym-homonym degeneracy of
the protein code is true, it is possible to predict that the same
homonymous codons, depending on the context of different
mRNA’s, will encode different amino acids and stop positions
within different proteins or within the same large protein.
This work must be done, and it is surprising that this exhaustive
analysis has not been done yet. The current situation of genetics
and molecular biology’s relationship with the protein code can be
described as follows: we counted on a high sprint performance
of an athlete who has lost one leg and has an artificial (prosthetic)
limb instead.
What about modern understanding of the role of mRNA
context? Did anyone provide an accurate description of how
mRNA contexts define the meaning (semantics) to codons during
their transcoding (the fact about transcoding that has been well-
known before and that we referred to in our analysis in this book)?
There is an answer in a recent review published in “Nature
Reviews Genetics”. This paper analyses many strange codon-
functioning situations, including their transcoding [Pavel
V. Baranov, John F. Atkins and Martina M. Yordanova.
Augmented genetic decoding: global, local and temporal
alterations of decoding processes and codon meaning. NATURE
REVIEWS | GENETICS VOLUME 16 | SEPTEMBER 2015 | pp. 517-
529]. This is what the authors write about context-dependent
codon transcoding (what we find very relevant and critical to our
research): "The meaning of a codon can be changed in the context
of a specific mRNA or at a specific location within the mRNA.
To distinguish it from codon reassignment, this phenomenon is
often termed codon redefinition and is considered to be a class of
recoding events. Naturally, because codon redefinition takes
place in the context of a single or a subset of mRNAs, these
mRNAs should have specific properties or sequence elements that
distinguish them from other mRNAs".
What are these mysterious "specific properties or sequence
elements" of mRNA, responsible for codon transcoding? There is
no answer to the authors yet. But the answer is here, and it is very
250
simple. The protein synthesizing system and the entire genome
are capable of thinking and have quasi-intelligence, since this is
the required attribute that makes it possible for the protein-
synthesizing system to define the meaning of codons-homonyms
based on mRNA context. Grasping the meaning of mRNA allows
the understanding of the semantics of codons-homonyms.
The authors of this article are absolutely right, and we stand
in solidarity with them, that Crick’s concept of the "frozen
accident" of the protein code begins “to melt" under the pressure
of new facts and ideas. That's what they say in this regard: "Crick’s
‘frozen accident’ hypothesis for the origin of the genetic code,
according to which the genetic code is not only universal but also
unchangeable and un-evolvable. Ironically, the time
of the hypothesis formulation also marked the beginning of
a series of experimental observations of various exceptions from
what are known as the standard rules of the genetic decoding,
leading to a ‘melting’ in perceptions of the universality of
the genetic code".
So, what is the third wobbling nucleotide in the codon about?
It is not only the steric "crutch" that provides greater strength
of the codon-anticodon pair, it is also the “switch sign” for tRNA
codon reading from synonymy mode to homonymy mode and
back. And this takes protein coding into endless semantic realms
and opens the endless prospects for control of biosystem
metabolism, though, under one "little" condition: we have
to understand the language, the meaning and the grammar of
the protein genes.
The presence of 3rd nucleotide wobbling in both codon types
(synonymous and homonymous) provides protein genetic code
with semantic coding sustainable abundance. This is an evolutionary
universal wisdom of the code.

251
31. PCR AMPLIFICATION OF PHANTOM DNA
RECORDED AS A POTENTIAL QUANTUM
EQUIVALENT OF MATERIAL DNA.
I. Introduction
DNA Phantom Effect16 was discovered in our laboratory led
by the author in 1984 using the method of correlation laser
spectroscopy. The first publication about this was in 1991 [Gariaev
et al., 1991].
In 2001, we used DNA phantoms in Canada in the form
of secondary radiation from the LGN-303 laser17
for the transmission of a pool of active genetic information over
a distance of 20 km. In this experiment, pancreases of a few dozen
Wistar rats were inactivated through alloxan induced diabetes.
These rats were subsequently treated with distant phantom
genetic information read by the laser from pancreases of newborn
Wistar rats of the same genetic lineage. In the control group, 90%
of these rats died. However, all rats that received phantom genetic
information, survived [Gariaev et al., 2007]. Later, these findings
were confirmed by the work of A. Kokaya, N. Kokaya, and
G.G. Tertyshniy’s group.
In 2014, we obtained preliminary data on materialization of
DNA phantoms, obtained in the form of spectra of secondary
LGN-303 laser radiation, generated by laser reading of DNA
segments of a certain length [Gariaev et al., DNA Decipher
Journal, May 2014].
These experimental results have significant potential value.
They confirm A.G. Gurvich’s (1920’s - 40’s) fundamental idea
about genes functioning as wave forms. This means that now we

16
Readers may find out more about the DNA Phantom Effect and DNA phantoms
in the author’s monographs “Wave Genome”'(1994) and “Linguistics Wave
Genome. Theory and Practice” (2009) by searching the Internet.

Source: http://www.plasmalabs.com/files/products/lgn_303_1.pdf
17

Accessed: 31/02/2020

252
can work in the field of new genetics and, consequently, new
biology, medicine, agriculture and computing, and have a new
approach to the problem of the origin of life on Earth, and so on.
However, phantom DNA data as equivalents of ordinary
material DNA requires independent verification. Therefore,
we appeal to and invite molecular biologists, geneticists and
other scientists to conduct independent experiments. Following
is a full description for the method of detection and
materialization of DNA phantoms in a PCR system.

II. Materials & Methods

Step 1. Preparation of the Initial DNA Product
The PCR product, 547bp in length, derived from a synthetic
DNA sequence and cloned in a plasmid, was used as the initial
DNA product.

The plus DNA strand:

5'CCTTACGTCAGTGGAGATGTCACATCAATCAACTTGCTTTGAA
GACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGG
TGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTGA
ATGATAGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGAGCC
ACCTTCCTTTTCTACTGTCCTTGCGCGCTATATTTTGTTTTCTAT
CGCGTATTAAATGTATAATTGGGGGACTCTAATCATAAAAACC
CATCTCATAAATAACGTCATGCATTACATGTTAATTATTACATG
CTTAACGTAATTCAACAGAAATTATATGATAATCATCGCAAGA
CCGGCAACAGGATTCAATCTTAAGAAACTTTATTGCACGCATTA
ATGGACTGGATTGGGGCCAACTCCTACCGTACCTGGCATTACCC
TTACGCTGAAGAGATGCTCGACTGGGCAGATGAACATGGCATC
GTGGTGATTGATGAAACTGCTGCTGTCGGCTTTAACCTCTCTTT
AGGCATTGGTTTGGAAGCGGGCA-3'
For DNA production through PCR amplification the following
primer pair was used:
5'-CCTTACGTCAGTGGAGATGTCACATC-3';
5'-TGCCCGCTTCCAAACCAATGCCTAAAGA-3'.
Each PCR mixture with a final volume of 25μL contained: 67mM
Tris-HCl pH 8.6 at 25°C; 2.5mM magnesium chloride; 16.6mM
253
ammonium sulfate; dNTPs mix at a total concentration of 300μM;
primer mix in 0.5μM each; 2.5 units of Taq DNA polymerase and
plasmid DNA template in amount of 25ng. PCR temperature
regime included:
- initial denaturation at 94°C - 3 minutes;
- 30 cycles of: 94°C - 30 seconds, 62°C - 30 seconds, 72°C - 40
seconds;
- final synthesis 72°C for 5 minutes.
The PCR product was purified from primers and other
components of the PCR reaction solution using a set of reagents
for purification implementing SiO2 coated magnetic particles
("Sileks", http://www.sileks.com) according to the manufacturer's
recommendations. 10μL of magnetic particles with binding
capacity for 10mg DNA were used. The elution of DNA was
performed in 50μL of elution buffer.
Step 2. Preparation: Modulated Broadband Electromagnetic
Spectrum of DNA Product
25μL of the aqueous solution of the PCR product was applied
to a clean microscope slide and used for probing by the helium-
neon LHN-303 laser beam for 3 and more minutes. The resulting
secondary modulated broadband electromagnetic radiation was
recorded by a transistor radio at a frequency of 700kHz and then
converted into Waveform audio file format. This is the WAVE
audio file we propose to use for DNA information induction
(without the use of the LHN-303 laser) into samples of purified
water, considering that sound can carry torsion information18,
including information about DNA (a hypothesis).
In addition, and at the same time the WAVE audio file
recording was made, DNA information induction into purified
distilled water was facilitated by way of a stationary tripod with
test tubes containing purified distilled water without DNA, RNA
and nuclease impurities, was placed at a distance of 15-20 cm
from the laser. The water was pre-frozen at -20°C and thawed

http://www.efir.com.ua/rus/a.php?r=2&d=69 (In Russian).

18

Accessed: 31/01/2020
254
at room temperature (defrosted water).
Step 3. PCR Amplification Using Water Samples Treated by
the Modulated Broadband
Electromagnetic Spectrum of the Initial DNA from
which Information was read by Laser LGN-303.
After laser exposure, water treated by the modulated
broadband electromagnetic spectrum, was used for execution of
standard PCR reactions, 25μL of this water was used without
addition of DNA-template material. The tripod with the tubes was
placed at a distance of 20-30 cm from the laser. Preparation of the
PCR reactions were performed in a sterile environment treated
with UV light that would prevent contamination of samples.
Each PCR mixture contained: 67mM Tris-HCl pH 8.6 at 25°C;
2.5mM magnesium chloride; 16.6mM ammonium sulfate; dNTPs
mix at a total concentration of 300μM; primer mix in 0.5μM each;
2.5 units of Taq DNA polymerase. Several temperature regimes
were used for PCR, different in duration of the elongation stage
(synthesis) of DNA strands at 72°C.
Initial PCR temperature regime included:
- initial denaturation at 94°C - 3 minutes;
- 40 cycles: 94°C - 30 seconds, 62°C - 30 seconds, 72°C –
40 seconds;
- final synthesis at 72°C for 7 minutes.
Modified PCR temperature regime included:
- initial denaturation at 94°C - 3 minutes;
- 40 cycles: 94°C - 30 seconds, 62°C - 30 seconds, 72°C -
2.7 minutes;
- final synthesis at 72°C for 5-7 minutes.
All temperature regimes resulted in synthesis of PCR products
of predetermined length, but to varying degrees. The largest
number of test specimens with the desired product was obtained
when using a seven-minute DNA strand elongation step in each
of the 40 PCR cycles.

255
 Step 4. Analysis of PCR Results
After the completion of the PCR reaction, the samples were
mixed with gel loading buffer, containing a fluorescent SYBR
Green I dye ("Sileks", http://www.sileks.com) and were analyzed
on a 1.5% agarose gel by standard methods of gel electrophoresis
in a single TBE buffer. The results were analyzed with a trans-
illuminator at a wavelength of 365nm. Samples were considered
positive where bands were located at the same distance from the
start as the positive control strip, corresponding to a known DNA
fragment size of 547bp PCR positive control samples, samples
of the initial DNA product from which the laser reading was made,
and the experimental samples were subjected to sequencing.
Sequencing revealed that the experimental samples are 99.2-
100% identical to the DNA sequence of the initial product from
which the information was read by the laser.
To illustrate our PCR experiments, the images of the PCR DNA
phantoms are shown. A link for the download of the audio
recording of DNA modulated broadband electromagnetic
radiation in WAVE format on a carrier frequency of 700kGts is also
provided.19
Our experiments can be reproduced without the use of a laser
and without the original DNA template (as we do too), by using
the audio recording. i.e. no need to synthesize the template. This
prevents accidental drifts of initial DNA into the working tubes
with water, the pipettes, etc. Thus, we avoid contamination.
In this case, the working sound player to be set at a distance of
1 to 20 cm from the tripod with the test tubes. The exposure time
may vary from 5 minutes or more. The identity of the resulting
PCR DNA product and initial DNA can be confirmed
by sequencing the obtained DNA. In this type verification, all that
is required is the primers and knowledge of the initial DNA
nucleotide sequence…

19
A link to download the audio recording of DNA in wave format: 547bp Sound
http://files.mail.ru/A59F39CE29C04CD180132D8885580905

256
 III. First Experiment on PCR Amplification of 12/01/2015
Audio Recording
(1) Control study before exposure to the sound wave recording
as a derivative of DNA (547bp) MBER spectrum
Time of PCR cycle 12/21/2015: from 18:00-01:30 (PCR program
with 7-minute elongation (synthesis) of DNA strands)

Electrophoresis from 12/24/2015

Tracks 1-15: The control (background before exposure to the sound) -

purified water, commonly used in PCR reactions as the solvent of reaction
components, pre-frozen and thawed. The origin of the water is the same
as the water used at the time of laser recording, it was frozen
in the laboratory. Track 16: A positive PCR control (plasmid DNA-
template 25ng, 30 cycles of PCR). Track 17: The marker fragments
length 139, 268, 450, 613bp.

(2) The study of the impact of a sound recording of

MBER spectra of DNA (547bp) (WAVE file) on purified water.
Electrophoresis from 12/25/2015

Tracks 1-15: Purified water, pre-frozen and thawed, treated with

the sound of DNA MBER. (WAVE file) for 30 minutes prior to
the beginning of the PCR cycle. A tube with purified water was set in
a motionless and stationary tripod, while the soundwave was aimed

257
directly at the bottom of the tube with a speaker. The water used was
the same as used in the PCR during the study of background before
exposure to the sound. Track 16: A positive PCR control (plasmid DNA
template 25ng, 30 cycles of PCR). Track 17: The marker fragments
lengths 139, 268, 450 and 613bp.

(3) Observations:
1) The new PCR program with a 7-minute DNA elongation
(synthesis) step is effective for primary, and for subsequent PCR-
analysis of the target DNA-product synthesis after laser exposure.
Residual background of laser recording, made on 12/01/2015
remained, however, the amount of the target product was reduced
to 3 of 15 tubes, compared with the PCR performed on the sound
recording day (6 of 14 tubes). This is logical, given that twenty
days passed from the date of recording, and taking into account
the distance between the laser recording location and
the laboratory, where PCR-analysis was performed (it is located
on the opposite side of Moscow in Domodedovo).
2) Sound exposure doubled the amount of the desired product
synthesis (6/15 tubes) compared to the background before sound
(3/15 tubes). Perhaps, sound can be used as a restorer and repeater
of modulated broadband electromagnetic radiation DNA
information recorded by laser in a system of PCR DNA synthesis.
However, clearly it is too early to make conclusions just from one
experiment, although the results are promising.
3) The genetic information sufficient for reproduction in the PCR
system is recorded when the laser is working and there is primary
DNA-reading radiation in optical range. Presumably the sound,
being a result of the conversion of laser frequency into MBER
with concurrent recording of the MBER radio frequency into
an ‘audio’ WAVE file format is capable of producing the primary
structure of the initial DNA. This makes it possible to materialize
the initial DNA in a PCR system. So, following this, it is possible
to use such a DNA-radiofrequency-recording in the acoustic
range for broadcasting onto new water samples without
the requirement of the direct primary impact of DNA modulated
broadband electromagnetic radiation.

258
4) It is necessary to repeat the experiment with the new samples
of water minimum of 5-6 times, to facilitate more confident
discussion about the abilities of “MBER acoustic waves”
as a secondary source of DNA information to produce an impact
on water samples of various origins and subsequently use these
water samples in PCR to synthesize the material DNA.

IV. Second Experiment on PCR Amplification of 12/01/2015

Audio Recording
(1) Control study before exposure to the sound WAVE recording
as a derivative of DNA (547bp) MBER spectrum
Time of PCR cycle 02/03/2016: from 13:10-20:40 (PCR program
with 7-minute elongation (synthesis) of DNA strands)
Electrophoresis from 02/03/2016

Tracks 1-14: The negative control (background before exposure

to the sound) - purified water, commonly used in PCR reactions
as the solvent of reaction components, pre-frozen and thawed. Track 15:
A positive PCR control (plasmid DNA-matrix 25ng, 30 cycles of PCR).
Track 16: The marker fragments length 300, 400, 500, 600, 700, 800,
900, 1000, 1500bp.

(2) A study of the impact of a sound recording (WAVE file)

of the modulated broadband electromagnetic spectra of DNA
(547bp) on purified water.
Time of PCR cycle 02/04/2016: from 14.20-21.50 (PCR program
with 7-minute elongation (synthesis) of DNA strands).

259
 Electrophoresis from 02/04/2016

Tracks 1-14: Purified water, pre-frozen and thawed, treated with

the sound of DNA modulated broadband electromagnetic radiation for 30
minutes prior to the beginning of the PCR cycle. A tube with purified water
was sitting in a motionless tripod, while the soundwave was aimed
directly at the bottom of the tube with a speaker. The water used was
the same as used in the PCR during the study of background before
exposure to the sound. Track 15: A positive PCR control (plasmid DNA-
template 25ng, 30 cycles of PCR). Track 16: The marker fragments
lengths 139, 268, 450, 613bp. Track 17: The marker fragments lengths
300, 400, 500, 600, 700, 800, 900, 1000, 1500bp.

(3) Observations:

1) At the time of the experiment, the residual background of laser

recording, made on 01.12.2015 remained, however, it became very
low - the amount of the target product was dramatically reduced
(2 very low amount of products on tracks 1 and 2), compared
with the PCR performed on the sound recording day. This is
logical, given that 2 months passed from the date of recording.
The background in the previous experiment with sound was
stronger, though it was identified in only 2 of 14 tubes. Perhaps,
the background of the recording fluctuates, becoming stronger
and then attenuates. However, over time it most likely attenuates
without a new feed in from the laser or sound recording.
2) In this experiment the sound exposure increased the amount
of the desired product synthesis by a factor of 1.5 (3/14 tubes)
compared to the background before sound (2/14 tubes). Wherein,
the efficiency of information transmission by sound was much
weaker than in the previous experiment with the sound (10/14
tubes). This proves that the sound can be used as a restorer and

260
repeater of DNA-information recorded by laser in the PCR system
of DNA synthesis, but with different effectiveness.
3) The effectiveness of the impacting sound may be wave-like
in nature, it may be in a peak, as in the previous experiment, or
it may be in a trough, as in this experiment. It is also possible that
sometimes, the sound does not produce any result at all.
This indicates that it is necessary to design and perform a series
of experiments, and based on the results, make conclusions about
the quality of the acoustic information transmission. In order
to understand the variation in effectiveness of the impacting
sound and how the intensity of the peaks and troughs alternate,
it is expedient to design and perform another series of
experiments with a sound recording to this end.
4) The conditions of the impacting sound and PCR in all three
conducted experiments were the same. However, the efficiency
of the previous transmission was much greater. This suggests
the possible influence of the current geomagnetic environment or
the influence of other fields of physical nature during sound
exposure. It is also possible that the influence of the very point
in space, where sound exposure took place had an effect. Perhaps,
the tripod with water samples turned out to be in a better point
in space in the previous experiment than in this experiment.
How to determine the most efficient tripod placement is not yet
known? Luck only applies at the moment! An ‘unlucky’ possibility
is that the experiment may be performed when the location
of the experiment falls into a point in space where the transfer
would be significantly weaker or completely absent. In any case,
a series of experiments is required to confidently speak about
the effectiveness of information transmission by means of sound.

261
32. PRACTICAL APPLICATION OF LINGUISTIC WAVE
GENETICS (LWG) IN CREATING QUANTUM
INFORMATION MATRICES (QIM) USED
FOR PROGRAMMING PLAIN LIQUIDS INTO
MEDICALLY ACTIVE LIQUIDS, CALLED QUANTUM
INFORMATION MATRIX PROGRAMMED LIQUIDS
(QIMPL).
Linguistic Wave Genetics (LWG) is a new branch of biology,
medicine, physics and bio-computing. The concept was first
developed and researched in early XX century by A.G. Gurvich.
LWG had opposed conventional (classic) genetics and molecular
biology based on a principal called "locality" - locally spread and
transmitted genetic information. According to LWG a genetic
information acts not only "locally" but also at a distance.
Our genome is able to generate, transmit and receive information
waves generated by our cells at the quantum genetic level.
The information is coded in a form of "quantum holograms" or
"phantoms". The LWG concept considers the genetic apparatus
(genome) as a bio-computer capable of making decisions,
managing and programming bio-systems. We have named
the whole information exchange process "bio-linguistics".
According to our research, LWG is based on quantum non-
locality, quantum laser physics and bio-linguistics.
LWG technology is used for generating multiple information
carrying programs called Quantum Information Matrices (QIM).
The process and techniques have been formulated and perfected
over the years by Professor Peter Gariaev. QIM allows for distant
programming of liquids with desired bio-medical information.
Any liquid treated/programmed with QIMs, we call Quantum
Information Matrix Programmed Liquid (QIMPL).
Creating and programming of quantum information matrices
(QIMs) is done by secondary laser radiation. We call it "quantum
laser" programming. It is done by a laser capable of generating
a torsion "spinor" field modulated by natural biologically active

262
substances.
Generated QIMs are used for creating bio-active liquids
(QIMPLs) that are used in medical treatments. Over the years
we have successfully used our QIMPLs in treating medical
conditions not responding to traditional conventional treatment
modalities.
We present two cases where our QIMPL treatment prevented
limb amputation.
First case: Fig. 1a shows severe, Wagner stage 4 diabetic
necrotic, ischemic right heel ulceration before treatment. Fig. 1b
shows the same foot after treatment with QIMPL soaked
dressings. After three weeks of treatment the entire necrotic,
ischemic right heel ulcer is almost completely gone, and wound
has almost healed.

Fig. 1a Right heel Wagner stage

IV diabetic ulcer before
treatment

Fig. 1b Right heel Wagner stage

IV diabetic ulcer 3 weeks after
treatment

263
 Second case: Fig. 2a and Fig. 2b show feet with fourth degree
frost bite, with visible extensive black necrotic areas. Fig. 2c and
Fig. 2d show the same feet after three weeks of treatment
with QIMPL soaked wound dressings.

Fig. 2a, 2b Both feet fourth

degree frostbite necrosis
qualified for amputation.

Fig. 2c, 2d Significant

improvement after 3 weeks
of treatment with (QIMPL).

264
33. THE SYHOMY OF THE GENETIC CODE IS
THE PATH TO THE REAL SPEECH CHARACTERISTICS
OF THE ENCODED PROTEINS.
The Wobble Hypothesis by F. Crick
A lot has been written about the hypothesis of F. Crick,
including the works of the author himself, but most of
the judgments are based on a formulation from F. Crick’s book
"What a Mad Pursuit" 1988 [F. Crick, 1988]. Here are the key words:
“An important point to notice is that although the genetic code has
certain regularities—in several cases it is the first two bases that
encode one amino acid, the nature of the third being irrelevant—
its structure otherwise makes no obvious sense.”
However, there are some significant additional issues that
stem from this brief message. This is what this article is about.
“The standard” genetic protein code was obtained by
M. Nirenberg's group as a result from studying protein synthesis
in E. coli. This work resulted in the table of the standard genetic
code. It reflects the functions of protein genes as a static code
structure, where all codons UNAMBIGUOUSLY encode amino
acids and stop positions. It is important that according to
the Wobble Hypothesis, half of the known 64 codons, i.e. 32,
are redundant for 20 known amino acids.
As for the 21st amino acid, selenocysteine and its coding –
it will be explained later in this article. Redundant codons are
synonyms that, in varying degrees of repetition, code the same,
but different, amino acids and stop positions. These are the main
provisions in M. Nirenberg’s model, later followed by F. Crick.
This understanding has prevailed for 50 years, since M. Nirenberg
received the Nobel Prize for this model in 1968. Now, theoretical
and experimental results have accumulated, that suggest
the introduction of amendments to this understanding of protein
genetic coding. They are as follows.

265
 Unambiguity and degeneracy factor of the E. coli protein code
The table of the standard code is functionally divided into two
symmetric and equal parts, where 32 codons UNAMBIGIUOSLY
and REDUNDANTLY encode only amino acids. These codons are
synonyms. 32 other codons (not synonyms), called homonyms
[Gariaev, 1997; 2009; 2015], AMBIGIOUSLY encrypt amino acids
and stop positions, and not always in accordance with
the standard code table. Namely, each codon homonym encrypts
simultaneously two different amino acids, or an amino acid and
a stop position. This means, that to ensure correct protein
synthesis, it is necessary to make a CHOICE from two different
amino acids – either choose one amino acid or choose an amino
acid or a stop position. The deciphered amino acids or stop
positions in this case may not correspond to the table of
the standard code, since they are recognized and selected by
the ribosome according to codons-homonyms DYNAMICALLY
while the ribosome is reading and logically analyzing the context
of mRNA. This contradicts M. Nirenberg’s and F. Crick’s dogma of
unambiguous coding, which was accepted as ‘carved in stone’ up
to the works [Gariaev, 1997; 2009; 2015], and the article20
[Turanov et al., 2009] which experimentally proves that codon of
the selenocysteine amino acid simultaneously encrypts another
amino acid - cysteine. This provided reason to doubt the evidence
of the dogma and called for a search to explain this phenomenon
so not to break the dogma of unambiguous coding, but to confirm
it from the standpoint of the linguistic principle of homonymy,
that is, the real (not metaphorical) textuality of genes (mRNA).
This occurs in the process of protein biosynthesis as opposed to
the contrary position of synonymy (also linguistic), about
the codification of one amino acid by many codons. The latter
corresponds to F. Crick’s Wobble Hypothesis and is
experimentally proven by the presence of isoacceptor tRNAs.
The ultimately general definition of synonymy and homonymy

Turanov A.A. et al., 2009, Genetic Code Supports Targeted Insertion of Two
20

Amino Acids by One Codon. Published 9 January 2009, Science 323, 259 (2009).
DOI: 10.1126/science.1164748

266
can be formulated as follows. Synonymy is when one meaning is
represented (coded) by many different words. Homonymy is when
one word represents many different meanings. This is
demonstrated in the new view of Table 1 of the genetic code,
where you can see the functional and symmetrical division
of the code into codons-synonyms and codons-homonyms.
Groupings of codons by family are carried out according
to the Lagerkvist scheme [6], where the family-forming factor is
the first two nucleotides in codons (triplets). The families
themselves are grouped by us differently - on the basis of
synonymy and homonymy.
You can see that the table is symmetrically divided into
codons-synonyms (in blue) and syhoms (in red). The Table was
adapted from the article [Gariaev, 2015].

267
 The choice of amino acids and stop positions in the case of
ribosome interaction with the codon-homonyms on mRNA

Such a CHOICE is made by the ribosome due to the fact

that it (and/or the whole cell) takes into account the context
of the given mRNA. This choice automatically implies quasi-
consciousness of the protein synthesizing system, more precisely,
its biocomputer functions [Gariaev et al., 2001]. Quasi-
consciousness is present because mRNA (gene copy) is a text in
a literal, non-metaphorical sense [Gariaev, 1997; 2009; 2015].
The situation of UNAMBIGUOUS coding by synonyms is
determined by the fact that in each of the 8 codon families,
ALL TRIPLETS (codons) are DIFFERENT. For this reason, in
the triplet families, coding is performed by ALL three letters
(nucleotides) and all triplets in each family encode only one
amino acid. This coding is UNAMBIGUOUS AND REDUNDANT.
Replacement of the third nucleotides in codons does not change
the coding.
The situation of PRIMARY UNAMBIGUITY of coding
by HOMONYM-triplets from the beginning (before ribosome
reading of mRNA) is available in half of the codons – which are
not synonyms (i.e., in fact, homonyms). This depends on the fact
that the 3rd codon nucleotide - the key participant in the work
of the genome-biocomputer of each cell - before the act of reading
mRNA by the ribosome, in a static state, "does not plan"
participation in the coding and can potentially be any of the four
possible ones. Let me remind you that F. Crick did not comment
on such cases of ribosome dynamics. So, the first two nucleotides
(doublets) are coded. At the same time, in 6 homonym-families,
it happens that the pairs of IDENTICAL doublets encode different
amino acids. Wherein, in two families, it happens as follows...
The doublet of TA-family encodes tyrosine and stop twice. In two
TG-doublets: one doublet encodes cysteine; for another doublet
of the same TG-family, one doublet pair encodes cysteine,
another doublet pair encodes stop and tryptophan. In general,
this means that in this case, there is also a homonymy factor,
but with important additional characteristics. This phenomenon
268
was discovered by the group of M. Nirenberg and F. Crick
on the example of T(U)T(U) codon family [8], when the triplet
UUU simultaneously encodes phenylalanine and leucine.
This simultaneity was not understood by F. Crick and
M. Nirenberg. So, they did not see it as contradictory to their
postulate about the UNAMBIGUITY of coding by all 64 codons of
amino acids and stops. This was believed until the work
of Turanov et al. [Turanov et al., 2009], where they demonstrated
the same simultaneity of coding for selenocysteine and cysteine,
which similarly had long ago been detected by Crick and
Nirenberg for the UUU codon [Сriсk, Nierenberg, 1964]. This work
[Turanov et al., 2009] experimentally demonstrated and
theoretically substantiated the phenomenon of UGA codon
ambiguity [Gariaev, 1997; 2009; 2015]. This work [Turanov et al.,
2009] brought the first doubts in the evidence of dogma on
unambiguous coding of amino acids and stop positions by all 64
codons. A new representation of the Table of the Genetic Code
presents this new and significant information - regarding
the homonymy of half the codons – in a clearly visible way
(See Table 2). The Table is taken from work [Gariaev, 1997].
The biological function of synonymous-homonymous dualism
(within the mixed codon families), perhaps, is about providing
additional flexibility to the code. This duality really means
hybridization of code capabilities in eight mixed codon families.
Therefore, it is more convenient to call them SYHOM-families
(portmanteau from the words SYnonym and HOMonym), and
to call this characteristic SYHOMY.
An important point, the standard genetic code table of
the E. coli protein code, adopted by the scientific community, is
STATIC and does not reflect the most important factor of
dynamics in the process of protein biosynthesis in vivo. This is
a reason why the majority has an incomplete understanding of
the key linguistic function of the third nucleotide in the syhom-
codons, the codons which take the genome to the level of real,
non-metaphorical, textual constructions of DNA and RNA.
Syhomy provides endless horizons of semantic (quasi-speech)
coding to the protein-synthesizing-system. This is especially
269
important for the functions of human brain neurons, where
the acts of thinking and consciousness are realized, probably,
along the way of materialization of short-lived DNA-RNA-
PROTEIN texts in the form of physical fields as materialized
equivalents of thoughts [Gariaev P., Leonova-Gariaeva E.A.,
Nonlocal Functions of DNA-RNA Proteins in Brain and
Consciousness-Thinking (is being prepared on 13 September
2018)].

Thus, we see synonymous-homonymic degeneracy (SOHOMY)

of the protein genetic code, which is amending the previous code
model. This fact reflects the unity of the opposite codon functions
of codons-synonyms and codons-syhoms, where synonyms stand
for redundancy and coding accuracy, and syhoms - for flexibility
and adaptability of code to environmental changes.

Amendment to F. Crick’s Wobble Hypothesis

For synonyms, all 4 different nucleotides (T, C, A, G) in the 3rd
position in codons can change places in any way. This does not
affect their coding functions. But for syhoms, this fundamentally
contradicts the official standard genetic code table. This does not
mean the denial of unambiguous coding. Unambiguity is achieved
by contextual orientations of ribosomes on mRNA. In syhoms,
at the level of mRNA translation into proteins in cases of reading
frame shifts, artificial or mutational substitutions of 3rd
270
nucleotides may lead to abnormal-context-dependent-choices of
amino acid coding and/or stop positions. This will happen, if
during reading frame shift, the syhom 3rd nucleotide will take
the position of the 1st or 2nd syhom nucleotides.
Such substitutions are random and not indifferent
to the biosynthesis of proteins, as required by F. Crick’s Wobble
Hypothesis. The values of the first two nucleotides of syhoms are
dictated by mRNA contexts, and the third nucleotide roles are
reduced to: a) participation in the coding with a "delegated
function", b) (in addition) physically strengthen the codon-
anticodon pair on the ribosomes.
What is a "delegated function"? Since the order of nucleotides
in the protein gene and, consequently, in mRNA, is rigid
(hereditary), when ribosome is reading mRNA and interacting
with a codon-syhom doublet (with the 1st and 2nd triplet
nucleotides), it brings about a situation of uncertainty, associated
with the 3rd wobbling nucleotide, according to F. Crick (and
the Nature of the code). What is the 3rd nucleotide’s
linguistic/semantic role in the codon-syhom text? Probably, it is
actualized by means of "delegation" of missing
linguistic/semantic function to the 3rd syhom nucleotide,
according to the scheme of contextual orientations. Here is
an example from linguistics. In the sentences: 1. “He heard
the caS mewing”; 2. “Tom usually wears a cowboy hat, but today
he's wearing a baseball caL”. Proceeding from the contexts, in the
first sentence in the word caS, the letter S should be delegated the
function of the letter T, and in the second sentence, the letter L
should delegate the function of the letter P. As a result,
the syhom-doublets lose their semantic uncertainty and, as a part
of the integral triplet (the former syhom), acquire the only correct
and unambiguous semantics of the coding triplet - the choice of
the amino acid and/or stop position - syhom dualism is lost,
resulting in unambiguity. Unambiguous coding is acquired, but
in a dynamic act of ribosome reading of mRNA. This is
the strategic consequence of synonymous-homonymous
degeneracy (two-dimensionality, syhomy) of the protein code.
The principle is simple, like all ingenious "invented" by Nature.
271
This is akin to the reassignment (recodification) of codons when
a biosystem is in a stressful state (heat shock, the presence of
exogenous antibiotics, amino acid starvation), this has been
known about for a long time, however is not yet understood with
respect to temporarily ambiguous doublets within codons-
syhoms. In linguistics, there is a canonical example of the role of
word endings in a sentence (within the context) for delegating
meaning to previously incomprehensible "words": "The iggle
squiggs trazed wombly in the harlish hoop"21. It seems like nonsense,
but in fact intuitively you may sense the meaning. Endings of
the "words" provide, delegate them relatively clear meaning. It is
possible that it is similar in DNA and mRNA texts.
The synonymous-homonymous two-dimensionality of codons-
syhoms can be seen in Table 3, with the TA codon family as
an example, where paired synonymy takes place. For the TG
family, paired synonymy works only partially: for codons TGA and
TGG, there is no synonymy, they encode Stop and Trp, this is
an exception. Paired synonymy as well as a paired opposing
homonymy is observed for all other syhom families.

21
Translator’s note: This is an English equivalent by H.A.Gleason to the original
Russian example given by Acad. V.S. Shcherba “Глокая куздра штеко будланула
бокра и курдячит бокрёнка”

272
In syhom-codons, substitution of the third (3’) nucleotide will
result in context dependent choices of amino acid and/or stop
positions. Such substitutions are random and can only occur from
accidental radiation, chemical or artificially induced mutations,
only these can replace, or rather, damage the third (3’)
nucleotides in the syhom-codons, which are hereditarily rigid.
One may propose the following rule: the third nucleotides
in syhom-codons take upon them delegated meanings of the four
nucleotides - A, U, G, C - chosen by the ribosome
nanobiocomputer in the course of reading the mRNA context.
In turn, this choice determines which ‘amino acid-tRNA-
anticodon:codon-syhom’ complex will be involved for
the inclusion of the selected amino acid in the growing peptide
chain.

Why stop codons are in syhom families

Termination - the end of protein synthesis, is carried out when
one of the stop codons - UAG, UAA, UGA - appears in the A-site
of the ribosome. Due to absence of tRNAs, corresponding to these
codons, peptidyl-tRNA remains bound to the P-site
of the ribosome. Here, specific RF1 or RF2 proteins are involved
that catalyze the separation of the polypeptide chain from mRNA,
as well as RF3, which causes dissociation of mRNA
from the ribosome. RF1 recognizes in the A-site UAA or UAG;
RF2 - UAA or UGA.
This is preceded by an important event - the decision to stop
protein synthesis with three stop codons (syhoms). The "solution"
in this case is not an empty metaphor, but the result of the work
of a nanobiocomputer, which probably a protein synthesizing
system is [Gariaev et al., 2001]. It is the nanobiocomputer that
analyzes the CONTEXT of mRNA sequences, and then, and only
then, one of the three ambiguous syhom triplets (either stop,
or amino acid) acquires the value of either stop or amino acid.
Why so? Imagine that stop functions belong to some codons-
synonyms. Then the strategic function of analysis of the textual,
semantic component of genes (mRNA) is lost. After all, synonyms
273
strictly, unambiguously and redundantly encode amino acids,
which follows from the invariance of natural native gene texts
(mRNA). In contrast to the strict unambiguity of codons-
synonyms, the stop-syhoms exist in mRNA in a ‘standby mode’ of
meaning within mRNA (gene) context. Depending on context,
a decision is made on the exact meaning of the ambiguous codon-
syhom: to be an amino acid code and continue protein synthesis,
or to stop, as it is meant to be a stop codon.

Discussion
The study presents a logically non-contradictory idea that
ribosomes (or the entire protein-synthesizing-system) “selects”
necessary amino acids and stop positions: when the ribosome
traverses non-synonymous codons (syhom-codons), it actually
reads and considers the meanings of mRNA contexts. A choice is
made between two similar tRNA anticodons, which carry different
amino acids. These anticodons are recognized, considered and
selected by the complex "ribosome + syhom-codons within
the mRNA context", based on the meaning of the mRNA context.
The choice of the semantics of the syhom-codons and,
respectively, one of the two tRNAs, carrying two different amino
acids, or alternatively the option of an amino acid or stop signal,
occurs due to the semantic orientation of the ribosome within
the mRNA contexts, functioning as a nanobiocomputer. It might
seem that this contradicts the genetics canon about unambiguous
genetic coding of all amino acids. However, this "choice" does not
negate the correct key thesis about unambiguous amino acid
coding during proteins biosynthesis. The apparent contradiction
is removed by a special function of the third nucleotide in
the 32 non-synonymous syhom-codons, the strategic importance
of this fact is that protein coding is passed into governance by
the laws of linguistics, previously unknown in relation to genome
operation. The function of the third nucleotide in 32 syhom-
codons is a distinctive semantic marking of synonymous and
synonymously-homonymous (syhoms) triplet-nucleotide-
families involved in proteins biosynthesis. This process involves
linguistic (human speech-like) laws for constructing protein texts

274
(speech) from amino acid letters. Such understanding of genome
operation now ceases to be metaphorical and acquires an exact
meaning, based not only on pure logic, but also on experimental
proof of the complex mixed semantic duality of syhom-codons
[Turanov et al., 2009].
The metaphor "choice" of amino acids and stop positions
in protein biosynthesis ceases to be a metaphor and becomes one
of the scientific facts of more developed Mendelian genetics and
molecular biology. The role of the third (3’) nucleotide in syhom-
codons during protein biosynthesis is based on theoretical
analysis [Gariaev, 1997; Gariaev, 2009; Gariaev, 2015] and
experimental work [Turanov A.A. et al., 2009]. Its role is seen from
the broader view compared to existing understanding. Third (3’)
nucleotide functionally and symmetrically divides the codons into
32 synonyms and 32 syhom-codon families. Wherein, syhom-
codons have a strategic function to participate in activation
of nonlocal nanobiocomputer ribosomal analysis of mRNA as
a real context in the mRNA language. Such an analysis is a natural
necessity for selection of one amino acid from two different
amino acids or between an amino acid and a stop position in
a situation where a ribosome traverses syhom-codons which have
a function of double-coding. This was theoretically substantiated
earlier [Gariaev, 1997; 2009; 2015]. Experimental work [Turanov
et al., 2009] confirmed this theory: it was demonstrated that two
different amino acids, selenocysteine and cysteine, are coded by
a single UGA-syhom-codon for Euplotes crassus, which to
a certain extent, is principally applicable to the human genome.
This result does not call into question the dogma of unambiguous
coding of amino acids and stop positions by the cells genomes,
but it requires us to introduce some significant corrections into
the long-accepted and uncontestable model of genetic coding.
These amendments are based on a broadened understanding of
the special linguistic (semantic) role of the third (3’) nucleotide in
codons and on the acceptance of the idea of real rather than
metaphorical textuality of protein genes. Recognition of
the speech-like nature of genes (mRNA) and the role of
the codon’s third (3’) nucleotide in this process leads to a simple
275
statement about the quasi-intelligence (biocomputing) of
the protein-synthesizing-system and its ability to consider
the specific (actual) mRNA context (meaning) for the decision-
making choice between amino acids and stops in syhom
situations, based on gene text (mRNA) meaning.
Why are the additional characteristics of the protein code
proposed here more pragmatic than M. Nirenberg’s and F. Crick’s
code model [Crick, Nirenbergm 1964] that is tactically correct,
but strategically incomplete? And why were the attempts to see
more within the code than its creators unsuccessful?
These attempts were made in the works of Lagerkvist [Lagerkvist,
1978] and Rumer [Rumer, 1969]. Lagerkvist was mistaken,
believing that mixed22 codons (syhoms, according to new
terminology) appear with low probability in mRNA. Rumer saw
symmetry in the genetic code, classifying it according to
the strength of codon-anticodon hydrogen bonds, which is quite
close to the division of codon families into synonyms and
the syhoms. However, they did not see that the synthesis of
proteins would be correct if the codons were functionally divided
into two mutually complementary symmetric groups, as it
actually is. One of them, synonymous, provides the accuracy and
redundancy of amino acid coding. The other, syhoms, provides
flexibility and adaptability of synthesized proteins to
environmental changes, due to changes in the amino acid
composition and sequences of synthesized proteins. This is
the wisdom of protein code.
For this representation of the genetic code model,
the publication of Lolle et al., about the recurrent genetics of
some plants, is worth reviewing [Lolle et al., 2005]. This study
demonstrated that there are no differences in the DNA sequences
of the wild-type of Ler gene and the HTH gene of the mutant
Arabidopsis thaliana plant, which are responsible for the direct
relationship between the biological properties of the cuticle, cell
adhesion and reproduction of Arabidopsis. The authors write:

22
The term “mixed” was introduced by Lagerkvist.

276
"In every case, the sequence of the reverted HTH allele matched
the Ler wild-type sequence exactly" (In each case, the sequence
of the returned HTH allele corresponded exactly to the sequence
of the wild type Ler). This means that Lolle and Pruitt found
the effect of a return to part of the ancestral genetics of
Arabidopsis. This fact is fantastic because the returned "wild" gene
and the mutant gene are identical in sequences, which is
inexplicable in Mendelian genetics. But this can be explained
from the standpoint of linguistic-wave genetics. Why does
the same gene manifest in different phenotypes?
To obtain an answer within the framework of the considered
amendments of the protein code model, it is necessary to check
the collinearity of mRNAs and their protein products in wild and
mutant genes. It can be predicted that the amino acid sequences
of the products of these genes will be different. Amino acid
sequences will differ in amino acid composition, since adjacent
DNA sequences from the 3’ and 5’ ends of the wild and mutant
genes are different, which results in context variations and,
hence, variations of meanings for the same codons in mRNA of
the wild and mutant genes. The authors write that a high level of
reversion from mutant to the wild type at the nucleotide level, was
an exact duplicate of the wild-type gene observed in previous
generations. Unfortunately, the nucleotide sequences given
by the authors of the wild and mutant coding regions of
the genome are not divided by codons. But the other point is
obvious: Adjacent DNA sequences from the 3 'and 5' ends of both
genes are different, hence, the contextual content of both their
mRNAs is different. This allows to predict different amino acid
sequences of the protein products of both “pseudo identical”
genes and, naturally, the different morphogenesis of the plant
regions encoded by these genes.
A detailed analysis of the work by Lolle et al. [Lolle et al., 2005],
together with the study of Turanov et al. [Turanov et al., 2009],
are interesting, since their main results encourage geneticists
to research genetic protein coding strategies further. As you can
see, much more needs to be clarified. This new understanding
in genetics facilitates the anticipation of possible faults
277
in recombinant technologies of artificial hybridization of various
genes. Such artificial hybridization may lead to semantic
uncertainty at the level of mRNA meanings, which determine
the choice and accuracy of amino acid and stop position coding
by syhom-codons. The paradox of the situation in genetics is that
over the 50 years of existence of the protein code model, it has
never been checked on a large-scale: on hundreds of proteins,
with all the statistics, and “proteins --- mRNA codons”
collinearity. If within the standard code table, any inconsistences
for E. coli proteins are found, then, this would not deny the code
model of M. Nirenberg and F. Crick. This would mean that
the principles of genetic coding of proteins, especially in
a linguistic, quasi-speech direction, are unlimited.

278
34. ATTEMPT TO REGENERATE THE DOG’S TOOTH
USING THE METHOD OF LINGUISTIC‒WAVE
GENETICS.

Preparation of stem cells

Multipotent mesenchymal stromal cells derived from human
adipose tissue were used for transplantation. Cellular suspension
from adipose tissue was diluted with Dulbecco's Phosphate
Buffered Saline (DPBS), ("Gibco") 1:2, layered on a density
gradient of Histopaque 1.077 ("Sigma") and centrifuged for 30
minutes at 600g. Then, interfacial mononuclear rings were
collected into centrifugal test tubes ("Corning"), washed
by centrifugation in excess DPBS. The resulting cell sediment was
resuspended in a culture medium and placed in culture test tubes
("Corning", 25cm2) and transferred to a 37°C constant incubator
with 5% carbon dioxide gas.
The culture medium consisted of DMEM/F12 supplemented
with 25mM HEPES, 2mM L-glutamine, 2mM sodium pyruvate,
100U/ml penicillin, 100μg/ml streptomycin and 10% fetal bovine
serum (all of the above are the reagents of “Gibco”). The medium
with non-adherent cells was removed. The cells, attached
to the plastic on the bottom of the culture flask, were gently
washed with DPBS, the medium was completely replaced.
Subsequent medium replacements were carried out every 2-3
days; the cultures were examined using phase-contrast
microscopy.
As the culture was cultured and the subconfluent state
reached, the cells were trypsinized with a solution of Trypsin-
EDTA ("Gibco") and passaged 1:2. For the experiment we used
a culture of passage 3, 1 million cells were placed in a tooth
socket.

Dog’s tooth regeneration

A demonstrative precedent for (in situ) regeneration of organs
and tissues with the help of quantum genes on spintronic
principles. This, as well as other precedents of quantum and
279
linguistic-wave genetics (based on relatively simply laser
technologies) open an infinite realm of quantum recombinational
genetics for regenerative medicine development (Figure 1 and
Figure 2).
Modulated Broadband Electromagnetic Radiation (MBER) was
synthesized from the surgically removed rudiment of a human
molar. Multipotent mesenchymal stromal cells (MMSCs) were
extracted from human adipose tissue. These MMSCs were
irradiated with the synthesized MBER and were grown to
the required concentration. Prior to the MMSCs introduction,
the dog's teeth were removed from the right and left sides of
the upper jaw. The programmed MMSCs were introduced into
the ight upper jaw in the place of the removed tooth. This resulted
in regeneration of a new tooth over 9 months (lower photo).

Results
A frequency-stabilized Helium-Neon laser with two
orthogonal optical modes was used to transfer the quantum
genetic information, which read the genetic information from
the rudiment of the human tooth. Such information was
spontaneously transformed into modulated broadband
electromagnetic radiation (MBER) carrying the same information,
initially recorded on polarization modulation (spin states) of
probing photons in the mode of returning the laser beam back to
its resonator.
The dog's teeth were removed behind the fangs on the left and
right side of the jaw. A week later, multipotent mesenchymal
stromal cells put in the place of the removed right tooth and were
pre-treated with MBER of the human tooth rudiment. The control
symmetrical area from the removed left tooth did not receive
any treatment. After 9 months, a complete regeneration of
the dog's tooth on the right side was observed. In the control area
of the left tooth, there was no regeneration. Extraction of the dog's
jaw for photographing the regenerated tooth was carried out after
the natural death of the dog from old age. Our study has
a theoretical justification given by us in the articles [Gariaev,

280
2015; Gariaev; Leonova-Gariaeva, 2018; Prangishvili, Gariaev,
Tertyshny, 2009], and the experimental substantiation given by us
in articles [Gariaev, Vladychenskaya, Leonova-Gariaeva, 2016;
Gariaev, Poltavtseva, Leonova-Gariaeva, 2017].

Fig. 1. Control: Dog’s left upper jaw where the tooth was removed.
No multipotent mesenchymal stem cells (MMSCs) introduced.

Fig. 2. Test: Dog’s right upper jaw where multipotent mesenchymal

stem cells (MMSCs) was introduced with subsequent tooth regeneration

Conclusion
Thus, the precedent of regeneration by the method of wave
genetics of a dog’s tooth was recorded using human genetic
information. The second factor is the conversion of human
genetic information into canine genetic information. This study
for greater evidence continues in experimental and theoretical
terms.
281
35. LINGUISTIC-PROBABILISTIC AND QUANTUM
UNDERSTANDING OF GENE OPERATION.

Difficulties in the interpretation of gene functions

We still do not understand the basis of the phenomenon of Life.
And most importantly - how it begins in our chromosomes, where
we are recorded as texts and holograms. In this paper we will
mainly cover the textual work of our chromosomes.
A half-truth is the worst lie. This half-truth is commonly
believed, especially since it is a half-truth of “knowledge” about
genetic coding. Everything here is an impregnable bastion
for criticism, and everything is dogmatized. Even the basic
concept, the strategic scheme of genetic coding
(DNA→RNA→Protein) is called the “Central Dogma”. Until
recently, the attack on this dogma, seemed senseless, doomed for
failure. However, as it turned out, the first fault in this dogma was
found with the discovery of revertase, and then this dogma,
turned into a ‘version’, and now it sounds much more modest:
DNARNA→Protein. But even with this modification, our ideas
about protein biosynthesis remains subject to erosion, since it is
just another approximation towards the truth, to understanding
the linguistic-shaped pluralism of the genome as a means of
encoding the spatial and temporal structure of biosystems
[Gariaev et al., 1990; Gariaev, 1993, 1997]

What do we want to prove?

In this study, we develop our ideas, the purpose of which, is not
in the final destruction of the so-called "canonical" triplet model
of the genetic code, but the development and establishment
of its exact place in the system of knowledge about the principles
of chromosomes. Yes, it can be said that the triplet code is
the ultimate truth. But it is a truth similar to claiming that one
can write any word using the alphabet. It's correct. But if we try to
go further, having only this knowledge, and prove that with
the help of the alphabet one can construct correct sentences,
then, this is wrong, because the construction of human speech

282
requires the laws of thinking, grammar and logic. And the genome
is precisely speech-like and logical, although these fundamental
features are not the only way to express its imaginative-semantic
structures. Moreover, we tend to follow the ideas of V.V. Nalimov
[Nalimov, 1989], which lead us to the idea that the genome is
quasi-conscious. Our logic and models are an attempt to obtain
higher-level knowledge about the laws of constructing genetic
texts and other semiotic-linguistic structures of the genome,
knowledge that is in the initial stage of development.
The foundation of this knowledge was laid back in the 1920s by
Russian researchers A.G. Gurvich [Gurvich, 1977],
V.N. Beklemishev [Beklemishev, 1994] and A.A. Lyubishchev
[Lyubishchev, 1925].
What can be proposed for the development and amendment
of the generally accepted theory of genetic coding? Before we
reach the final proof, let’s assume the below three provisions,
which already have some theoretical and experimental evidence)
are true: [Gariaev et al. 1990; Gariaev, 1993, 1997, 1999; Gariaev,
Tertishniy, 1999; Prangishvili, Gariaev et al., 2000]
1. DNA molecules in chromosomes have material-wave duality,
akin to the dualism of elementary particles. In accordance with
this, DNA encodes an organism in two ways - with the help of
the DNA substance, and due to its sign-oriented wave functions,
including at the level of its own laser radiation [Agaltsov, Gariaev
et al., 1996].
2. The genetic apparatus has the ability to be non-local
at the molecular level (holographic memory of the chromosomal
continuum) and quantum-non-local in accordance with the effect
of Einstein, Podolsky, Rosen [Einstein, Podolsky, Rosen, 1935].
The latter means that the genetic and other regulatory wave
information of the genome is recorded at the level of polarizations
(spin states) of its photons and is transmitted non-locally
(everywhere and in zero time) throughout the biosystem's space
according to the code parameter of polarizations. This achieves
inertialess informational contact between the body’s billions
of cells.

283
3. The genome as a whole and individual cell nuclei are quasi-
conscious on different levels; both the genome and individual cell
nuclei are capable of generating and recognizing textual-
imaginative regulatory structures using holography and quantum
non-locality.

What’s next?
Let’s assume, we have received final proof of these provisions.
Then, shall we look differently at material-wave dualism of DNA
and how it is related to the numerous code functions
of chromosomes that are significantly different from the known
triplet genetic code? In a sense, the genome acts as a complex
multi-wavelength laser with tunable frequencies. It emits light,
which is gene-linguistic (or gene-sign-oriented) modulated by DNA
for its amplitude, phase, frequency and polarization. Moreover,
the genome is also likely to be a raser. This raser converts
coherent sign-oriented polarized photons into coherent
isomorphically sign-oriented polarized broad-spectrum radio
waves connected to photons teleportationally [Gariaev, 1997;
Gariaev, Tertishniy, 1999; Prangishvili, Gariaev et al., 2000]
The genome is also a mobile, changing multiplex quasi-
hologram, which, with its multi-wave automatic-reading by its
own photon radiation, forms light-radio-wave gene-linguistic and
other regulatory structures [Gariaev, Tertishniy, 1999;
Prangishvili, Gariaev et al., 2000].
Such structures are registries of biofield marking schemes
(gauge fields) for constructing the space-time of biosystems. And
finally, the genome is a quasi-textual formation, with elements of
quantum non-locality, which can inertialessly ‘read’ the billions
of its own cells and use the information obtained as a guide to live
and a way to organize its structure [Gariaev, Tertishniy, et al.,
1999; Gariaev, Tertishniy, 1999; Prangishvili, Gariaev et al., 2000].
Perhaps, these ideas about new informational dimensions
of the genome today are like “Tutnese (Double Dutch)” to many
biologists and geneticists, and even more so to physicians today.
However, fortunately, not to all of them. This kind of thinking,
284
which originated in Russia in the 20’s, has gained momentum
with a sharp acceleration in the last decade. A new strategy
for understanding the work of chromosomes should be based
on fundamental studies of the material-wave and quasi-speech
attributes of the genome of higher biosystems. We emphasize
once again that we consider the chromosomal continuum
as a linguistic sign-oriented laser-radio-wave radiator [Gariaev,
1997; Gariaev, Tertishniy, et al., 1999; Gariaev, Tertishniy, 1999;
Prangishvili, Gariaev et al., 2000]. And this has direct
experimental evidence. For example, to prove the laser potency of
genetic structures, we have shown that in vitro DNA and
chromatin can be pumped as a laser-active medium with
subsequent laser light generation [Agaltsov, Gariaev, et al., 1996].

This ensures the selection of the correct amino acid or stop

position due to the strategic role of the “wobbling” of the 3'-
nucleotide in non-synonymous codons. This leads to
the transition of the genetic code from purely a physic-chemical
level of its operation to mental-textual one – the Syhomy of
genetic code. This is a representation of the fact of one of
285
the levels of non-locality (continuity) of the genome and his
speech-likeness [Gariaev, Leonova-Gariaeva, 2018]. This can be
presented in the form of the genetic code Table 1 with
a symmetric separation of the families of codons of synonyms and
codons of hybrids of synonyms and homonyms (syhoms).

A closer look at theoretical constructions

The evolution of biosystems has created their own genetic
"texts" and the genome-biocomputer as a quasi-conscious
"subject". At his level, it "reads and understands" these texts.
To substantiate this elementary "consciousness" of the genome,
it is extremely important to recall that natural (and it does not
matter what language it is) human texts and genetic "texts" have
similar mathematical-linguistic and entropic-statistical
characteristics. This applies, in particular, to the concept of
fractality of the density distribution of the frequency of
occurrence of letters (for genetic "texts" letters are nucleotides)
[Maslov, Gariaev, 1994].
There are data [Mantegna, Buldyrev et al., 1994] (completely
in line with our ideas) that were expressed earlier and
independently [Gariaev et al. 1990; Gariaev, 1993, 1997], that
“non-coding” DNA sequences, which is about 95-98% of
the genome represent strategic informational content of
chromosomes. This content is of material-wave nature and,
therefore, it is multidimensional and actually acts as
a holographic associative-imaginative and at the same time
as a semantic-semiotic program of the embryological principle,
a semantic continuation and a logical end of any biosystem.
Intuitively understanding the hopelessness of the old model
of genetic coding, the authors of [Mantegna, Buldyrev et al., 1994]
with nostalgic sadness say goodbye to the old and well-served
model of the genetic code, but don’t offer anything in return.

Homonymous-synonymous ambiguities of genetic texts.

What does the body need them for?
The common fundamental semiotic-semantic property of

286
natural and genetic texts is their synonymy and homonymy.
This provides chromosomes, as well as natural texts and speech,
with the excessive redundancy of information, its ambiguity
(multiple meaning), and therefore, adaptive flexibility.
The ambiguity of the same genetic texts becomes unambiguous
due to the effect of changing position of DNA-sequences in
the genome through their transpositions and/or
the transpositions of their environment. And this is an analogue
of situations in natural texts and speech, when the synonymous-
homonymous ambiguities of parts of the semantic field are
removed by the context (background principle [Prangishvili,
Anuashvili, Maklakov, 1993]).
In the traditional triplet model of the genetic code, homonymy
of coding doublets is easily detected. The meaning of
such homonyms has not yet been understood and appreciated,
with some exceptions [Gariaev, 1997; Gariaev, Leonova, 1996].
The inexplicable homonymy of codons of informational RNA
(mRNA) instantly arose with creation of a triplet model for
the encryption of amino acids in the process of protein
biosynthesis. And it immediately became a time bomb, since
a correct explanation of the biological (informational) meaning
of such homonyms automatically makes it necessary
to substantially refine the triplet model, if not to say,
to completely revise it.
How do codon homonyms reveal themselves? A number
of different amino acids are encoded by the same doublets as part
of mRNA codons, and the third nucleotides in the codons can
change randomly, they "wobble" and can be any of the 4 canonical
ones. As a result, they do not correlate with the coded amino acids
[Crick, 1966; Lagerkvist, 1978]. This is the cause of semantic
ambiguity in the anticodon choice made by the ribosome for
aminoacyl-tRNA selection. For example, each of the synonymic
codons of the standard code of higher biosystems AGT and AGC
encodes serine, and each of the synonymic codons AGA and AGG
encodes arginine. The third nucleotides of mRNA codons
in combination with the sign-oriented doublet do not have exact
amino acid correlates, and the first two sign-oriented codon
287
nucleotides are the same but encode different amino acids,
leading to ambiguity in the choice of tRNA anticodons. In other
words, a ribosome with same probability can choose both serine
and arginine tRNA, which can lead to the synthesis of abnormal
proteins. In fact, such errors do not occur, the accuracy of protein
biosynthesis is extremely high.
The errors occur only in some metabolically abnormal
situations: the presence of some antibiotics, amino acid
deficiency, etc. Normally, the ribosome somehow makes the right
choice of tRNA anticodons from homonymous doublets.
We believe that the correct choice of the anticodons-homonyms
doublet is implemented by contextual mechanisms.
The homonymity of the amino acid code can be overcome in
the same way as it happens in natural languages by placing
the homonym as a part into a whole, that is, into a complete
phrase, the context of which is deciphered by the homonym
assigning it a single meaning, resolving the ambiguity. Therefore,
mRNA as a kind of “phrase” or “sentence” should work in protein
synthesis as a functional coding whole (non-locally), defining
the amino acid sequence at the level of associates of
aminoacylated tRNAs that complementally interact
with the entire mRNA molecule. Macrosteric discrepancies
between the mRNA and tRNA continuums can be eliminated
due to the conformational lability of macromolecules. Wherein,
the role of ribosome A, P-sites is to accept these associates
(protein precursors followed by enzymatic stitching of amino
acids into protein). Knowing this, one can predict that interaction
of aminoacylated tRNA with mRNA is of a collective phase
character similar to re-association ("annealing") of single-
stranded DNA during the drop of temperature following
the "elongation" of the native polynucleotide. Are there any
experimental data that could be interpreted in such a way?
There are many of them and they are summarized in one
analytical study [Ter-Avanesyan, Inge-Vechtomov, 1988].
We will introduce here some of them. It is known that
the correctness of recognition of termination codons by tRNA
molecules depends on their contextual environment (which
288
proves our theoretical constructions): in particular, the presence
of uridine behind the stop codon. So, this study [Goldman,
Rosenberg, Zubay, 1995] describes it as follows. Insertion of nine
consecutive rarely used CUA-leucine codons after codon 13 as
a part of 313 codon test mRNA, strongly inhibits its translation
without an apparent effect on the translation of other mRNA’s
containing CUA codons. This clearly shows that translation has
contextual orientation. Making clearly visible the strategic
influence of codon inserts in mRNA (strictly defined and remotely
located from peptide bond formation) on the inclusion or non-
inclusion of a specific amino acid in the composition of
the synthesized protein. This distant influence, associated with
the continuity of protein synthesis (this is also an example of the
non-locality of genetic apparatus functions), when mRNA is
perceived by a protein-synthesizing apparatus not only in parts
(nucleotide-by-nucleotide, locally), but also as a whole (non-
locally). However, in the cited study, this key phenomenon is
simply stated, remaining incomprehensible to researchers and,
apparently, therefore, is not even discussed. There are more and
more of such works. The one that we mention here, for example,
refers to half a dozen of similar results, where interpretation in
this respect is also difficult. The reason for this, obviously, is
the imperfection of the model of the triplet genetic code. The
model is not accurate also because there are unusual swollen
anticodons. When they are involved in protein synthesis, not
three but more base pairs are involved in the ribosome A-site
[Ter-Avanesyan, Inge-Vechtomov, 1988]. This means that
the dogmatic postulate of the code tripletness is violated in this
case too. The results of studies on the interaction of tRNA-tRNA
on the ribosome are given in [Ter-Avanesyan, Inge-Vechtomov,
1988], and this also fully confirms our idea of an associate
(continuum) loaded with tRNA amino acids as a precursor of
protein. The study [Ter-Avanesyan, Inge-Vechtomov, 1988],
proposed a significant idea (very close to our thinking) that
the effect of mRNA context on the unambiguous inclusion of
amino acids in a peptide represents some fundamental, and so far,
poorly studied, principles of decoding of genetic information

289
in the process of protein synthesis.
Recall, that genetic information of protein synthesis takes up
only about 1% of the chromosome volume. 99% is employed
by programs of significantly higher levels.

Prions are the final blow to the central dogma

of molecular biology
As we see, the early ideas about the genetic code and the sign-
oriented operation of the protein-synthesizing apparatus are
simplified. Perhaps, the final argument in favor of the final
revision of the central dogma of molecular biology is
the phenomenon of prions. Prions are low molecular weight
parasitic proteins (PrPsc) that infect the brain of animals
(Mad Cow Disease) and humans (Alzheimer's disease,
Creutzfeldt-Jakob syndrome and others). An inexplicable feature
of prions is their virus-like strain-specificity. But strain-
specificity is inherent only to microorganisms or viruses that have
a genetic apparatus. At the same time, it is believed that the prion
genome is absent, since all attempts to detect at least traces of
DNA or RNA in prion composition ended in failure. A strong
contradiction arises, which once again casts doubt on the central
dogma of molecular biology: the prion has no genome but reveals
clear genetic signs. Unable to explain this, “saving” the central
dogma, they still assume that DNA or RNA residues are hiding
in some folds of prion molecules [Hunter, 1999]. However,
decades of prion research, which culminated in Stanley Prusiner
being crowned with the 1997 Nobel Prize for research in this area,
showed an absolutely exact absence of nucleic acids and,
therefore, no genome in their composition [Prusiner, Stanley,
1996].
How to overcome this contradiction? If you stick to the central
dogma, it is impossible. Letting go of dogma, we can imagine
the following scenario of prion biogenesis [Gariaev, Garber et al.,
1996]. The main symbolic figure here is the "virtual prion
genome", that is, the temporary genome, ‘borrowed’ from the host
cell. More precisely, it can be said that this is the protein-

290
synthesizing apparatus of the host cell. Probably, prions as one of
the breeding methods have retained a paleogenetic path, which in
some cases allows them not to use genes encoding them in
chromosomes, but to self-propagate in another way, ignoring
the central dogma of molecular biology and genetics. For the cell,
synthesizing a prion by means of addressing to their genes, is,
albeit a progressive way, but is organizationally and energetically
difficult. Prions can do better. We assume that the NH-groups of
the PrPsc peptide bonds can react with the OH-groups of
the ribose residues of the acceptor CCA sequences of
corresponding tRNA. In the course of hypothetical enzymatic
reactions, the emerging poly-tRNA-continuum, collinear to
PrPsc, spatially pulls together anticodons in pairs, forming
a covalently discrete similarity of messenger RNA (smRNA).
This stage is almost the reverse to the protein synthesis on the
ribosome. Probably, it occurs on the A- and P-sites
of the ribosome. Then, RNA is synthesized into smRNA.
This requires the corresponding RNA polymerase, capable
of working with the covalent-discrete matrix of smRNA. This is
what prion "borrowing" is about: the use of the host cell’s protein-
synthesizing apparatus for the time period of prion reproduction.
Since this operation is limited in time, it creates an illusion
of absence of genetic apparatus. At the same time, prion peptide
chains serve as matrices on which the poly-tRNA-continuum is
built in pairs on A- and P- ribosome sites, forming discrete poly-
anticodons. The latter, bonding in pairs, either immediately serve
as a matrix for RNA-dependent mRNA prion synthesis, or
(in another case) poly-anticodons are cut out by specific splicing
followed by ligation into a covalently continuous mRNA prion
matrix. Next, prion’s mRNA on the ribosome is polymerized
by prions themselves. This means that the ribosome works
in the opposite direction and thus, it is a “prion-poly-anticodon-
dependent mRNA polymerase”. And consequently, in violation of
the Central Dogma, information flows from protein to RNA.
This requires dogma formula to be re-written as follows:
DNARNAProtein. And it can no longer be called a dogma,
but is a simple working formula, with which it is necessary

291
to work, specifying and developing it. With such an outlook on
prion biogenesis in mind, their strain-specificity is explained
by the peculiarities of the reverse work of ribosomes, which are
temporarily recruited during the synthesis of each of the prion
strains. And these peculiarities are determined by the taxonomic
position of prion-producing biosystems.
Let us return again to the generally accepted basic principles
of the genetic code model: it is triplet, non-overlapping,
degenerate, has ‘no commas’, i.e. codons are not separated from
each other in any form. The flow of information goes from DNA
to RNA and further to protein. And finally, the code is universal.
What remains of these provisions? In fact, nothing. In fact,
the code, apparently, is two-, three-, four-, .., n-lettered
as a fractal and heteromultiple formation, encoding not only
individual proteins, but also functionally associated protein
associates. It is overlapped by shifts in the ribosomes reading.
It has commas, since heterocodons can be separated from each
other by sequences with other functions, including punctuation
functions. The code is not universal: in 31 cases it is different from
the standard code of higher biosystems. All these cases refer to
the mitochondrial, yeast, mycoplasmal, trematode and other
codes of lower organisms [Elsanowski, Ostell,1996; Fox, 1987] and
can be considered as a kind of dialect. But strategically, the Codes
are close.
And the last: the protein is probably able to serve as a matrix
for RNA, as we can see with the example of prions. How
to interpret the real genetic (to be precise, protein) code, taking
into account the above contradictions and the proposed logic of
reasoning? It is possible to postulate a qualitative, simplified,
primary version of the material-wave control of amino acid
alignment, dictated by the associates of aminoacylated tRNA as
protein precursors. Accepting this version, it is easier
to understand the work of the protein code as one of the many
hierarchical programs of the material-wave organization of
a biosystem. In this sense, such a code is the first stage of
chromosomal plans for the construction of a biosystem, since
the language of the genome is multidimensional, pluralistic and
292
not reduced to the task of protein synthesis. The main provisions
of the proposed orientational model of material-wave sign-
oriented processes during protein biosynthesis can be reduced
to the following:
1. A multicomponent ribonucleoprotein protein-synthesizing
apparatus is a system for generation of highly organized sign-
oriented radiation of acoustic-electromagnetic fields that
strategically regulate its self-organization and the order
of incorporation of amino acids into a polypeptide chain.
2. Amino-acylated tRNAs associate in sequences are
the “precursors of the synthesized proteins” before contact with
the A–P region of the ribosome. Wherein, the continuum of
anticodons of tRNA pools is complementary to the entire mRNA,
except for dislocations, determined by the presence of non-
canonical nucleotide pairs.
3. The order of alternation of aminoacylated tRNAs in protein
precursor-associates is determined by the sign-oriented collective
resonances of all participants in the synthesis of amino acid
sequences. Here pre-mRNA and mRNA are the key wave matrices,
they work as an integral continuum (macrocontext)
of heteropolycodons of different length scales, including
the intron fraction of pre-mRNA. The main function of the wave
matrices is the associative-contextual orientation of
the aminoacylated tRNA sequence. This orientation ignores the
rules of canonical pairings of nucleotides in the one-dimensional
mRNA-tRNA space to a greater extent than the “wobble
hypothesis” of F. Crick. On the ribosome, in addition to and/or
along with the resonant regulation of the relative position of the
codon-anticodon continua, there are laser-like radiations of all
participants of this process, correcting the order of incorporation
of amino acid residues into the peptide. The ribosome
enzymatically covalently fixes “de jure” peptide bonds of amino
acid sequences, which are marked “de facto” in the polyamino-
acid-poly-tRNA associate, as a precursor of the protein.
4. Resonant-wave “censorship” of the order of incorporation
of amino acids into the peptide chain eliminates the potential
293
semantic arbitrariness of creating erroneous protein “sentences”,
resulting from homonymy of codon families, and ensures their
correct “amino acid understanding” by contextual removal
of homonymy of ambiguous identical doublets in codons.
The degeneracy of the genetic code is necessary for the pre-
mRNA-mRNA-dependent context-oriented accurate selection
of aminoacylated tRNA. The selection which is determined
by the nature of the wave associative resonant interactions
in protein-synthesizing apparatus.
5. One of the mechanisms of creating error-free sequences
of aminoacylated tRNA on the pre-mRNA-mRNA wave matrices
can be considered a special case of a partially complementary
reassociation of single-stranded DNA-DNA and RNA-DNA or,
more generally, as an act of self-assembly, known for ribosomes,
chromosomes, membranes and other molecular-supramolecular
structures of the cell.
6. A ribosome is able to work in the direction of RNA synthesis
on a protein matrix.
Thus, the role of mRNA is sign-oriented multi-vector and
dualistic. This molecule, like DNA, in evolution marks a nodal
event – the complementary synergistic unity of material and wave
genetic information. The ambiguity of material coding is removed
by the precision of the wave coding, which is implemented,
probably, by the mechanisms of collective resonances and laser-
holographic (associative, contextual-background) effects
in the cell-tissue continuum. A leap towards more advanced wave
regulation of RNA-Protein translation is accompanied by partial
or complete rejection of the rule of canonical pairing of adenine
with uracil (thymine) and guanine with cytosine, which is
characteristic of evolutionary earlier and simpler stages of DNA
replication and RNA transcription. Such rejection is
informationally necessary, inevitable and energetically preferable
at the level of higher biosystems. We emphasize once again that
contextual associative-holographic mechanisms of operation of
the protein-synthesizing system of organisms are closely
connected with the so-called “background principle” [Mantegna,

294
Buldyrev et al., 1994], and also, probably, with the multi-vector
and ambiguous (polysemantic) logic of managing complex
systems (Gerhard Thomas, kenogramatics). From this position,
macrocontexts of pre-informational and contexts of
informational RNA can be considered as a background, which in
this situation and in this interpretation is a "noise source of
information". This provides a sharp amplification of the signal,
according to which the exact choice (wave recognition) of one
of the two homonymous aminoacylated tRNAs takes place, one
and only one of which must enter the exact protein “phrase” or
“word”. This choice is possible after the selection of the coherent
component in the form of echo of the same "comprehension"
(discernment) by the ribosome of one of two identical doublets
in codons. The situation can be explained with a simple example.
For example, in the sentence, you must choose one of two words
(analogs of codons with doublets-homonyms). Let’s assume
these words are “cat” and “cab”. It is clear, that the word choice
depends on the whole sentence, on the context, which acts
as a background, allowing to highlight the signal – the missing
word. If the sentence sounds “The cat would like to eat
the mouse”, then, replacing the word “cat” with “cab”, would be
equivalent to the introduction of noise and signal loss. Perhaps,
the role of pre-informational RNA and introns is similar.
They represent different levels of contexts that need to be
somehow “read” and “comprehended” by the living cell and its
ribosomal apparatus in order to make an accurate decision on
the choice of the tRNA anticodon in a situation of homonymy.
In this case, the ribosomal protein synthesizing system of the cell
can be considered as a nanobiocomputer.
The apparatus for a continuous (non-local) “reading”
of contextual RNA-sequences as a whole can be represented
by a multi-faceted soliton family: optical, acoustic,
conformational, rotational-oscillatory, and other solitons,
excited in a polynucleotide. The functions of such solitons can act
as methods of accumulating semantic information about RNA-
contexts which is followed by semantic regulations of codon –
anticodon sign-oriented interrelations. Wherein, semantic
295
evaluation is carried out by the cells biocomputers - genomes.
As a method for continual reading of polynucleotides, it is
possible to imagine exactly the soliton method, scanning the RNA
sequence. For example, solitons of running torsional oscillations
of nucleotides on the sugar-phosphate axis, which we physically
and mathematically examined for single-stranded RNA-like DNA
segments [Blagodatskikh, Gariaev et al., 1996; Gariaev, Maslov,
et al., 1997]. Such solitons react to changes in nucleotide
sequences by modulating their dynamics, which acquire sign-
oriented features, the dynamics that can probably be transmitted
distantly, that is, at distances significantly exceeding the length
of hydrogen bonds. Without distant (wave, continual) migration
of a signal about the whole (i.e. about pre-mRNA-mRNA
sequences), it is impossible to implement associative-contextual
regulation of protein synthesis. For this purpose, some types of
solitons need to exercise its wave nature/aspect (as well as their
holographic memory) to be able to work not only with parts,
but also with an extended polynucleotide whole. Such
a continuity (or one and the same, non-locality) ensures
ribosomal apparatus recognition and correct choice of a true
codon from two doublet-homonymous codons, a codon, which is
pseudo-suppressed by the background noise (context).

Practical application of linguistic ambiguities of genetic texts

After all the above reasoning, the question arises: can
our findings in any form help to solve the problems of HIV and
cancer, which from the first sight seem to be irrelevant to what
we are talking about? The answer is: ‘yes’, they are directly and
immediately related to these problems. The genome of HIV and
other retro viruses, as well as oncogenes, are “silent”
(as destructive factors), as well as some other DNA structures are
“silent”, for example, pseudogenes. And this "silence" lasts up to
a certain point. And this key point for the initiation of
the pathological state of the genome of candidate cells for
abnormal degeneration is determined by transpositions
in the chromosomal space-time of oncogenes and the HIV
genome, or by transpositions of their polynucleotide

296
environment. In both situations, the oncogene and HIV genome
context is changing. The latter, in this case, ceases to be
homonymous, unrecognizable or perceived by the cell
as the norm. Other signals, aimed at reproduction of HIV, are
included ("read and understood") too. In the new context,
oncogenes are perceived by the cell as factors with different
(pathological) command functions. The changed background
(context) reveals, amplifies in the new context-polynucleotide
situation hitherto hidden potential signals, other meanings.
The same thing happens as in the synthesis of proteins in the act
of choosing from the homonymous codons the correct one. In this
other context, cells are “deceived in the meanings” of DNA-
sequences and take incorrect “decisions” for correct, which leads
to a complete rearrangement of metabolism along the cancer path
and in the direction of HIV reproduction. The relativity
of the situation here is that these decisions are incorrect in
relation to the organism, but correct in relation to
the reproduction of HIV. In this way, pathogens identify
themselves, revealing their true "goals", preserving and
multiplying themselves as alien parts due to the destruction of
the biosystem as a whole. We can consider the problem of
migration of DNA-sequences in chromosomes more broadly,
whether they are oncogenes, the HIV genome, or any other
transposons that we cannot understand. Moving along
the genome as a contextual continuum, they acquire more and
more new meanings, different semantics, depending on their
location in the 3-dimensional space of interphase chromosomes.
The same reasoning is valid with respect to the "genome-
engineering" transgenesis of plants and animals. The growing
sphere of artificial transgenic organisms threatens a global and
rapid degeneration of all life on Earth because it does not take into
account the uncontrolled automatic sign-oriented rearrangement
of higher genocodes that occurs after the introduction of alien
DNA molecules. The result of such "genome-engineering"
manipulations will be an almost uncontrolled intertaxon transfer
of alien DNA-sequences and an avalanche semantic chaos within
chromosomes and metabolic chaos in all biosystems, including
297
humans.
Fairly abstract theoretical constructions of the proposed by us
meanings of transpositions of genetic material are confirmed not
only by the example of transgenic biosystems, but also
in the fundamental work of R.B. Khesin [Khesin, 1984].
Euchromatic genes, moving to intercalary heterochromatin, show
the effect of position: they are inactivated in some somatic cells,
continuing to function in others. Oncogenous sequences can be
incorporated into retroviruses that initially do not have their own
oncogenes. As a result, sometimes relatively harmless viruses
become tumor-like. For example, the RaLV virus in rats can turn
into a sarcomal RaSV virus, incorporating host determinants into
its genome. Cellular oncogenes, like viral ones, acquire
transforming activity if viral long-repetitive-terminal-repeats
(LTR) are attached to their 5'-ends by ligation. In a certain
environment, proviruses, including HIV (as we see it), turn into
latent (“silent”) genetic elements. They can be stored in the host
genome without harm, thanks to repression of their activity
by the neighboring sequences of cellular DNA. Bearing in mind
this provision, cited by Khesin, it is also possible to assume the
opposite - activation of the HIV genome, surrounded by other
DNA sequences, when the cell interprets HIV in a different DNA
context as a hostile semantic structure, but cannot oppose
anything in its defense. However, as Khesin emphasizes,
it remains a mystery what are the features of the neighboring
chromosomal DNA regions and what determines the mechanism
of provirus activity. This question will remain unanswered, if our
understanding of the genome does not acquire other dimensions,
in particular, semantic-speech, wave, imaginative, which is what
we call for. In this aspect, it would be interesting to compare
semantic and holographic information of chromosomes.
The genome of higher biosystems has several levels of non-
locality, "blurring", redundancy of information, one of the forms
of which is the holographic memory of the chromosomal
continuum. This is contrasted with the locality and unambiguity
of information of mobile genome elements – transposons –
but the multi-vector meanings of this information disclose
298
themselves depending on the changing contextual environment
of the transposons.
And the transposons themselves represent the initiating
elements of the emerging, disappearing and repeating texts.
A contextual "game" (combinatorics) depends on the metabolic
needs of cells, tissues, the body at the moment. The difference
between the text and the context is conditional and depends
on the scope of the part and the whole in the genome.
The boundaries of the part and the whole are conditional and are
probably of a morpho-functional nature, depending
on the quantization of the organism over the levels of the cell,
tissue, organ and biosystem as a whole. There is a more subtle
gradation – along the functional-metabolic regions of the cell,
which are controlled by certain parts of the chromosomes,
up to protein-gene and exon-intron splicing. Each of these
discrete gradations is a whole with respect to itself, but it is a part,
where the level of division is higher. Isn’t this the origin of
metabolic pathologies and gerontological manifestations when
the biosystem ceases to distinguish and differentiate the multi-
faceted patterns of the part and the whole? Here, the HIV genome
(as a transposon and as a conditional part) in some DNA context
of the host chromosomes may be invisible to the cell. This reveals
one of the mechanisms of molecular-semantic mimicry of
pathogenic chromosomal structures. Each coding-non-coding
homonymous (and synonymous too) and any other DNA sequence
can be viewed as a potentially multi-meaning (ambiguous)
pseudo-supressed by noise signal(s) or as an image(s) that needs
to be recognized and understood in the context of other dynamic
genetic images.
The amplification of each of these signals-images, their
isolation from background (context, noise) is achieved by
the genetic apparatus not by suppressing the noise, but
on the contrary, changing background-context serves as a means
of isolating, amplification and “comprehension” by the cell, tissue
and organism of the meanings of each of these potential signals-
images. In similar fashion, it is logical to consider the role of
the 3'- and 5'-flanking sequences of protein genes that highlight
299
one or another of their linguistic sign (meaning). If we realize that
the proposed mechanism for the dynamic game of meanings of
genotexts can play a significant role in the development of HIV
and cancer, in general, the whole metabolic status of
the organism, and if we accept the idea that comparing
the genome with natural texts and figures is, by no means,
a poetic metaphor, then, there are real possibilities of creating
new strategy for biosystem regulation, including regulation of
behavior of viruses and oncogenes.

Does a probabilistic approach allow isolation

of individual (including pathogenic) meanings
in a changing polysemantic continuum of the genome?
We have already noted some similarities between
the Background Principle and the multi-vector logic
(kenogrammatics) of Gerhard Thomas (see above) and possible
perspectives of these methodologies for isolating and recognizing
the genetic, or broader, metabolic vectors of the vital functions
of multicellular organisms. There is a powerful direction
in the theory of natural languages, applicable, as it seems to us,
to genetic linguistics. This direction was developed
by V.V. Nalimov and is associated with a probabilistic approach to
understanding the language [Nalimov 1981, 1989]. Recall, that
the genome is primarily a language (text). One of the natural
texts, but specific. V.V. Nalimov believes that the semantics of
each specific text (including genetic, as we believe) is given by its
distribution function (the probability density) - 𝝆(𝝁). A text
change, its evolution, is associated with a spontaneous
appearance in some situation 𝒚 of a filter 𝝆(𝒚/𝝁) that
multiplicatively interacts with the original function 𝝆(𝝁). For us,
𝒚 is the change of the genetic text respresenting the natural
transpositions of mobile DNA elements, recombinations, splicing,
and ligation. Non-natural changes are “erroneous”
(for a biosystem) transpositions of their own or foreign mobile
elements of DNA, mutations and artificial transgenic
manipulations of “genetic engineering”. A special class of non-
natural changes is the introduction of viral genomes

300
into the chromosomal material of the biosystem, for example,
the HIV genome. The interaction of the filter 𝝆(𝒚/𝝁) with
the original function 𝝆(𝝁) is given by the well-known Bayes
formula:
𝝆(𝝁/𝒚) = 𝒌𝒑(𝝁)𝝆(𝒚/𝝁),
where
𝝆(𝝁/𝒚) is the distribution function determining the semantics
of the new text after its
𝒚 - changes;
𝒌- the normalization constant.
The Bayes formula, according to V.V.Nalimov, acts
as a syllogism: two premises - 𝝆(𝝁) and 𝝆(𝒚/𝝁), are necessarily
followed by the text with the new semantics 𝝆(𝝁/𝒚).
We shall assume that the idea of Bayes-Nalimov is applicable
to genetic "texts". Then, the "meaning" of these "texts", taken
as a whole, turns out to be given by the weight ratios determined
by the function 𝝆(𝝁). "Meanings", being qualitative in nature,
acquire a quantitative characteristic. Such a conditional
distribution function 𝝆(𝝁/𝒚) is interpreted by V.V. Nalimov
slightly differently from the generally accepted in Bayes’s
statistics. According to him, 𝝆(𝒚/𝝁) - is the density distribution
of a random variable 𝒚 at a given value 𝝁. Thus, the argument of
a function 𝝆(𝒚/𝝁) that performs the role of a filter can be
considered not 𝝁 but 𝒚.
The key moment in this model is probably the initiation,
exciting a new semantic situation change factor 𝒚. It is this that
unpacks "understanding and re-understanding" of all new
meanings, as well as holographic and other images, in
the changeable semantic space of mobile DNA of the genome of
multicellular organisms. The semantic continuum of the genome
passes through dynamic filters 𝝆(𝒚/𝝁) that meet the sharp
changes of 𝒚. It is significant that V.V. Nalimov wondered what
influences the ability to generate non-trivial filters 𝝆(𝒚/𝝁) and
did not find the answer. But then he expresses the idea of the role
of the environment, the role of the diversity of situations as

301
the origin, the reason for the formation of adequate filters. Here,
V.V. Nalimov actually ended up with the Background Principle,
discussed above. After bringing the model of V.V.Nalimov and
the Background Principle together, it is logical to assume that
factor 𝒚 is nothing but an extended-contextual (background)
mechanism for triggering filters 𝝆(𝒚/𝝁). These filters highlight
exactly the semantic load and meaning, which are determined by
a specific metabolic, including genetic ("contextual") situation.
For example, the need for the cell to synthesize at the moment
a large amount of catalase, which entails the selection and
expression of the catalase gene from the multi-meaning gene
continuum. This reveals another, and perhaps the key,
mechanism for the differential activation of the genome
for the production of certain proteins. Thus, the Background
Principle and the Bayes-Nalimov idea turned out to be connected,
in essence, with identical concepts. Probably, Gerhard Thomas
kenogramatics [Nalimov, 1989] (see above) can be added here too,
since it is largely relying on contextual orientations in
the selection of priorities for managing complex systems.
Let us again return to "genetic engineering" and also recall
"chromosome engineering," when they operate with large genome
blocks, trying to create useful hybrids. From the standpoint
of a probabilistic approach to mobile polysemantic chromosome
continuum, such “engineering” looks rather gloomy.
Any manipulation here is an instant (compared to the pace
of evolution) creation by us (and not evolution) of new factors 𝒚,
therefore, unauthorized by the time (evolutionary) frameworks
of the mutation of semantic filters 𝝆(𝒚/𝝁). This is the coming
chaos of the gene pool of the Earth, if we understand the functions
of the genome in the old way.

The paradox of the genetic apparatus

The paradox of the genetic apparatus is that it combines
seemingly mutually exclusive properties - informational
stability, passed down from generation to generation with
the inconstancy of the genome [Khesin, 1984]. The genome is
mobile due to polynucleotide transpositions, nonlinear dynamics
302
(electro-acoustics) of soliton type, conformational
rearrangements and holographic rearrangements. These non-
random (programmatic) movements of the chromosomal
continuum in living tissues are complexly distributed in
the space-time of the biosystem. These dynamics are one of
the methods of wave control of the distribution of parts of the
body relative to each other. This is also the way to organize
a sequence of metabolic events, that is, biological time, which is
fractal. Such powerful sign-oriented chromosomal nonlinear
dynamics, easily detectable even in vitro, is realized through its
isomorphic representation in the space-time structure
of the organism [Gariaev et al. 1990; Gariaev, 1993].
As a result, in the chromosomal continuum, as a polysemantic
and multiplex-holographic formation, there is a constant and
changeable semantic "game of meanings”. There is a kind
of "endogenous semiotic demonstration" of optico-acoustic
regulatory (sign-oriented) images, which also have variable
meanings. One of the types of such chromosome images was
experimentally found in many laboratories as a phantom leaf
effect. For more details, see [Gariaev et al. 1990; Gariaev, 1993].
The theory of this effect was developed on the principles
of holography [Gariaev et al. 1990; Gariaev, 1993; Gariaev,
Tertyshny, 1999; Prangishvili, Gariaev, 2000].
It can be said that the “game of meanings” is a function of sign-
oriented dynamics of interphase chromosomes. This is a necessary
condition for the storage and processing of extremely large
amounts of information, when the ultralow volume of the liquid
crystal chromosomes of the zygote is able to operate with the
multi-vector, multi-meaning logic of the development of
an extra-complicated biological system. Hence, the clear idea that
a fundamentally new strategy for the development of methods for
treating HIV and cancer lies in understanding and control
of the multi-vector genome logic. If we learn to apply correct
genetic engineering methods, we can efficiently introduce certain
DNA-sequences connected to oncogenes or HIV genome from
the 3 'and 5' ends, then, we should expect inactivation of their

303
pathological natures. On the other hand, if we know the laws
of ribosomes operation in the contextual orientation mode, then,
we can fight HIV in the zone of the ribosomal wave (laser, soliton,
polarization-radio wave) controls. Ribosomes, synthesizing HIV
proteins, must have subtle wave vectors of control via context-
background paths. Knowing them, it is possible to suppress
the synthesis of viral proteins by external artificially modified
fields, similar to those used by the cells themselves in normal
conditions.

Levels of non-locality of the genetic apparatus.

Preliminary experiments.
Let’s talk about another phenomenon of genome operation.
This is a hypothetical, and to some extent justified by us
experimentally, effect of quantum non-locality of sign-oriented
states of chromosomes [Gariaev, Tertyshny, 1999; Gariaev,
Tertyshny et al., 1999; Prangishvili, Gariaev, 2000]. The idea
of quantum non-locality was expressed by Einstein, Podolsky,
and Rosen (EPR effect) [Einstein, Podolsky, Rosen, 1935]. It is
flawless in terms of the formalism of quantum physics. Briefly,
the essence of EPR is that elementary particles, for example, two
photons, originally located in the so-called entangled state,
when separated from each other at any distance, keep
the connection (this can be described as informational)
by quantum parameters, for example, polarization.
If the polarization of one of them for some reason has changed,
for example, the photon passed through some optically active
layer and recorded polarization modulations, then, this photon
disappears, but instantly (in zero time) transmits the recorded
polarization information to another photon. It would be more
accurate to say that there is no “transmission”, but there is
a transition of one photon into another using the mechanism
of permissive teleportation. The transformation of the first
modified photon into the second occurs, regardless of
the distance between them. The second photon becomes
a complete analogue of the first. If this somehow works in
the genetic apparatus, then, we open completely different

304
horizons of understanding metabolism, and the phenomenon of
Life in general. In purely physical terms, the EPR phenomenon
was correctly confirmed only in 1997 as a fact of photon
teleportation (32).
Similar results were soon obtained by other researchers, and
not only on photons. They already teleported multi-frequency
physical fields. Based on these data, it can be assumed that
the photon fields emitted by the chromosomes as linguistic sign-
oriented can be teleported in the space of the organism or even
beyond its limits. The same applies to photon wave fronts, read
from the chromosomal continuum as from a multiplex hologram.
If the photons are converted into radio waves, which we have
discovered [Gariaev, 1996; Gariaev, Tertyshny, 1999; Gariaev,
Tertyshny et al., 1999; Prangishvili, Gariaev, 2000], and this
happens in the chromosomes by the EPR mechanism, then,
the significance of this phenomenon is fundamental.
Indeed, the importance of the reality of quantum non-locality
for the genome is difficult to overestimate. This idea was
expressed and published by us after we discovered, apparently,
a more complex version of the EPR effect using the equipment
we developed. It includes a special type of laser that can translate
its own photons into radio waves [Gariaev, 1996; Gariaev,
Tertyshny, 1999; Gariaev, Tertyshny et al., 1999; Prangishvili,
Gariaev, 2000; Gariaev, Garber, 1996; Tertyshny, Gariaev, Roslov,
1999]. This laser is characterized by the ability for a unique
dynamic polarization of the beam, perhaps remotely simulating
the dynamic polarization of the laser radiation of chromosomes.
It converts its photons (λ=632.8nm) into radio waves from a kilo
to megahertz range during beam interaction with matter and
injection of the probe photons back into the laser resonator.
We believe that under such conditions, pairs of entangled
photons (produced in the gas phase of the laser optical resonator)
during their separation and interaction with any matter, including
laser mirrors, turn into radio waves. It was found that photons are
able to localize in fractal clusters of the metallized laser mirrors.
When photons probe any external object, then their spectral
characteristics are “remembered” by mirrors. So, we managed
305
to record polarization-radiowave information of DNA
preparations. Such information carries morphogenetic signals.
This gave us the opportunity to develop a fundamentally new type
of dynamic polarization laser-radiowave spectroscopy and
investigate quantum non-local (probably, teleportational) genetic
processes.
Let us additionally introduce some considerations about
the significance of quantum teleportation of genetic-metabolic
information for biology as a whole. It seems that the quantum
non-locality of genetic (chromosomal) information, as
a manifestation of its wave total distribution (continuity) in
the space of multicellular biosystems, is a special case.
In biosystems, at least there are six levels of non-locality.
Level 1 - Organizational. Here, non-locality is expressed in ability
to regenerate, for example, in planarians. After cutting such
worms, any part of their body gives the whole organism during
regeneration. In other words, in this case there is no linkage
of the total pool of genetic information to some part
of the biosystem. The same applies to vegetative propagation
of plants.
Level 2 - Cellular. From every cell, and not just from zygotes,
you can grow a whole organism. For animal biosystems, this is
difficult, but possible. Each cell is a potential continuum
of the organism.
Level 3 - Cellular-nuclear. Enucleation of nuclei from somatic and
germinal cells with the subsequent introduction of other nuclei
into them does not prevent the development of a normal
organism. Cloning of this kind is already carried out on higher
biosystems, for example, on sheep. Each cell nucleus is also
a potential continuum of a biosystem. There is no localization of
genetic potencies on any individual cell.
Level 4 - Molecular: the ribosome "reads" the informational RNA
not only for individual codons, but for the whole RNA, taking
into account the context, that is, non-locally, continually.
Level 5 - Chromosome-holographic. The genome has a holographic
306
memory [Gariaev, Tertishniy, et al., 1999; Gariaev, Tertishniy,
1999], and this is a typically distributed (non-local) associative
memory. At this and subsequent levels, non-locality acquires
a new quality, a dualistic, material-wave character, since
holograms as a substance are “read” by electromagnetic and/or
acoustic fields that carry genome-wave information beyond
the substance of chromosomes. A physical field or fields, such as
a gauge field, marking the future space of an organism, appear
on the scene. This also includes, apparently, the holographic
memory of the cerebral cortex, which determines mental,
semantic and imaginative spaces, calibrating the potential
actions of higher biosystems. This is where socio-genetic
processes are realized.
Level 6 - Quantum non-locality of the genome. Up to level 6,
the non-locality of genetic information is realized in the space
of the organism. Level 6 has a special character and a new quality.
It manifests itself in one of the forms of quantum non-locality,
namely, permissive, postulated in this work. In this case, the non-
locality is realized both in the space of the biosystem and in its
own, “compressible” to zero, time. Gene-wave programs that are
instantly distributed in such ways, isomorphic to material ones,
work in the body "here and there at the same time", therefore,
the semantic construction "first and then" loses its meaning. And
this is a strategic factor, an extraordinary achievement
for multicellular biosystems. Billions of cells must “know” about
each other, if not about everything, then a lot, and moreover,
instantly. Without the phenomenon of “wave information
instantaneousness,” the giant multicellular continuum of higher
biosystems is unable to fully co-ordinate metabolism,
its physiological and other functions.
Intercellular diffusion of signaling substances and nerve
processes are too inert for this. Even if we assume that sign-
oriented electromagnetic fields with light speeds are involved
in the intercellular transmission, which is sufficiently justified,
even then, this is not enough. The mechanism of quantum non-
locality is necessary, and it is applicable to the genetic apparatus,
which can act as an instantly distributed quantum (wave) object,
307
isomorphic to material chromosomes. Using non-locality,
the genetic apparatus of higher biosystems create an amazing
phenomenon: when in the moments of “collapsed” space-
time,“here and there”, “first and then”, the biosystem works
as a continuity, providing supercoherence, information over-
redundancy, overinformation, connectedness and, as a result,
integrity (survival). A manifestation of this, for example,
is the ability to regenerate organs and tissues in lower organisms
(hydra, worms, amphibians, lizards, crustaceans), an ability that
has been largely lost by humans. But, given the principles of wave
self-organization of biosystems that we are developing, it can be
activated. An illustration of this is the world's first successful
engraftment of donor tissue implanted to a blind person
with restoration of vision. The ideology of such a surgical
operation and regenerative processes was based on research
[Gariaev 1997; Nalimov , 1989; Gurvich, 1977; Beklemishev, 1994;
Lyubishchev, 1925; Gariaev, Tertishniy, 1999; Gariaev, Tertishniy
et al., 1999; Prangishvili, Gariaev, Tertyshny et al., 2000;
Agaltsov, Gariaev, Gorelik et al., 1996; Gariaev, Leonova-
Gariaeva, 2018; Maslov, Gariaev, 1994; Mantegna, Buldyrev,
Goldberger, 1994; Prangishvili, Anuashvili, Maklakov ,1993;
Gariaev, Leonova, 1996].
In recent years, have obtained theoretical and experimental
results confirming our ideas. We have expanded the theoretical
model of the linguistic nature of genetic information by
introducing the concept of “delegating” the function of other
Code letters to the 3’-nucleotides of non-synonymous codons.
We introduced the concept of SYHOMY - the phenomenon of
functional hybridization of synonymous and homonymous
codons, which explains the leap of the genetic coding of proteins
to the level of real textual (mental) structures [Khesin, 1984;
Gariaev, 1997, 2008, 2009, 2015, 2017; Shipov, Gariaev, 2018;
Prangishvili, Gariaev, Tertyshny et al., 2000; Gariaev, Kokaya,
Leonova-Gariaeva et al., 2007; Korneev, Gariaev , 2015;
Tertyshny, Gariaev, 2007; Gariaev et al., 2007; Gariaev, Kokaya,
Leonova-Gariaeva et al., 2007; Gariaev, Tertyshny, Tovmash,
2007; Gariaev, Vladychenskaya, Leonova-Gariaeva et al., 2016;
308
Gariaev., Vlasov, Poltavtseva et al., 2018]. But this is a topic for a
separate article.

309
36. MRNA DEPENDENT VIRTUAL-REAL
SUBSTITUTIONS OF NUCLEOTIDES IN CODONS:
THE DYNAMICS OF THEIR MEANINGS
IN THE GENOME LANGUAGE.

Let’s consider a structurally modified standard (Table 1)

of the Genetic Protein Code. The Table presents symmetrically
distributed codons: synonyms and syhoms (hybrids of
synonymous codons and homonymous codons). The amended
table was proposed by us earlier [Gariaev, 2015; Gariaev, Leonova-
Gariaeva, 2018].

A careful analysis of the Table shows that the synonymous

codon family TCT TCC TCA TCG encodes serine. Two triplets of
syhom codons AGT AGC also encode serine. This represents a real
material transformation of the coding doublets AG ---> TC, which
enables syhom AG doublet to encode serine along
the synonymous path.

310
 Synonymous codon family CGT CGC CGA CGG encodes
arginine. Two triplets of syhom codons AGA AGG also encode
arginine. This represents a real material transformation of
the coding doublets AG ---> CG, which enables the syhom AG
doublet to encode arginine along the synonymous path.
Synonymous codon family CTT CTC CAA CTG encodes leucine.
Two triplets of syhom codons TTA TTG also encode leucine.
This represents a real material transformation of the coding
doublets TT ---> CT, which enables syhom TT doublet to encode
leucine on the synonymous path.
The observed phenomena can be the cause and effect of VR-
transcoding of mRNA, and, can be manifested in codon frequency
shifts (CFS) or codon usage bias. For example, on mRNA one
of the synonymous codons of TC family can be ‘read’ depending
on mRNA context: it will be read not as encoding serine,
but virtually transcoded as part of the AG syhom family.
And consequently, during the translation, the transformation
of virtuality into reality (VR-transcoding) will take place:
and arginine (not serine) will be included into the synthesized
protein due to VR-transcoding of TC->AG families. In sequencing
of the resulting protein, we will discover substitution of serine
by arginine. This will be the evidence of TC->AG family VR-
transcoding during translation.
If we consider the possible phenomenon of codon VR-
transcoding, including synonymous codons, then CFS can be
interpreted as a function of the mRNA’s semantics (context).
Demonstrativeness of these real material two-way inter-code
information exchanges once again suggests that the path of
syhom ­> synonymous transcoding can occur virtually, i.e.
at the level of their semantics (meanings) for all encoding syhom-
synonymous doublets according to the following scheme:
one word is written but another word is understood. In general,
this real phenomenon can be signifying a warning informing
message to us about the importance of understanding the protein
code as a dynamic system of meanings, originally set by the texts
of genes at the stage of their transcription into mRNA and,
311
secondly, at the stage of their translation into semantic proteins.
We have studied such a path as a property of “delegation” of other
meanings (semantics) from mRNA to “wobbling” (according
to F. Crick) 3’-codons (syhoms) [Gariaev, Leonova-Gariaeva,
2018]. In other words, if understood generally, semantic (virtual)
transcoding of all codons takes place - both synonyms and
syhoms, triggered by mRNA texts. However, we would like to
emphasize that syhoms are obvious subjects of transcoding,
determined by the context (semantics) of mRNA. This is
something that was not noticed by the fathers of the protein code
model — F. Crick and M. Nirenberg [Cгiсk, Nierenberg,
1962,1963]. This transcoding, that we postulate, does not mean
that in such organization of genome operation, there will be
a case of a codon semantic chaos. On the contrary, such a genome
attribute provides biosystems with broad possibilities to adapt to
a volatile external environment. Perhaps, the same phenomenon
lies at the basis of Thinking and Consciousness, which are built on
the information functions of rapidly synthesized and decaying
special linguistic sign (semantic) textual proteins in the cerebral
cortex. A highly organized set of their meanings (semantics) can
represent a semantic field – the equivalent of non-material
Thinking and Consciousness with their subsequent
materialization in textual proteins. The described VR-transcoding
is a manifestation of elementary thinking and consciousness
at the genome level. Thinking and consciousness have a distinct
fractal structure [Gariaev, 2014].
The above-mentioned VR-transcoding is a manifestation
of elementary thinking and consciousness at the genome level.
This is the result of reading and understanding genes (mRNA
texts) by a protein synthesizing system. Thinking-consciousness
of this level has a hierarchy of fractal dimensions at the stage of
mRNA translation.
The smallest of them, the first dimension is represented
by the letters (nucleotides) in triplets. The significance of the first
dimension is significant: the substitution of each letter, especially
the third (wobbling one, according to F. Crick) in these codons,
plays a huge role in transforming the meanings of mRNA texts.
312
 The second level of the fractal dimension of the letters of
triplets is represented by a family of nucleotide pairs, that is,
the first and second codon letters, which in 32 synonymous
triplets redundantly but unambiguously encode amino acids.
The third letter wobbles, that is, it is not involved or is the object
of VR-transcoding.
The third level of the fractal semantic dimension of letters
in triplets is represented by the triplets of nucleotides as integral
semantic units of 32 codons-synonyms, unambiguously encoding
amino acids, already as letters of the semantic continuum
of proteins as texts. But they can also be the objects of VR-
transcoding. At the same level of fractal dimension, there are
32 syhom codons, that initially ambiguously encode amino acids
and stop positions. Syhoms become unambiguous in the process
of reading the mRNA context by ribosomes.
All three levels of fractal semantic dimensions contribute
a variety of proteins as texts, making semantic continua.
The fourth, fifth, and so on levels of codon unification as
precursors of words and sentences (texts) follow, but this occurs
only at the stage of protein translation. The fourth and
subsequent levels of fractality transcend genomes to infinite
levels of non-material, mental coding, that is, the creation of
programs of conscious behavior and communication of people
in verbal-written forms.
In this regard, there is an essential feature of genome
fractalization: shifting to higher levels of compression of their
semantic dimensions, for example, to the level of arithmetic
attributes of the genetic apparatus. In one of his works, analyzing
the quantitative ratios of the nucleon composition of the atoms
nuclei of encoded amino acids and codons of the triplet genetic
code, V.I. shCherbak suggests the presence of an arithmetic
calculus in protein biosynthesis, which is also a manifestation of
some aspects of the genome quasi-thinking. In the protein code
V.I. shCherbak discovered the system of genetic calculus and its
use of zero. shCherbak believes that this is an extremely
important circumstance, and it is difficult to disagree with him.

313
And here’s why: “Zero is a purely intellectual and extremely abstract
concept, which sets and lays the foundation for co-ordinate thinking
and consciousness, making possible quantitative measurements
of the external world. These measurements are then interpreted
by the internal organismic genetic computing consciousness.
So, digits (along with letters) become an integral part of the genetic
(protein) code.” Therefore, arithmetic control in linguistic (and/or
textual) genetics is real, as postulated by V.I. shCherbak.
Developing his ideas, V.I. shCherbak writes: “some cell
organelles should work as biocomputers. Thereby, we have to discover
the number systems with which they work.” And further: "…it seems
that the genetic code is connected more closely to abstract notions
of arithmetic than with notions of physics or chemistry."
[shCherbak, 2003].
It seems to us that these two positions of shCherbak are not
entirely accurate. The chromosomal continuum is already
a biocomputer. Probably, it is not self-sufficient and is an integral
part of cellular and tissue computing with the use of additional
cellular organelles. V.I. shCherbak considers the binary logic
of digital computing of the genome to be the determining factor
of its operation. He sees the translation of digital DNA-RNA
"understanding" into analog form only as a secondary,
subordinate path. If this is true, then, only partially.
The chromosomal continuum, as a biocomputer, has no strict
need to use only the equivalents of wealth (i.e. numbers), it works
directly with wealth itself when it is necessary to build an integral
organism, and not just synthesize proteins. But binary digital
logic is not completely abolished. It is necessary, for example,
at the moments of turning on and off protein and RNA genes,
which is also important, especially for constructing protein
“phrases” and “texts”.
At the same time, V.I. shCherbak’s research is fundamental,
it is of a paradigmic significance, for the first time giving
unambiguous mathematical proof that the protein code is a quasi-
conscious system and at the same time the result of the semantics
of the Universe. The origin of the protein code can only be

314
understood as a conscious act, but not as the result of the blind
Darwinian evolution.
Such functioning can be represented as the highest
compression of the enormous meaning of the ultimate
abstraction of the concept of zero. If applied from this position to
the work of the genomes of individual neurons, the level of
consciousness-thinking related to them has a relatively small
fractal dimension. Here, the highest dimension is probably in the
genomic continuum of neurons in the human cerebral cortex.
This occurs through the described semantic transcoding of codons
with the biosynthesis of short-living semantic proteins,
as equivalents of thinking-consciousness. In fact, this is the
embodied language of the brain genome. The same can be seen in
natural, primarily non-verbal languages. And this corresponds to
a more correct translation of the Biblical "From the first he was the
Logos" (“In the beginning was the idea/thought”). Thought
materialization occurs in speech and in writing. Genomic writing
is a textual amino acid sequence in the semantic proteins
of the human cerebral cortex. Quickly decaying, such proteins can
convert into long lasting “so-called” Schrödinger wave
holographic memory in the cerebral cortex [Nobili, 1985].
One might think that the genetic memory of protein genes is
hardware, and VR-transcoding of triplets and the entire mobile
organization of protein synthesis is software. In essence,
encoding and transcoding, act as the language of the genome.
Basically, we can say that the highest genetic code is Thinking-
Consciousness in a form of human language, and the Universal
language of DNA is a manifestation of it. This can be seen
as an antithesis to the abundance of the proposed versions of
the “second genetic codes”. Their “pandemonium”, which
Trifonov so sarcastically writes about [Trifonov, 2012], is only
a reflection of VR-transcoding of codons that do not follow
the one-dimensional logic of geneticists. Neither second nor third
genetic codes exist, including the codes of codes. There is a fractal
hierarchy of genetic languages, ascending to the top of human
natural languages as a single super-code multi-vector directive,
in which the genetic code of proteins is only one of
315
its manifestations.
On the other hand, it’s worth remembering the famous phrase
attributed to the Bible: “A thought once spoken is a lie.” The word
is a materialized otherness of a thought, idea. And here comes
an eternal question: are thoughts (words) true? For this, let’s turn
to famous V.V. Nalimov’s monograph “The Probabilistic Model
of Language”, where he proves that any word or their combination
in speech and writing always represents a certain field
of probabilistic meanings described by the Bayes-Nalimov
formula [Nalimov, 1979]. If the genetic code is the language of
the genome, then, its probability is obvious and corresponds to
VR-transcoding of triplets as a manifestation of linguistic sign
dynamics of genes and their combinations. Any violation can be
interpreted as a pathological condition of the biosystem at all
levels of the genome - from molecular to organismic and mental.
From these positions, the definition of the genetic code of
the highest fractal dimension can be refined as a continuum of
probabilistic meanings of synthesized proteins during the work of
the cerebral cortex [Gariaev, 2014].
It is the dynamics of thinking and consciousness, that requires
the use of an infinitely diverse combinatorics of transcoding
of the Code’s triplets, resulting in the protein complement
as a material reflection of Consciousness-Thinking. To some
extent, this is theoretically justified for the wobbling (according
to F. Crick) 3'-nucleotide of 32 syhom codons, [Gariaev, 2015;
Gariaev, Leonova-Gariaeva, 2018], therefore, we can assume that
this possibility is realized on all three nucleotides (letters) of all
64 codons of the Code Table.
The suggested virtual mRNA-context-dependent substitutions
of letters (nucleotides) in mRNA codons can be represented
as follows during protein biosynthesis:
1. The substitution of the first two nucleotides in the syhom
codons with any first two nucleotides from the synonymous
codons turns syhoms into any synonymous codons, which is
specified by mRNA context.

316
2. The substitution of the first two nucleotides with any first two
letters from other codon families gives the entire table of codon
semantics. Moreover, such substitutions of the second letters
in triplets are hardly noticeable, since they are virtual. They
change the meaning of the triplets, physically they remain
unchanged.
3. Substitutions of the second letters in codon families provide
the same possibilities - that is, they can represent the entire table
of codon semantic values. This also occurs virtually, non-
materially, depending on mRNA context and thus, cannot be
experimentally registered, for example, in PCR systems.
4. The substitution of the 3rd wobbling letter in codons occurs
according to the same scenario of ribosomes mRNA-dependent-
orientations and plays a key role in switching genome operation
to the mental-textual path, which is described in detail in
[Gariaev, 2015].
5. The materialization of virtual substitutions of triplets and their
letters occurs during the translation of mRNA into amino acid
textual sequences of synthesized proteins, which can be detected
by protein sequencing and checking their ‘amino acids – codons’
collinearity. The absence of some collinearity will prove
the correctness of this explanation of genome operation.
6. With respect to the 3’-nucleotide in syhom codons,
the following rule can be formulated: Syhoms, in each of their
classes, with virtual (or real - mutant, artificial) changes of their
own 3’-nucleotides are invariant in meanings programmed
by mRNA.
Thus, the verification will provide some basis to believe that
the tables of genetic codes of proteins are non-stationary,
dynamic and are determined by the meanings of mRNA (and by
delegating these meanings to the codons as to integral semantic
units and/or the 1st, the 2nd and the 3rd nucleotides). The tables
of genetic codes can and should be correctly understood only
through the dynamics of protein biosynthesis.
The hypothetical-probabilistic nature of this version of
317
genome operation is somewhat balanced by significant
experimental results that at first sight are not directly related to
transcoding manipulations in the genome. But then, there was an
article by F. Crick and M. Nirenberg [Crick, Nirenberg, 1979]
awarded with the Nobel Prize in 1968, which introduced
a universally accepted model of the protein genetic code.
The paradox is that this article describes an experiment (we would
like to note that it is a key experiment), which was not explained
in the part describing operation of the poly U-RNA matrix
encoding two different amino acids, phenylalanine and leucine.
This fact violates one of the main postulates of the canonical
model of the Code proposed by the authors - its unambiguity.
The unambiguity of the Code implies that each triplet encodes
one and only one amino acid or stop position. F. Crick and
M. Nirenberg did not explain this contradiction, saying that
the molecular nature of this phenomenon is incomprehensible to
them: “An important point to notice is that although the genetic code
has certain regularities—in several cases it is the first two bases that
encode one amino acid, the nature of the third being irrelevant—
its structure otherwise makes no obvious sense.”
This misunderstanding (which destroys the Code model) had
remained unexplained, up to the recent publications [Gariaev,
2015; Gariaev, Leonova-Gariaeva, 2018]. Another experimental
work, which voluntarily or involuntarily established the confusion
in genetics, is an article by Pruit, Lolly and co-authors, which also
demonstrated an inexplicable phenomenon [Lolle et al., 2005].
Their study demonstrated that the wild and mutant Hot Head
genes of the Arabidopsis thaliana plant, genes with the same DNA
sequences, cause different plant biomorphogenesis. This was
regarded by some biologists as a deviation from Mendelian
genetics. Finally, Turanov et al. published an article [Turanov et
al., 2009], which showed the same phenomenon of
the simultaneous coding of two different amino acids, cysteine
and selenocysteine, by a single codon of UGA in a ciliate (Euplotes
crassus infusoria). The authors once again provided an in vivo
demonstration of what F. Crick and M. Nirenberg first
demonstrated in vitro [Cгiсk, Nierenberg, 1962, 1963]. All three

318
articles have a strategic, but disguised and misunderstood logical
motive, associated with the role of the 3'-nucleotide of syhom
codons as a switch of genome Code operation into textual
semantic modes, as we mentioned above. In the case of F. Crick’s
and M. Nirenberg’s article, this was about misunderstanding of
the function of the UUU syhom codon in a form of poly-U RNA.
Its function is mRNA-oriented selection of the desired amino acid
- phenylalanine or leucine. But since poly-U RNA has no context,
there is no clear choice, therefore, both amino acids are included
in the growing peptide, which clearly violates the principle
of the Code model unambiguity.
In [Lolle et al., 2005], the situation is different. The authors of
Lolly et al. encountered a phenomenon that seems to contradict
classical Mendelian genetics. In the case of an excellent study of
the genetic code of the ciliate Euplotes [Turanov et al., 2009],
the situation is even more complicated. The genetic apparatus
of infusoria has the same task: having one triplet of UGA in
the mRNA, which encodes cysteine and selenocysteine at
the same time, it is obliged to choose only one from two different
amino acids. This occurs due an additional RNA fragment
insertion into the mRNA – a short hairpin palindrome. It is
the RNA palindrome that changes the context of mRNA, which
determines the selection of one amino acid from two different
ones. The semantic orientation of the ribosome in the context of
mRNA was used to select the desired amino acid.
This demonstrates that a hairpin palindrome can also serve
in another capacity - as a topological linguistic sign structure with
a function of signaling the selection by the ribosome of one of two
different amino acids.
Explanations of these paradoxical and incomprehensible
purely experimental results lie somewhat separately from
classical genetics. These concepts were formulated in [Gariaev,
2015; Gariaev, Leonova-Gariaeva, 2018], including the key
concept of ambiguous coding of amino acids due to the second,
homonymous, degeneracy vector of the protein code. In 1997,
this was predicted by P. Gariaev in [Gariaev, 1997].

319
 This phenomenon is about the twofold synonymous-
homonymous degeneracy of the protein Code. This automatically
stems from F. Crick’s postulate on the wobbling of the third
nucleotide (3’ nucleotide) in the syhom codons. As described
above, wobbling is virtual at the stage of mRNA transcription and
materializes into reality at the stage of mRNA translation
into proteins [Gariaev, 2015 (June); Gariaev, Leonova-Gariaeva,
2018]. In another words, it can be formulated as follows:
the genome operates in three strategic dimensions - material,
linguistic and quantum.
1. The physical/material dimension is the real genome:
chromosomal continuum and DNA.
2. The linguistic dimension is the textual-semantic content
of informational biomacromolecules - DNA (genes), mRNA
(transcriptional, textual representation of genes) and Proteins
(translational, protein-textual representation of genes). These are
three textual dialects (DNA --- RNA --- Protein), giving the same
information.
3. The quantum dimension is the non-material, wave
representation of DNA-RNA-Proteins. For example, in the form
of physical torsion fields or spintronic effects of transmission
of active quantum equivalents of genes at macro distances
[Gariaev et al., 2007]. This is an ideal (from the word “idea”)
display of the triad of DNA-RNA-Protein semantics. The quantum
dimension has an additional and essential hypothetical attribute
- nonlocality. The nonlocality of genetic information
at the quantum level is divided into two more sublevels
a) holographic nonlocality; b) nonlocality within the framework
of Einstein-Podolsky-Rosen phenomenon (EPR). The analyzed
works [Crick, Nirenberg, 1662, 1663; Lolle, 2005; Turanov A.A. et
al. 2009] contradict the F. Crick-M. Nirenberg Code model not
tactically, but strategically, since they explain and prove the role
and significance of the second synonymous-homonymous vector
of the Code degeneracy. The second vector of genome operation
transcends biosystems to endless horizons for using genes and
their protein products as textual, semantic structures.

320
 What objections can be raised to the basic idea of this article
on the virtual-real transformations of codon meanings during
protein biosynthesis, transformations that depend on
the contexts (meanings) of mRNA? The first and main objection
is massive total violations of thermodynamically substantiated
rules for pairing of codon-anticodon pairs: A-U, G-C. Though in
his work on the Wobble Hypothesis [Crick, 1966], F. Crick gave
examples of such violations: the use of inosine in tRNA
anticodon. By extrapolating this violation to all codon-anticodon
recognitions and focusing on the explanation of virtual-real
transcoding of codons, we can say the following. The biological
(informational) value of violations of the A-U, G-C rule is
significantly higher than the thermodynamic troubles arising
from this.
Other objections may be related to the problems of mutual
recognition of tRNA and aminoacyl-tRNA synthetases, which are
forced to adapt to the emerging pseudo chaos with the changed
rules of codon-anticodon pairings. But such adaptation is
inevitable, otherwise it may result in real semantic chaos. There
is also a positive point within these problems. Biosystems use
seemingly unthinkable huge amounts of tRNA, varying in
different species. It is logical to think that their numbers depend
on the mobile semantic realms of genes’ meanings, placed
in different contexts of genes due to their transpositions.
The latter can be considered as a way to realize new gene
meanings. And such cases are known: for example, the transition
of “silent” genes to “speaking” ones or a precedent of changing
the semantics of the Hot Head gene, which does not change its
sequence, but changes its morphogenetic functions [Lolle, 2005].
These are examples of the famous so-called "Gene position
effect”. And this is the same phenomenon of virtualization-
realization of codon meanings, which depends on the contextual
meaning of mRNA sequences and genes. All this sets a different
vector for working with DNA-mRNA-protein sequences. And only
now, this vector is beginning to organize our work differently.

321
 Discussion
Genetics and molecular biology abruptly transcend to a new
level of understanding of genome operation. This transcendence
is strategically determined by the real textual attributes
of the genome, which we have been trying to understand for
a long time as a nanobiocomputer operating in two main modes –
1) real (non-metaphorically) textual and 2) quantum. If we buy
this idea, many current problems of genetic coding will appear in
a clear and pragmatic form. And this means an opportunity to put
genetics, medicine, agriculture and quantum computing on
a different stable foundation. The linguistic nature, the real
textual nature of the genome, is the subject of another
consideration, begins with the Wobble Hypothesis of F. Crick,
who did not realize its consequences, being unable to understand
its substantially deeper biological meaning [Shipov, Gariaev,
2018; Gariaev, 2019]. What is this meaning about?
Let’s turn to the book of F. Crick’ memoirs. In this book he
writes in relation to his Wobble hypothesis something more
substantial than in all his previous articles: “An important point to
notice is that although the genetic code has certain regularities—
in several cases it is the first two bases that encode one amino acid,
the nature of the third being irrelevant—its structure otherwise makes
no obvious sense.”
The meaning of this phrase requires close analysis if we want
to understand the coding of proteins at the level of DNA with
respect to the 3’-nitrogen base in the syhom codon in the 3’-
5’codon-ancodon pair. The meaning of this phrase is not
unambiguous. This refers primarily to the words “... the nature of
the third being irrelevant - its structure otherwise makes no obvious
sense.” That is, if you take the “otherwise” case as the truth,
the meaning and purpose of the code becomes not obvious. But (!)
F. Crick does not use the word “incorrect” or “meaningless”
structure of the genetic code. He said, “it is not obvious”. And
the second uncertainty in these citations from F. Crick is
“in several cases, it is the first two bases that encode one amino acid”.
By the time the book was written, it was already known that this

322
was not only several cases, but the function of 32 codon-
synonyms. The second half - 32 syhom-codons remained for
F. Crick in the shadow of uncertainty. As, by the way, it remains
until now for many molecular biologists and geneticists. It is here,
where the general misunderstanding of the role of syhom-codons
and their “wobbling” 3'-nucleotides is hidden and obscured. And
the meaning that F. Crick invested into the word “wobbling” also
remains unclear. Are these the substitutions of 3’- nucleotides?
But such substitutions can only occur due to mutations that
normally do not exist. Or is it a substitution of semantic values of
3’- nucleotides in syhom-codons (as we believe)? So that these are
not the third nucleotides in the syhoms that wobble, but these are
the meanings of the 3’-nucleotides in the codons that virtually
wobble. And this wobbling is not physical, but “mental”,
dependent on the meaning of mRNA. The meaning wobbles,
similar to how in a spoken language when incorrectly pronounced
letters wobble within words – we mentally correct them, knowing
the general meaning of the pronounced phrase. This is what
the “no obvious sense” meaning of the presence of the third
wobbling nucleotide in 32 non-synonymous codons (syhoms), is
about: the coding value of this 3rd nucleotide is delegated by
the mRNA context, as an ideal construct (from the word “idea”)
[Gariaev, Leonova-Gariaeva, 2018]. This is precisely what F. Crick
and M. Nirenberg did not understand when they received
a brilliant experimental result of encoding by the UUU syhom -
codon of two different amino acids - phenylalanine and leucine.
Inside the Nobel’s model of M. Nirenberg’s genetic code, perhaps,
there was one more Nobel Prize. But they said that “The molecular
basis of this ambiguity is not known. Nor is it known if the dual coding
occurs in living systems as well as in cell free systems” [Crick,
Nirenberg, 1662, 1663]. It was in this fundamental discovery
where the explanation of the speech-likeness of protein genes was
hidden [Gariaev, 2015; Gariaev, Leonova-Gariaeva, 2018]. And
at the same time, it was referring to the mental, conscious nature
of protein genetic coding, since the choice of two different amino
acids simultaneously encoded by the syhom-codon can only be
made after reading and understanding the meaningful context of

323
the mRNA text using the ribosome as a nanobiocomputer.
This was understood only in the following studies [Gariaev, 1997,
Gariaev, Leonova-Gariaeva, 2018]. The wobbling of the 3’-
nucleotides of syhom-codons (hybrids of synonyms and
homonyms) is a strategic switch of the protein code to the text
mode of operation. The key point of such switching is found in the
fact of virtual delegation of new semantic values to the 3’-
nucleotides of syhom-codons. These meanings are set
by the contextual (semantic, non-material) contents of the given
mRNAs during their transcriptions [Gariaev, 2015 (June); Gariaev,
Leonova-Gariaeva, 2018] and are materialized at the stage of their
translation into selected in this way amino acids and/or protein
biosynthesis is stopped. Here, the most subtle and significant
factor is the context-sensitive-mRNA-dependent quasi-conscious
choice of one amino acid from two different ones with
undetermined double coding of them by syhom-codons. Or the
choice of the “stop meaning” of the syhom-codon. De facto,
the second syhom-degeneracy of the protein code was
experimentally proved in the methodically brilliant work of
Turanov et al. [Turanov et al., 2009]. But they failed to point out
the value of this phenomenon. In this predominantly theoretical
study, we attempt to develop the idea of a larger significance of
F. Crick's original thoughts expressed by him in [Crick, 1966]
regarding the wobbling 3’-nucleotide in the syhom-codons.

324
BIBLIOGRAPHY.
Adleman L.M. Molecular Computation of Solutions to Combinatorial
Problems. The first DNA computing paper. Describes a solution for
the directed Hamiltonian path problem. Science. 1994; 266 (11):
1021–1024
Agaltsov A.M., Gariaev P.P., Gorelik V.S., Rakhmatullaev I.A., Scheglov
V.A. Two-photon-excited luminescence in genetic structures. Quantum
Electronics. 1996; 23 (2): 181-184 (In Russian)
Albada P. van, Lagendijk A. Observation of Weak Localization of Light
in a Random Medium. Phys. Rev. Lett. 1985; 55: 2692-2695
Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K. and Walter, P.
Molecular biology of the cell. 2nd edition. Garland Publishing, Inc.
1989
Aleksandrov S.A. Incoherent method of obtaining holograms. Optics
and spectroscopy. 1998; 85 (6):1029-1032 (In Russian)
Allison S.A., Sorlie S.S., Pecora R. Brownian Dynamics Simulations of
Wormlike chains: Dynamics Light Scattering from 2311 Base Pair DNA
Fragments. Macromolecules. 1990; 23: 1110-1118
Application for the grant of a patent to the Federal Institute of
Industrial Property of Russia from October 20, 2005. Registration
number 2005132403. Incoming number 036308 (In Russian)
Artyukh V.D., Gariaev P.P., Kokaya A.A., Leonova-Gariaeva E.A.,
Muldashev E.R., Mukhina I.V., Smelov M.V., Tovmash A.V., Chalkin
S.F., Shatrov Y.K., Yaguzhinsky L.S. The effect of laser induced
resistance of animals to alloxan. 2007.
http://www.trinitas.ru/rus/doc/0016/001b/00161365.htm (In Russian)
Baklanova E.A., Uraev D.V., Schmalgauzen V.I. Dynamics of
polarization holographic recording in films of azo-containing
polymers. Moscow University Bulletin. Physics. Astronomy. 2005; 3:
20-26 (In Russian)
Beklemishev V.N. Methodology of systematics. KMK Ltd SCIENTIFIС
PRESS (to the manuscript of 1928). Moscow. 1994; 128. (In Russian)
Bell J.S. Einstein-Podolsky-Rosen Experiments. Proceed. Symp. on
Frontier Problems in High Energy Physics, Pisa. 1976; 33-45
Bell J.S. On the Einstein-Podolsky-Rosen Paradox. Physics. 1964;

325
1:195-200
Bennet C.H., Brassard G., Crepeau C., Jossa R., Peres A., Wootters W.K.
Teleporting and unknown quantum state via dual classical and
Einstein-Podolsky-Rosen channels. Phys. Rev. Lett. 1993; 70: 1895-
1899
Berezin A.A. Physical and mathematical model of a neuron based on
the Fermi-Pasta-Ulam return phenomenon for the development of
fundamentally new high-capacity memory elements. Information
Technologies. Engineering. 1997; 5: 29-35 (In Russian)
Berezin A.A., Gariaev P.P. Simulation of electroacoustic radiation of
DNA as a carrier of bioinformation. 2nd International Symposium
"Mechanisms of Action for Ultra-Low Radiation Doses, Moscow. 1995;
122 (In Russian)
Berezin A.A., Gariaev P.P., Gorelik V.S., Reshetniak S.A., Shcheglov
V.A. Is it possible to create laser based on information
biomacromolecules? Laser Physics. 1996; 6 (6): 1211-1213
Berezin A.A., Gariaev P.P., Reshetniak S.A., Shaitan K.V., Shcheglov
V.A. To the problem of possible development at a biolaser working on
Frolich modes. Preprint of The Physical Institute named after P.N.
Lebedev. 1996; 49: 12 (In Russian)
Berezin A.V., Kurochkin Yu.A., Tolkachev E.A. Quaternions in
relativistic physics. M., URSS. 1995 (In Russian)
Berkovich S.Y. On the «barcode» functionality of the DNA, or
The phenomenon of Life in the physical Universe. 2001;
http://arxiv.org/abs/physics/0111093
Bersuker I.B. Electronic structure and properties of coordination
compounds. Leningrad: Chemistry. 1976 (In Russian)
Biebricher C.K., Eigen M., Luce R. Product analysis of RNA Generated
de novo by Qb Replicase. J. Mol. Biol. 1981; 148: 369-390
Biebricher C.K., Luce R. Template-free generation of RNA species that
replicate with bacteriophage T7 RNA polymerase. The EMBO Journal.
1996; 15(13): 3458-3465
Bischof M. Biophotonen. Das Licht in unseren Zellen. Printed in
Germany. ISBN 3-86150-095-7. ZWEITAUSENDEINS. 1995; 522 (In
German)
Blagodatskikh V.I., Gariaev P.P., Leonova E.A., Maslov, M.Yu., Shaitan
326
K.V., Shcheglov V.A. On the dynamics of dislocations in a DNA
molecule. Brief messages on physics. Physical Institute of RAS. 1996;
3-4: 9-14. (In Russian)
Blagodatskikh V.I., Gariaev P.P., Maslov M.Yu., Reshetnyak S.A.,
Scheglov V.A. Interaction of coherent electromagnetic radiation with
biomacromolecules. Part 1. Laser Physics. 1996; 6 (4): 621-653 (In
Russian)
Boltyansky V.G., Efremovich V.A. Visual topology. Moscow: Science.
1982; 84 (In Russian)
Boren K., Hafman D. Absorption and scattering of light by small
particles. Moscow: Mir. 1986; 77 (In Russian)
Bouwmeester D., Pan Jian-Wei, Mattle K., Eibl M., Weinfurter H.,
Zeilinger A. Experimental quantum teleportation. Nature. 1997; 390:
575-579
Brandner S., Isenmann S., Raeber A., Fisher M., Sailer A., Kobayshi Y.,
Marino S., Weissmann C., Aguzzi A. Normal host prion protein
necessary for scrapie-induced neurotoxity. Nature. 1996; 379: 339-343
Buchachenko A.L. Radio emission and other magnetic effects in
chemical reactions. Moscow: Knowledge. 1979 (In Russian)
Budagovsky A.V. Remote cell-to-cell interaction. Moscow: NSLC
TECHNOLOGY. 2004; 103 (In Russian)
Budagovsky A.V. Translation of genetic information through coherent
electromagnetic fields. Problems of intensification of modern
gardening. Michurinsk. 1990; 172-174 (In Russian)
Budagovsky A.V., Evseeva R.P. Experimental model of remote
transmission of morphogenetic information in the system of two plant
tissues with different potencies for differentiation. Mechanisms of
action of ultra-low doses. Abstracts of the 11th International
Symposium, Moscow. 1995; 124-125 (In Russian)
Budagovsky A.V., Evseeva R.P., Muratova S.A. The use of a hologram of
a differentiated organ for the induction of morphogenesis in
the culture of callus tissue of fruit plants. In vitro plant biology,
biotechnology and preservation of the gene pool. Abstracts of
the International Conference, Moscow. 1997; 79 (In Russian)
Budagovsky A.V., Turovtseva N.I., Budagovsky I.V. Coherent
electromagnetic fields in remote cell-to-cell interaction. Biophysics.

327
2001; 46 (5): 894-900 (In Russian)
Bueler H., Aguzzi A., Sailer A., Greiner R.A., Autenried P., Aguet M.,
Weissmann C. Mice devoid of PrP are resistent to scrapie. Cell. 1993;
73: 1339-1347
Burlakov A.B., Burlakova O.V., Golichenkov V.A. Distant interactions of
different-age loach embryos. Proceedings of The Russian Academy of
Sciences (RAS). 1999; 368(4):562-564 (In Russian)
Burlakov A.B., Burlakova O.V., Golichenkov V.A. Distant wave
interactions in the early misgurnus fossilis L. loach embryogenesis.
2000 (In Russian)
Chetverin A.B., Chetverina H.V., Munishkin A.V. On the Nature of
Spontaneous RNA Synthesis by Qb Replicase. J.Mol.Biol. 1991; 22: 3-9
Choudhury G.K., Kejariwal P.C., Chattopadhyay A. The devices for
generation of phantom leaf effect. J. Inst. Eng. (India). 1979; 60(3): 61-
66
Chukova Yu. P. Effects of low-level exposure. Moscow: Ales. 2002
Codes. 2000.
http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi
Crick F.H.C. 1989. What mad pursuit. A personal view of scientific
discovery. Basic Books, Inc., Publishers. New York
Crick F.H.C. 2004. A personal View of Scientific Discovery. Basic Books,
Inc., Publishers, New York.
Crick F.H.C. Codon-anticodon pairing: the wobble hypothesis. 1966;
19: 548-555
Cгiсk F.H., Nierenberg Marshall W., The Genetic Code, I—II, Scientific
American 1962; 207(4): 66 and 1963; 208 (3): 80
Davydov A.S. Solitons in molecular systems. Kiev: Naukova Dumka.
1984; 288 (In Russian)
Denisyuk Yu.N. On the representational properties of traveling
intensity waves while recording dynamic volume holograms.
The Journal of Technical Physics. 1974; 44 (1):131-136 (In Russian)
Dirac P.A.M. Proceed. of the Royal Society of London. 1930.
Du Praw E.J. DNA and Chromosomes. Holt, Rinehart & Winston, New
York. 1970

328
Ehrlicher A., Betz T. Stuhrmann B. , Koch D. , Milner V. , Raizen M. G. ,
and Käs J. . Guiding neuronal growth with light. Proc. Natl. Acad. Sci.,
USA. 2002; 99 (25): 16024–16028. DOI: 10.1073/pnas. 252631899
Einstein A., Podolsky B., Rosen N. Can quantum-mechanical
description of physical reality be considered complete? Phys. Rev.
1935; 47: 777-780
Elsanowski A., Ostell J. The Genetic Codes. National Center for
Biotechnology Information (NCBI). Betseda. MD. 1996; 16 (Internet)
Fermi E., Pasta J., Ulam. Studies of nonlinear problems. Technical
Report, USA. 1955; DOI: 10.2172/4376203
Fox T.D., Natural variation in the genetic code. Ann. Rev. Genet. 1987;
21: 67-91
Frolich H. Neurosci. Res. Programm. Bull. 1977; 15: 67-72
Frolich H. Phys. Lett. 1968; 26A: 402
Frolich H. Phys. Lett. 1972; 29A: 153-154
Frolich H. Proc. Natl. Acad. Sci., USA. 1975; 72: 4211-4215
Gariaev P.P. Another Understanding of the Model of Genetic Code
Theoretical Analysis. Open Journal of Genetics. 2015; 5: 92-109.
http://dx.doi.org/10.4236/ojgen.2015.52008
Gariaev P.P. Der wellengenetische Code. Tattva Viveka. 2003; 20: 68-73
(In German)
Gariaev P.P. DNA as source of new kind of God «knowledge». Act &
Facts. 1994; 12: 7-11
Gariaev P.P. Epigenetic role of extracellular matrices. Code hierarchy
hypothesis. Inter-republican correspondence scientific and technical
seminar "The use of lasers in science and technology". Irkutsk: Branch
of the Institute of Laser Physics of RAS. 1996; 8: 85-107 (In Russian)
Gariaev P.P. Fractality of the intellect. 2014.
https://ss69100.livejournal.com/. (In Russian)
Gariaev P.P. Genetic apparatus as a wave control system. International
scientific-practical conference "Analysis of systems at the threshold of
the 21st century", Moscow. 1996; 69-78 (In Russian)
Gariaev P.P. Linguistic-Wave Genome: Theory and Practice. Institute of
Quantum Genetics, Kyiv. 2009; 218. (In Russian)

329
http:www.wavegenetic.ru/Petr_Gariaev.pdf
Gariaev P.P., Linguistic-Probabilistic and Quantum Understanding of
Gene Operation. Open Journal of Genetics 09(03):43-64. DOI:
10.4236/ojgen.2019.93004
Gariaev P.P. On the nature of reflexology. Modern concepts of primary
mechanisms of acupuncture and acupressure. Inter-republican
correspondence scientific and technical seminar "The use of lasers in
science and technology". Irkutsk: Branch of the Institute of Laser
Physics of RAS. 1996; 8: 188-206 (In Russian)
Gariaev P.P. Review of scientific data on the availability of complete
information on the canonical model of genetic coding. New Medical
Technology / New Medical Equipment. 2008; 1: 30-49. (In Russian)
Gariaev P.P., The Code of the God. Linguistic-Wave Genetics. Moscow:
“Conceptual” Publishing House. 2017; 112. (In Russian)
Gariaev P.P. The crisis of genetics and the genetics of the crisis.
Russian thought. Moscow: Public Benefit. 1994; 1-6: 46-49 (In Russian)
Gariaev P.P. The Wave Genome. Moscow: RAS, Public Benefit. 1994;
279 (In Russian)
Gariaev P.P. Wave genetic code. Moscow: Publishing Center. 1997; 107
(In Russian)
Gariaev P.P. Wave Information Properties of Living Systems.
Holographic aspect. Inter-republican correspondence scientific and
technical seminar "The use of lasers in science and technology".
Irkutsk: Branch of the Institute of Laser Physics of RAS. 1996; 8: 137-
159 (In Russian)
Gariaev P.P. et al. Materialization of DNA Fragment in Water through
Modulated Electromagnetic Irradiation. DNA Decipher Journal.May
2014; 4(1):1-2
Gariaev P.P., Birshtein B.I., Iarochenko A.M., Marcer P.J., Tertyshniy
G.G., Leonova K.A., Kaempf U. The DNA-wave biocomputer. «CASYS»,
International Journal of Computing Anticipatory Systems (ed.
D.M. Dubois). Liege, Belgium. 2001; 10: 290-310.
https://pdfs.semanticscholar.org/da69/1b1e01a358abee378338d414329
14069ccba.pdf
Gariaev P.P., Chudin V.I., Komissarov G.G., Berezin A.A., Vasiliev A.A.
Holographic Associative Memory of Biological Systems. Proceedings

330
SPIE, The International Society for Optical Engineering. Optical
Memory and Neural Networks. USA. 1991; 1621: 280-291
Gariaev P.P., Garber M.R., Leonova E.A. Virtual prion genome.
Friedman readings. All-Russian Scientific Conference, Perm. 1998:
140-142 (In Russian)
Gariaev P.P., Garber M.R., Leonova E.A., Tertyshny G.G. On the
question of the central dogma of molecular biology. Soznanie i
fizicheskaya realnost [Consciousness and Physical Reality]. 1996; 4(1):
34-46. (In Russian)
Gariaev P.P., Kaznacheev V.P., Vasilyev A.A., Berezin A.A. Soliton-
holographic genome with a collectively-symmetric genetic code.
Preprint of the USSR Academy of Medical Sciences. The Institute of
Clinical and Experimental Medicine. 1990; 50. (In Russian)
Gariaev P.P., Kokaya A.A., Leonova-Gariaeva E.A., Muldashev E.R.,
Mukhina I.V., Smelov M.V., Tertyshny G.G., Tovmash A.V.,
Yaguzhinsky L.S. Theoretical models of wave genetics and reproduction
of wave immunity in the experiment. New Medical Technologies, New
Medical Equipment. 2007; 11: 26-70. (In Russian)
Gariaev P.P., Kokaya A.A., Mukhina I.V., Leonova-Gariaeva E.A.,
Kokaya N.G. Effect of electromagnetic radiation modulated by
biostructures on the course of alloxan diabetes mellitus in rats. Bulletin
of Experimental Biology and Medicine. 2007; 2: 155-158 (In Russian)
Gariaev P.P., Leonova E.A. Genetic apparatus as a wave control system.
International Scientific and Practical Conference "Analysis of Systems
at the Threshold of the XXI Century: Theory and Practice". 1996; 69-78
(In Russian)
Gariaev P.P., Leonova E.A. New genetic code model. Collection of
scientific papers of The Academy of Medical and Technical Sciences of
the Russian Federation. Department "Biotechnical systems and
education" at MSTU named after N.E. Bauman. 1996; 1: 25-34 (In
Russian)
Gariaev P.P., Leonova E.A. Revision of the genetic code model.
FOLIUM: Consciousness and Physical Reality. 1996; 1(1-2): 73-84 (In
Russian)
Gariaev P.P., Leonova-Gariaeva E.A. The Syhomy of the Genetic Code Is
the Path to the Real Speech Characteristics of the Encoded Proteins.
Open Journal of Genetics. 2018; 8 (2). DOI: 10.4236/ojgen.2018.82003

331
Gariaev P.P., Macedonian S.N., Leonova E.A. Biocomputer on genetic
molecules as a reality. Information Technology. 1997; 5: 42-46 (In
Russian)
Gariaev P.P., Maslov M.Yu., Reshetnyak S.A., Scheglov V.A. Model of
the interaction of electromagnetic radiation with information
biomacromolecules. Brief Communications in Physics, Physical
Institute RAS. 1996; 1-2: 60-63 (In Russian)
Gariaev P.P., Maslov M.Yu., Reshetnyak S.A., Shcheglov V.A.
Interaction of electromagnetic radiation with information
biomacromolecules. "Antenna" model. Brief messages on physics.
Physical Institute of RAS. 1996; 1-2: 54-59 (In Russian)
Gariaev P.P., Maslov M.Yu., Shaitan K.V., Shcheglov V.A. On the effect
of the non-linearity of the bonds between neighboring nucleotides on
the propagation dynamics of conformational perturbations/excitations
in DNA molecules. Brief messages on physics. Physical Institute of
RAS. 1997; 3-4: 3-8. (In Russian)
Gariaev P.P., Poltavtseva R.A., Leonova-Gariaeva E.A., Voloshin L.L.,
Dobradin A. Practical Application of Linguistic Wave Genetics (LWG).
Principle in Creating Quantum Information Matrices (QIM) used for
Programming Plain Liquids into Medically Active Liquids, called
Quantum Information Matrix Programmed Liquids (QIMPL). Clinical
Epigenetics. 2017; 3:22. https://clinical-
epigenetics.imedpub.com/what-is-the-basis-of-the-technology-of-
liquid-quantum-informationmatrices-lqim-and-other-practical-
applications-of-linguisticwave.pdf DOI: 10.21767/2472-1158.100056
Gariaev P.P., Prangishvili I.V., Tertyshny G.G., Maksimenko V.V.,
Mologin A.V., Leonova E.A., Muldashev E.R. Spectroscopy of the radio
wave radiation of localized photons: the yield on quantum non-local
bioinformation processes. Sensors and Systems. 2000; 9: 2-13 (In
Russian)
Gariaev P.P., Prangishvili I.V., Tertyshny G.G., Mologin A.V., Leonova
E.A., Muldashev E.R. Genetic structures as a source and receiver of
holographic information. Sensors and Systems. 2000; 2: 2-8 (In
Russian)
Gariaev P.P., Prangishvili I.V., Tertyshny G.G., Mologin A.V., Leonova
E.A., Muldashev E.R. Three-dimensional model of processes of
endogenous holographic management of the development of the
spatial structure of biosystems. Sensors and Systems. 2001; 1: 3-8 (In

332
Russian)
Gariaev P.P., Shabelnikov A.V. Tertyshny G.G. Spectra of human speech
and DNA. Sensors and Systems. 2001; 12: 2-4 (In Russian)
Gariaev P.P., Tertyshniy G.G. The quantum nonlocality of genomes as
a main factor of the morphogenesis of biosystems. 3th Scientific and
medical network continental members meeting, Potsdam, Germany.
1999; 37-39
Gariaev P.P., Tertyshny G.G. Priority on a patent of 06/01/1999, No.
99/01 / L, Federal Institute of Industrial Property. PCT Receiving Office
Group. Starfield, LTD (In Russian)
Gariaev P.P., Tertyshny G.G. The phenomenon of the transition of light
to radio waves in relation to biosystems. Collection of scientific papers
of The Academy of Medical and Technical Sciences of Russian
Federation. Department "Biotechnical systems and education" at MSTU
named after N.E. Bauman. 1997; 2: 31-42 (In Russian)
Gariaev P.P., Tertyshny G.G., Gotovsky Yu.V. Transformation of light
into radio waves. 3rd International Conference "Theoretical and clinical
aspects of the use of adaptive resonance and multiresonance therapy".
Moscow: IMEDIS. April 18-20, 1997; 303-313 (In Russian)
Gariaev P.P., Tertyshny G.G., Gotovsky Yu.V., Leonova E.A.
Holographic and quantum genome nonlocality. 5th International
conference “Theoretical and clinical aspects of the use of bioresonance
and multiresonance therapy". Moscow: IMEDIS. 1999; 256-272 (In
Russian)
Gariaev P.P., Tertyshny G.G., Leonova E.A., Maksimenko V.V. Wave
antiviral immunity. 2000 (In Russian)
Gariaev P.P., Tertyshny G.G., Loshchilov V.I., Scheglov V.A., Gotovsky
Yu.V. The Transition of Laser Light to Radio Frequency
Electromagnetic Radiation. Collection of Scientific Papers of
The Academy of Medical and Technical Sciences of Russian Federation.
Department "Biotechnical systems and education" at MSTU named
after N.E. Bauman. 1997; 2: 31 (In Russian)
Gariaev P.P., Tertyshny G.G., Tovmash A.V. Experimental in vitro
studies on the holographic mapping and transfer of DNA in
combination with the information surrounding it. New Medical
Technologies. 2007; 9: 42-53. (In Russian)
Gariaev P.P., Vasiliev A.A., Berezin A.A. Holographic associative
333
memory and information transmission by solitary waves in biological
systems. SPIE, The International Society for Optical Engineering, CIS
Selected Papers, Coherent Measuring and Data Processing Methods and
Devices. 1994; 1978: 249-259
Gariaev P.P., Vlasov GP, Poltavtseva RA, Voloshin LL, Leonova
Gariaeva EA. Attempt to regenerate the dog’s tooth using the method
of a new direction in biology‒Linguistic‒Wave Genetics. Institute of
Quantum Genetics (LLC), Russia. MedCrave. 2018. DOI:
10.15406/jsrt.2018.04.00123
Gariaev P.P., Vnuchkova V.A., Shelepina G.A., Komissarov G.G. Verbal-
semantic modulations of Fermi-Pasta-Ulam resonances as a
methodology for entering the command-like structure of the genome.
Journal of Russian Physical Thought. 1994: 1-4: 17-28 (In Russian)
Gariaev, P. P., Vladychenskaya, I. P. & Leonova-Gariaeva, E. A., PCR
Amplification of Phantom DNA Recorded as Potential Quantum
Equivalent of Material DNA. DNA Decipher Journal. 2016; 6 (1): 1-11
Goldman E., Rosenberg A.H., Zubay G., Studier F.W. 1995. Consecutive
low-usage leucine codons block translation only when near the 5' end
of a message in Escherichia coli. J.Mol.Biol. 1995 Feb 3;245(5): 467-73
https://www.ncbi.nlm.nih.gov/pubmed/7844820
Gotovsky Yu.V., Komissarov G.G., Gariaev P.P. New methods of
diagnosing diseases on the seven main acupuncture points (chakras)
and equipment for implementation. 2nd International Conference
"Theoretical and clinical aspects of bioresonant and multiresonant
therapy". Moscow: Center for Intellectual Medical Systems, “IMEDIS”.
1996; 164-169 (In Russian)
Gurvich A.G. Selected works. Moscow. 1977; 351. (In Russian)
Hagerman P. J. and B. H. Zimm. Monte Carlo approach to the analysis
of the rotational diffusion of wormlike chains. Biopolymers. 1981; 20:
1481–1502
Hunter N. Prion disease and the central dogma of molecular biology.
Trends in microbiology. 1999; 7(7): 265-266
Jan van Duin. The bacteriophages. Chapter 4. Single-Stranded RNA
Bacteriophages. Ed. Callendar R. Plenum Press, New York-London.
1998; 133-135
Jiang Kanzhen. Bio-ultra high frequency connection. A collection of
articles on non-tradition aspects оf natural science. Siberian Scientific
334
Research Centre of Anomalous Environmental Phenomena. Tomsk.
1992; 1
Jiang Kanzhen. Experiments with AURAS (Bioelectromagnetic Fields).
Chiang Kanzhen (NEXUS). New Times Magazine (USA-Canadian
Edition). 1995-1996; 3(1)
Jiang Kanzhen. The anti-senility effect of the young plant’s biotic field
on the aged mice. Zheng Qian, Jiang Kanzhen, Fаn Shudua, et al.
Journal of China Medical University, 1994; 23 (6)
http://en.cnki.com.cn/Article_en/CJFDTOTAL-ZGYK406.000.htm
Jiang Kanzhen. The conclusion of the broadened seminar on Jiang
Kanzhen’s report (the conclusion made by the Soviet Academy of
Sciences. Soviet Academy of Medical Sciences, Siberian Branch
of The Soviet Academy of Agricultural Sciences). 1999 (a); ‘Znanie-Sila’
Magazine. Moscow. (In Russian)
Jiang Kanzhen. The device to transmit natural information nutrition to
a biological object «Biotron Tszyan – 2». 1995; Russian Patent №
2090013: Device «Biotron Tszyan -2» for transmiting a natural
information supply to a biological object. Geneva International Patent
№ Wo 96/41872, 1996; Chinese Patent № CN 1194666A, 1998;
EUROPEAN PATENT APPLICATION 96927965.2
Jiang Kanzhen. The health care and anti-ageing effect of the
bioelectromagnetic field emitted by plant seedlings on human beings.
Jiang Kanzhen, Zheng Qian, Tang Binghuan. Gold Award by the
Canadian International Medical Achievements. International medical
achievements classics. Hong Kong Sci-Teck United Press. 1999 (b)
Jiang Kanzhen. The method to change organism’s heredity’s and
the device to transmit biological information. 1981. Soviet Union
Patent №1828665.
Jiang Kanzhen. The method to rejuvenate organisms. 1991. Russian
Patent № 2057808
Jiang Kanzhen. The rejuvenation application of bioelectromagnetic
field and its detection; Jiang Kanzhen, Zheng Qian, Tang Binghuan.
A collection of paper abstracts. The 3 National Seminar on Modern
Biophysical Technologies held by the Chinese Society for Biophysics,
Zhangjiajie, Hunan. 2000.
Josephson B.D., Pallikari-Viras F. Biological Utilisation of Quantum
Non-Locality. Foundation of Physics. 1991; 21: 197-207

335
Kabat Е. A. et al. Sequence of Immunoglobulin Chains. US Department
of Health Education and Welfare. 1977
Kadomtsev B.B. Dynamics and information. Moscow: Editors of the
journal "Uspekhi Fizicheskikh Nauk" [‘The Success of Natural Science”].
1999; 400 (In Russian)
Kawabe Y., Wang L., Nakamura T. and Ogata N. Thin-film lasers based
on dyedeoxyribonucleic acid-lipid complexes. Chitose Institute of
Science and Technology. Chitose, Hokkaido 006-8655, Japan. 2002.
Appl. Phys. Lett. 81, 1372; DOI: 10.1063/1.1501164, Issue Date: 19
August 2002
Kaznacheev V.P., Mikhailova L.P. Bioinformation function of natural
electromagnetic fields. Novosibirsk. 1985 (In Russian)
Kaznacheev V.P., Shurin S.P., Mikhailova L.P. Invention № 122. Distant
cell-to-cell interactions in the system of two tissue cultures. Official
bulletin for inventions and discoveries at Ministry Council of the USSR.
1973; №19 (In Russian)
Khesin, R. B., Genome inconsistency. Moscow: “Nauka”. 1984; 472. (In
Russian)
Kirkin A.F. Non-chemical distant interactions between cells in the
culture. Biophysics. 1981; 26 (5): 839-843 (In Russian)
Korneev A.A., Gariaev P.P. Some Aspects of Wave Gene Transmission.
DNA Decipher Journal. 2015; 5
Lagerkvist U. «Two out of Three»: an alternative method for codon
reading. Proc. Natl. Acad. Sci., USA. 1978; 75: 1759-1762
Lemons D., McGinnis W. Genomic Evolution of Hox Gene Clusters.
Science. 29 September, 2006; 313 (5795): 1918 – 1922
Lolle S.J., Victor J.L., Young J.M., Pruitt R.E. Genome-wide non-
mendelian inheritance of extra genomic information in Arabidopsis.
Nature. 2005; 434: 505-509
Lyubishchev A.A. On the nature of hereditary factors. Moscow:
"Prometheus". 1925; 120. (In Russian)
Lushnikov A.A., Maksimenko V.V.,.Simonov A.J. Electromagnetic
Surface Modes in Small Metallic Particles, in Electromagnetic Surface
Modes. Ed. by A.D.Boardman, J. Wiley, Chichester. 1982; 305-345
Mae-Wan Ho. Dance of life. Resurgence. January/February 2003; 216.

336
http://www.resurgence.org/resurgence/issues/ho216.htm
Maksimenko B.B., Krikunov V.A., Lushnikov A.A. Strong localization of
light in close-packed granular media. The Journal of Experimental and
Theoretical Physics. 1992; 102: 1571 (In Russian)
Maksimenko V.V. Antoine’s Localization of Photon inside Fractal
Cluster, Fractal in Engineering. Delft, Netherlands. 1999; 355-358
Maksimenko V.V. Localization of Light in Fractal Cluster. Journal of
Aerosol Science. 1999; 30: 291
Maksimenko V.V. Localization of Photon between Pair of Particles-1.
Elastic Scattering. Journal of Aerosol Science. 1999; 30: 287
Maksimenko V.V. Localization of Photon between Pair of Particles-2.
Inelastic Scattering. Journal of Aerosol Science. 1999; 30: 289
Mantegna R.N., Buldyrev S.V., Goldberger A.L., Havlin S., Peng S.-K.,
Simons M. and Stanley H.E. Linguistic Features of Noncoding DNA
Sequences. Phys. Rev. Lett. 1994; 73(23): 3169-3172
Maslov M.U., Gariaev P.P. Fractal Presentation of Natural Language
Texts and Genetic Code. 2nd International Conference on Quantitative
Linguistics «QUALICO-94», September 20-24, Lomonosov Moscow
State University, Philological Faculty. 1994; 193-194
Matsumoto M., Sakaguchi T., Kimura H., Doi M., Minagava K.,
Matsuzava Y., Yoshikava K. Direct observation of brownian motion of
macromolecules by fluorescence microscope. J. Polimer Sci.B. 1992; 30:
779-783
Mazur A.I., Grachev V.N. Electrochemical indicators. Moscow: Radio
and communication. 1985 (In Russian)
Miller R. A., Webb. B. Embryonic Holography. Psychoenergetic
Systems. Ed. Stanley Krippner, presented at the Omniversal
Symposium, California State College at Sonoma, September 29.
Reprinted in Lyttle's Journal Psychedelic Monographs and Essays. 1993;
6: 137-156.
http://www.nwbotanicals.org/oak/newphysics/Helix%20to%20Hologra
m.pdf
Miller R.A. The Holographic Paradigm and the Consciousness
Restructuring Process, Chaosophy. OAK Publishing, Inc. Oregon, USA.
1993.
Mills D.R., Peterson R.L., Spiegelman S. An extracellular Darwinian
337
experiment with a self-duplicating nucleic acid molecule. Proc. Natl.
Acad. Sci., USA. 1967; 58: 217-224
Molchanov A.A. The effect of light intercellular interactions on the
intensity of protein extrusion of the secretory cells of the mammary
gland. Bulletin of Leningrad State University, Biology. 1985; 3 (1); 70-
74 (In Russian)
Mosolov A.N. The genetic apparatus of eukaryotes as a single dynamic
structure. From the book: “Successes of Modern Genetics”. Moscow.
1980; 9: 184-202 (In Russian)
Muldashev E.R. Combined eye transplantation. Ministry of Health of
the Russian Federation, Ufa, All-Russian Center for Ophthalmic and
Plastic Surgery "Alloplant". 2000 (In Russian)
Munishkin A.V., Voronin L.A., Ugarov V.I., Bondareva L.A., Chetverina
H.V., Chetverin A.B. Efficient Templates for Qb Replicase are Formed
by Recombination from Heterologous Sequences. J.Mol.Biol. 1991; 221:
463-472
Nalimov V.V. A probabilistic model of language. Monograph.
The Science. Moscow. 1979; 303. (In Russian)
Nalimov V.V. In the labyrinths of language: a mathematician's journey.
Philadelphia, PA.: ISI-Press. 1981: 246
Nalimov V.V. Spontaneity of consciousness. Probabilistic theory of
meanings and semantic architectonics of personality. Moscow:
Prometheus. 1989; 287 (In Russian)
Nobili R. Schrödinger wave holography in brain cortex. Phys Rev A Gen
Phys. 1985 Dec; 32(6): 3618-3626. DOI: 10.1103/physreva.32.3618
Olovnikov A.M. Molecular mechanism of morphogenesis: the theory of
location DNA (review). Biochemistry. 1996; 61(11): 1948-1970 (In
Russian)
Prangishvili I.V. Systems approach and system-wide laws. Moscow:
SINTEG. 2000 (In Russian)
Prangishvili I.V., Anuashvili A.N., Maklakov V.V. Regularities in
the manifestation of the mobility of an object. Collection of works of
the RAS Institute of Management Problems. Moscow. 1993; 1: 7-10. (In
Russian)
Prangishvili I.V., Gariaev P.P., Tertyshny G.G., Leonova E.A., Mologin
A.V., Garber M.R. Genetic structures as a source and receiver of
338
holographic information. Sensors and Systems. 2000; 2: 2-8 (In
Russian)
Prangishvili I.V., Gariaev P.P., Tertyshny G.G., Maksimenko V.V.,
Mologin A.V., Leonova, E.A., Muldashev E.R. Spectroscopy of the radio
wave radiation of localized photons: the yield on quantum non-local
bioinformation processes. Sensors and Systems. 2000.; 9(18): 2-13 (In
Russian)
Pribram K.H., Nuwer M. & Baron R. The holographic hypothesis of
memory structure in brain function and perception. In: R.C. Atkmson,
D.H. Krantz, R.C. Luce & P. Suppes (eds). Contemporary Developments
in Mathematical Psychology. San Francisco: W.H. Freeman & Co. 1974;
416-467
Priority on a patent in accordance with the international application
for invention No. 99/01 / L of 01/06/1999 (In Russian)
Prusiner S.B. (ed.) Prions, Prions, Prions. Springer press. 1996.
Reshetnyak S.A., Shcheglov V.A., Blagodatskikh V.I., Gariaev P.P. and
Maslov M.Yu. Mechanism of interaction of electromagnetic radiation
with a biosystem. Laser Physics. 1996; 6 (2): 621-653
Rouse P E. A theory of the linear viscoelastic properties of dilute
solutions of coiling polymers. J. Chem. Phys. 1953; 21: 1272-80
Rumer Yu.B., Translation of Systematization of Codons in the Genetic
Code [III]. 1969. DOI: 10.1098/rsta.2015.0448
Sakaguchi S., Katamine S., Okada H., Hasegava S., Miyamoto T., Noda
T. Loss of cerebral Purkinje cells in aged mice homozigous for a
disrupted PrP gene. Nature. 1996; 380 (6574): 528-531
Scheglov V.A., Gariaev P.P. Laser-laser interactions and phantom
effects in genetic structures. Proceedings of the international scientific
conference "Science on the threshold of the XXI century - new
paradigms." 1996; 7
Shabalina S.A., Spiridonov N.A. The mammalian transcriptome and
the function of noncoding DNA sequences. Genome Biology. 2004; 5:
105
Shcherbak V.I. Arithmetic inside the universal genetic code.
Biosystems. 2003; 70: 187–209
Shipov G.I. The theory of physical vacuum: New paradigm. Moscow:
Science and Technology Center. 1993; 362
339
Shipov G.I., Gariaev P.P. Quantum genome in terms of the physical
vacuum. Moscow: “Conceptual”. Publishing House. 2018; 152. (In
Russian)
Smelov M.V. Electromagnetic vacuum solitons. Part 4. Preliminary
experimental studies based on the model of electromagnetic solitons.
Moscow State University, Physical Thought of Russia. 2001; 1; 38 (In
Russian)
Solomonik A. Semiotics and linguistics. Moscow. 1995; 345 (In Russian)
Soviet encyclopedic dictionary. Moscow: Soviet Encyclopedia. 1980;
442 (In Russian)
Spiegelman S., Haruna I., Holland I.B., Beaudreau G., Mills D.R.
The synthesis of a self-propagating and infectious nucleic acid with
a purified enzyme. Proc. Natl. Acad. Sci., USA. 1965; 54: 919-927
Spinoza B. Ethics. 1677 (In Russian)
Steele E., Lindley R., Blandan R. What if Lamarck is right?
Immunogenetics and evolution. Moscow: World. 2002; 237 (In Russian)
Stephen Ross, Richard Newton, Yu-Ming Zhou, Julian Haffegee, Mae-
Wan Ho. Quantitative Image Analysis of Birefringent Biological
Material. J. of Microscopy. 1997; 187: 62-67
Sumper M., Luce R. Evidence for De Novo Production of Self-
Replicating and Environmentally Adapted RNA Structures by
bacteriophage Qb Replicase. Proc. Natl. Acad. Sci., USA. 1975; 72: 162-
166
Ter-Avanesyan M.D., Inge-Vechtomov S.G. Genetic control of protein
synthesis. Leningrad State University. 1988; 294 (In Russian)
Tertyshny G.G., Gariaev P.P. Wave genetic nanotechnologies for
biosystem management. Theory and experiments. New Medical
Technologies. 2007; 7: 49-64. (In Russian)
http:www.wavegenetics.jino-net.ru/zip/New_tec-7-2007.zip
Tertyshny G.G., Gariaev P.P., Aksenov V.A., Leonova E.A., Fomchenkov
S.V. Formalism of endogenous polarization-holographic control
processes in organisms. Consciousness and physical reality. 2004; 9(4):
44-50 (In Russian)
Tertyshny G.G., Gariaev P.P., Roslov V.N. “The method of analysis of
physical objects and the device for its implementation” No. 99/01/L of
01/06/1999. The priority of the international application. (In Russian)
340
Tertyshny G.G., Getmanov V.G., Dyatlov A.V., Zhirov M.V. The use of
local and spline approximations for estimating non-stationary
parameters of opto-electronic signals. Automation and Remote
Control. 2000; 6: 29-35
Tertyshny G.G., Getmanov V.G., Kuznetsov P.A. Application of
approximation algorithms in a laser computer vibrometer. Measuring
Equipment. 1997; 7: 34-37
Tertyshny G.G., Getmanov V.G., Kuznetsov P.A. Laser computer
vibrometer. Abstracts of the International Workshop "Vibrodiagnostics
in industry". Moscow: “Spectr”. 1998; 237-243
Thomas G.G. On Permutographs. Supplemento ai Rendiconti del
Circolo Matematico di Palermo. 1982; Serie II (2): 275-286
Trifonov E. Pandemonium of the Second Genetic Codes. Troitsky
Variant (trv-science.ru 2012; 95: 13. https://trv-
science.ru/2012/01/17/stolpotvorenie-vtorykh-geneticheskikh-kodov/.
(In Russian)
Trubnikov B.A., Gariaev P.P. Does the "speech" of DNA molecules look
like computer programs? Nature. 1995; 1: 21-32
Turanov A.A. et al. Genetic Code Supports Targeted Insertion of Two
Amino Acids by One Codon. Science. 2009; 323, 259. DOI:
10.1126/science.1164748
Tuszinski J.A., Paul R., Chatterjee R, Sreenivasan S.R. Relationship
between Frolich and Davidov models of biological order. Physical
Review. 1984; 30 (5): 2666-2675
Weiss S., Porske D., Neumann M., Groschap M.H., Kretzschmar H.A.,
Famulok M., Winnacker E-L. RNA aptamers specifically interact with
the prion protein PrP. Journal of Virology. 1997; 71 (11): 8790-8797
Wolpert L. Positional information and pattern formation. Curr. Top.
Biol. Dev. 1971; 6: 183-224
Zimm B H. Dynamics of polymer molecules in dilute solution:
viscoelasticity, flow birefringence and dielectric loss. J. Chem. Phys.
1956; 24: 269-78.

341
342
ABOUT THE AUTHOR.

Peter Gariaev (born February 1,

1942) Dr of Biological Sciences,
Academician of the Academy of
Natural Sciences and Russian Academy
of Medical and Technical Sciences,
Acad. of The International Academy of
Ecology and Life Safety, Member of
The New York Academy of Sciences.
Peter Gariaev is known as the father of the wave genome
scientific theory. For many years he was a Senior Researcher
in the Russian Academy of Sciences. Founder of several
commercial and non-profit organizations: CJSC Institute of Wave
Biology and Medicine, LLC Institute of Quantum Genetics, Wave
Genetics Inc. (in Canada), The International Wave Genome Center
(Luxemburg). Currently Chairman of the Board of the Scientific
Enterprise "Biology of the 21st Century."
In Russia, the discoveries of Peter Gariaev caused a resonance
and are being actively debated by scientists. The works of Peter
Gariaev are published in Russian and international press. This
monograph ‘Quantum Consciousness of The Linguistic-wave
genome. Theory and Practice’ represents the collection of his best
works.

343
344
Peter Gariaev

Quantum Consciousness
of Linguistic-Wave Genome

THEORY AND PRACTICE

Institute of Quantum Genetics

Cover design by Victoria Merki

345
346