Tumor Biol.

DOI 10.1007/s13277-015-3232-6

RESEARCH ARTICLE

Celecoxib sensitizes gastric cancer to rapamycin via inhibition

of the Cbl-b-regulated PI3K/Akt pathway
Yubo Cao & Jinglei Qu & Ce Li & Dan Yang & Kezuo Hou &
Huachuan Zheng & Yunpeng Liu & Xiujuan Qu

Received: 22 September 2014 / Accepted: 5 February 2015

# International Society of Oncology and BioMarkers (ISOBM) 2015

Abstract Mammalian target of rapamycin (mTOR) has
emerged as a new potential therapeutic target for gastric can-
cer. However, a phase III clinical trial found that monotherapy
with the mTOR inhibitor everolimus did not significantly im-
prove the overall survival of patients with advanced gastric
cancer. This has led to the exploration of more effective com-
binatorial regimens to enhance the effectiveness of mTOR
inhibitors. Here, we demonstrate that Akt phosphorylation is
increased in the rapamycin-resistant gastric cancer cell lines
MGC803 and SGC7901. We further show that combined
treatment with celecoxib and rapamycin results in an additive
inhibitory effect on the growth of gastric cancer cells through
suppression of rapamycin-induced Akt activation. Moreover,
celecoxib upregulated the expression of the ubiquitin ligase
casitas B-lineage lymphoma-b (Cbl-b). Knockdown of Cbl-b
significantly attenuated celecoxib-mediated inhibition of Akt
phosphorylation and impaired the additive anticancer effect of
Electronic supplementary material The online version of this article
(doi:10.1007/s13277-015-3232-6) contains supplementary material,
which is available to authorized users.
Y. Cao : J. Qu : C. Li : K. Hou : Y. Liu (*) : X. Qu (*)
Department of Medical Oncology, The First Hospital of China
Medical University, NO.155, North Nanjing Street, Heping District,
Shenyang 110001, People’s Republic of China
e-mail: cmuliuyunpeng@hotmail.com
e-mail: qu_xiujuan@hotmail.com
Y. Cao
Department of Medical Oncology, The Fourth Hospital of China
Medical University, Shenyang 110032, China
D. Yang
Department of Pharmacology, Shenyang Medical College,
Shenyang 110034, China
H. Zheng
Department of Biochemistry and Molecular Biology, College of
Basic Medicine, China Medical University, Shenyang 110001, China
celecoxib and rapamycin. Our results suggest that celecoxib-
mediated upregulation of Cbl-b is responsible, at least in part,
for the additive antitumor effect of celecoxib and rapamycin
via inhibition of rapamycin-induced Akt activation.
Keywords Cbl-b . PI3K/Akt pathway . Gastric carcinoma .
Celecoxib . COX-2 . mTOR inhibitor
Introduction
Gastric cancer remains a leading cause of cancer-related
deaths worldwide [1]. Most patients are diagnosed at an
advanced stage and the 5-year survival rate is less than
10 % [2, 3]. At present, there is no globally accepted
standard chemotherapeutic regimen for the treatment of
patients with advanced gastric cancer [4]. However, recent
studies indicate that targeted therapy has great potential
therapeutic value for the management of advanced gastric
cancer. Trastuzumab has recently been recommended for
the treatment of human epidermal growth factor receptor
2-positive advanced gastric cancer [5]. Additionally, agents
targeting the mammalian target of rapamycin (mTOR) are
currently undergoing clinical trials.
Given its central role in the regulation of cell growth, pro-
liferation, and survival, the phosphatidylinositol 3 kinase
(PI3K)-related serine/threonine kinase mTOR represents a po-
tential molecular target for anticancer therapy [6]. mTOR ex-
ists as two functionally distinct complexes, mTORC1 and
mTORC2. Rapamycin-sensitive mTORC1 regulates messen-
ger ribonucleic acid (mRNA) translation by activating ribo-
somal p70S6 kinase (p70S6K) and inhibiting the translational
repressor eIF4E-binding protein 1 [7]. Rapamycin-insensitive
mTORC2 phosphorylates the serine-473 residue of Akt to

promote Akt activation [8, 9]. mTOR inhibitors such as
rapamycin and its derivative everolimus have been shown to
exhibit potent preclinical anticancer activities in gastric cancer
both in vitro and in animal models [10, 11]. Phase I/II clinical
trials have shown that everolimus is well tolerated and exhibits
promising efficacy in the treatment of patients with advanced
gastric cancer [12, 13]. However, a recently published phase
III clinical trial reported that everolimus monotherapy did not
significantly improve the overall survival of patients with ad-
vanced gastric cancer who had been previously treated with
one or two lines of systemic chemotherapy when compared
with best supportive care [14]. Therefore, there is a need to
understand the mechanisms underlying drug resistance and
also to develop alternative treatment strategies for gastric
cancer.
Activation of Akt under conditions of mTOR inhibition is
tightly associated with development of cell resistance to
rapamycin [15]. He et al. have reported that resveratrol can
enhance the antitumor activity of rapamycin in breast cancer
cell lines by suppressing rapamycin-induced Akt activation
[16]. Furthermore, Ji et al. have reported that the Akt inhibitor
MK-2206 could overcome everolimus resistance in PTEN-
mutant gastric cancer cells [17]. However, these agents have
not been widely subjected to clinical trials in cancer therapy.
Therefore, we investigated whether combining rapamycin
with conventional and low-toxicity Akt-suppressing drugs
could improve therapeutic efficacy. Celecoxib is a new-
generation non-steroidal anti-inflammatory drug (NSAID)
that selectively inhibits COX-2 activity without inhibiting
COX-1, and therefore, does not induce the side-effects associ-
ated with traditional NSAIDs [18]. Previous studies have dem-
onstrated that celecoxib possesses anticancer effects attributable
to inhibition of Akt signaling [19, 20]. Recently, Chen et al.
reported that celecoxib could enhance the sensitivity of lung
cancer cells to the EGFR-tyrosine kinase inhibitor ZD1839 by
suppressing Akt signaling [21]. Furthermore, celecoxib en-
hanced the anti-proliferative response of estrogen-dependent
breast cancer cells to nimotuzumab through downregulation
of p-Akt expression [22]. However, whether celecoxib can
sensitize gastric cancer cells to rapamycin by suppressing
Akt signaling remains unclear.
Regulation of the Akt signaling pathway is affected by
many factors, among which ubiquitin ligase casitas B-
lineage lymphoma-b (Cbl-b) is an important negative regula-
tor [23, 24]. Cbl-b is an E3 ubiquitin ligase that ubiquitinates
tyrosine kinase receptors and other signaling proteins,
resulting in their downregulation [25]. Previous studies have
identified that Cbl-b proteins interact with the p85-regulatory
subunit of PI3K, resulting in PI3K ubiquitination and degra-
dation [26]. However, a role for Cbl-b in celecoxib-induced
antitumor activity has not yet been identified.
We have investigated the mechanisms underlying the resis-
tance of human gastric cancer cells to mTOR inhibition and
Tumor Biol.
the potential utility of celecoxib for overcoming rapamycin
resistance in gastric cancer cells. We reveal that celecoxib
sensitizes human gastric cancer cells to rapamycin by
inhibiting rapamycin-induced Akt activation. Additionally,
celecoxib-mediated upregulation of Cbl-b is responsible, at
least in part, for this inhibition of the PI3K/Akt pathway in
gastric cancer cells.
Materials and methods
Reagents and antibodies
3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bro-
mide (MTT) and dimethylsulphoxide (DMSO), LY294002
were from Sigma-Aldrich (St. Louis, MO, USA). Celecoxib
was obtained from Sigma-Aldrich (St. Louis, MO, USA).
Rapamycin were purchased from Sigma-Aldrich (St. Louis,
MO, USA). Antibodies against Cbl-b and β-actin were pur-
chased from Santa Cruz Biotechnology (Santa Cruz, CA,
USA). Antibodies against mTOR and phospho-mTOR,
p70S6K and phospho-p70S6K, Akt and phospho-Akt, and
COX-2 were obtained from Cell Signaling Inc. (Beverly,
MA, USA).
Cells and cell culture
Gastric cancer MGC803 and SGC7901 cell lines were ob-
tained from the Type Culture Collection of the Chinese
Academy of Sciences (Shanghai, China). The cells were
cultured in Roswell Park Memorial Institute (RPMI) 1640
medium (GIBCO, Gaithersburg, MD, USA) containing
10 % foetal bovine serum (FBS), penicillin (100 U/mL),
and streptomycin (100 mg/mL) at 37 °C in an atmosphere
of 95 % air and 5 % CO2.
Cell viability assay
The effects of celecoxib and rapamycin on cell proliferation
were measured using the 3-(4,5-dimethyl thiazol-2-yl)-2,5-
diphenyl tetrazolium bromide (MTT) assay. Cells were seeded
at 5,000–1,0000/well in 96-well plates and incubated over-
night; various concentrations of test agents were then added
and incubation continued for 48 or 72 h. Thereafter, 20 μL of
MTT solution (5 mg/mL) was added to each well and the
cells incubated for a further 4 h at 37 °C. After removal
of the culture medium, cells were lysed in 200 μL of
DMSO and the optical density (OD) was measured at
570 nm using a microplate reader (Bio-Rad, Hercules,
CA, USA). Change in percentage viability was calculated
using the formula: cell viability=(OD of the experimental
sample/OD of the control group)×100 %.
Tumor Biol.
Western blotting
The cells were washed twice with ice-cold phosphate-buffered
saline (PBS), lysed in lysis buffer (1 % Triton X-100, 50 mM
Tris–Cl, pH 7.4, 150 mM NaCl, 10 mM EDTA, 100 mM NaF,
1 mM Na3VO4, 1 mM PMSF, and 2 μg/mL aprotinin) and
quantified with Lowry method. Cell lysate proteins were sepa-
rated to SDS-PAGE electrophoresis then transferred to a nitro-
cellulose membrane (Immoblin-P, Millipore, Bedford, MA,
USA). After the membranes were blocked with 5 % skim milk
in TBST buffer (10 mM Tris–HCl pH 7.4, 150 mM NaCl, 0.1 %
Tween 20) at room temperature for 2 h, the blots were incubated
with indicated antibodies overnight at 4 °C. After washing three
times with TBST buffer, the membrane was incubated with
secondary antibodies for 30 min at room temperature. Finally,
proteins were detected with enhanced chemiluminescence
reagent (SuperSignal Western Pico Chemiluminescent
Substrate; Pierce, Rockford, IL, USA) and visualized with
the Electrophoresis Gel Imaging Analysis System (DNR
Bio-Imaging Systems, Jerusalem, Israel).
Clonogenic assay
Cells were seeded at 200 cells/well in 12-well plates and treat-
ed with either 100 nM rapamycin or 10 mM LY294002 or
30 μM celecoxib, or co-treatment with rapamycin and
LY294002 or celecoxib after plating for 24 h in 10 % FBS
medium. Cells were allowed to grow for additional 14 days.
Followed by staining with Wright Giemsa, the number of
colonies was counted.
Reverse-transcription-polymerase chain reaction (RT-PCR)
MGC803 and SGC7901 cells either treated or untreated with
celecoxib were cultured and harvested at the indicated time.
Cell pellets were washed twice with ice-cold PBS and total
RNA extracted with the RNeasy mini kit (Qiagen, Carlsbad,
CA, USA) as described by the manufacturer. RT-PCR was
performed with primer pairs for Cbl-b: forward (5′-CCGG
TTAAGTTGCACTCGAT-3′) and reverse (5′-CAAAGGGG
TCCACGATTATG-3′) and for actin as a control: forward
(5′-GTGGGGCGCCCCAGGCACCA-3′) and reverse
(5′-CTCCTTAATGTCACGCACGATTTC-3′). PCR con-
ditions were 95 °C for 5 min; 30 cycles of 95 °C for
30 s, 59 °C for 30 s, and 72 °C for 30 s; and one cycle
of 72 °C for 7 min. The amplifed products were then
separated on 1.5 % agarose gels, stained with ethidium
bromide and visualized under UV illumination.
RNA interference stable infection
The method of plasmid construction is discussed in our pre-
vious study [23]. MGC803 cells were transfected with short
hairpin RNA (shRNA) targeting Cbl-b using lipofectamine
2000 reagent (Invitrogen, USA), according to the manufac-
turer’s instructions. After 48 h, stably transfected cell lines
were selected by 0.4 mg/mL active G418 (Invitrogen, USA).
The expression of Cbl-b was verified by the Western blot with
anti-Cbl-b antibody.
Small interfering RNA transfections
Cbl-b small interfering RNA (siRNA) was obtained from
Shanghai GeneChem Co. Ltd (China). Cbl-b siRNA was syn-
thesized: 5′-GGAUGUGUUUGGGACUAAUTT-3′ (sense).
The control sequence was: AATTCTCCGAACGTGTCACG
T. The cells were transiently transfected with Cbl-b siRNA
using Lipofectamine 2000 reagent (Invitrogen, USA), accord-
ing to the manufacturer’s instructions.
Statistical analysis
Data were confirmed in three independent experiments and
were expressed as the mean ± standard deviation (S.D.).
Differences between groups were evaluated by Student’s t test.
SPSS 16.0 computer software (SPSS Inc., Chicago, IL, USA)
was used for statistical analysis and P<0.05 was considered
statistically significant.
Results
Rapamycin-induced Akt activation was responsible
for rapamycin resistance in MGC803 and SGC7901 gastric
cancer cells
We assessed the effect of rapamycin on cell survival in the
human gastric cancer cell lines MGC803 and SGC7901 by
performing an MTT assay 72 h after rapamycin treatment.
Over 70 % of cells remained viable following exposure to
up to 1,000 nM rapamycin (Fig. 1a). This indicated that both
cell lines were resistant to rapamycin.
To investigate the mechanism of resistance to rapamycin in
MGC803 and SGC7901 cells, we measured protein expres-
sion levels of p-mTOR, p-p70S6K, and p-Akt following
rapamycin treatment. In both MGC803 and SGC7901 cell
lines, p-mTOR and p-p70S6K levels decreased within 8 h of
exposure to rapamycin, and this decrease was sustained for up
to 24 h. Concurrently, p-Akt levels increased within 8 h of
exposure to rapamycin, and this increase was apparent up to
24 h after treatment (Fig. 1b). We also examined the effects of
rapamycin on the protein expression levels of p70S6K, Akt,
and mTOR and found that rapamycin did not alter their
expression.
To further explore whether the activation of Akt is respon-
sible for rapamycin resistance in MGC803 and SGC7901

Fig. 1 Akt activation was associated with development of cell resistance
to rapamycin in MGC803 and SGC7901 gastric cancer cells. a MGC803
or SGC7901 cells were treated with various concentrations of rapamycin
(1–1,000 nM) for 72 h. Cell viability was determined by MTT assay. b
MGC803 or SGC7901 cells were treated with 100 nM rapamycin for 8,
16, or 24 h; the phosphorylation status of mTOR and Akt was analyzed
by Western blotting. c MGC803 or SGC7901 cells were treated with or
without the PI3K inhibitor LY294002 (25 mM) for 1 h before the addition
gastric cancer cells, we blocked PI3K/Akt signaling
with a PI3K-specific inhibitor (LY294002) and then ex-
posed cells to rapamycin. Treatment with LY294002
prior to rapamycin exposure diminished rapamycin-
induced Akt phosphorylation in both MGC803 and
SGC7901 cells (Fig. 1c). Rapamycin (100 nM) inhibited
cell growth by 15.70 ± 2.97 % and 20.22 ± 2.84 % in
MGC803 and SGC7901 cells, respectively (Fig. 1d).
However, a combination of rapamycin and LY294002
significantly increased the level of growth inhibition
(41.17 ± 3.00 % and 49.57 ± 2.92 % in MGC803 and
SGC7901 cells, respectively; P < 0.01). The effect of
the drugs in combination was greater than the inhibitory
effects caused by each agent alone, indicating an addi-
tive effect. Collectively, these results indicate that
rapamycin-induced Akt activation was associated with
rapamycin resistance in both MGC803 and SGC7901
gastric cancer cells.
Tumor Biol.
of 100 nM of rapamycin for 24 h. The phosphorylation status of mTOR
and Akt was analyzed by Western blotting. d MGC803 or SGC7901 cells
were treated with or without LY294002 (25 mM) for 1 h before the
addition of 100 nM of rapamycin for 72 h. Cell survival was determined
by MTT assay. Results from three independent experiments are shown.
Student’s t test, **P<0.01 for the comparisons between the groups as
indicated
Celecoxib sensitized gastric cancer cells to rapamycin
by inhibiting rapamycin-induced Akt phosphorylation
We next examined the effect of celecoxib alone and in com-
bination with rapamycin on the survival of MGC803 and
SGC7901 cells. An MTT assay conducted 72 h after exposure
to celecoxib revealed a dose-dependent inhibitory effect upon
cell survival in both cell lines. The 50 % inhibitory concen-
tration of celecoxib was 47.25±6.43 μM in COX-2-negative
MGC803 cells and 43.53 ± 5.12 μM in COX-2-positive
SGC7901 cells (Fig. 2a, b). To assess whether celecoxib sen-
sitized gastric cancer cells to rapamycin, we incubated
MGC803 and SGC7901 cells with rapamycin (100 nM),
celecoxib (40 μM), or both for 72 h. Co-treatment with
celecoxib enhanced the anti-proliferative response to
rapamycin in both MGC803 and SGC7901 cells (Fig. 2c).
Colony formation assays confirmed that both celecoxib and
LY294002 enhanced the sensitivity of gastric cancer cells to
Tumor Biol.
Fig. 2 Celecoxib enhanced the anti-tumor activity of rapamycin in
gastric cancer cell lines by suppressing rapamycin-induced Akt
signaling. a The protein expression levels of COX-2 in MGC803 or
SGC7901 cells were analyzed by Western blotting. b MGC803 or
SGC7901 cells were treated with various concentrations of celecoxib
(10–60 μM) for 72 h. Cell viability was determined by MTT assay.
Results from three independent experiments are shown. Student’s t test,
*P<0.05, **P<0.01, and ***P<0.001 for the comparisons between
celecoxib-treated and vehicle-treated group. c MGC803 or SGC7901
cells were treated with rapamycin (100 nM) and/or celecoxib (40 μM)
rapamycin (Fig. 2d). Collectively, these results reveal that
treatment with a combination of rapamycin and celecoxib
can inhibit growth of gastric cancer cells.
To elucidate whether celecoxib sensitizes gastric cancer
cells to rapamycin by suppressing rapamycin-induced Akt
phosphorylation, we treated MGC803 and SGC7901 cells
with rapamycin (100 nM), celecoxib (40 μM), or both for
24 h, and measured p-Akt levels by Western blotting. Levels
of p-Akt protein were significantly reduced in celecoxib-
treated cells exposed to rapamycin compared with control
cells or those treated with rapamycin alone (Fig. 2e). These
results indicate that celecoxib sensitized MGC803 and
SGC7901 cells to rapamycin by suppressing rapamycin-
induced Akt phosphorylation..
Celecoxib upregulated Cbl-b expression in MGC803
and SGC7901 cells
We next measured levels of Cbl-b to determine whether it is
involved with celecoxib-mediated Akt deactivation.
for 72 h. Cell viability was determined by MTT assay. Results from three
independent experiments are shown. Student’s t test, **P<0.01 for the
comparisons between the groups as indicated. d Clonogenic assay to
determine the long-term effects of a combination of 100 nM rapamycin
and 10 mM LY294002 or 30 μM celecoxib on the growth of MGC803 or
SGC7901 cells after 14 days of treatment. e MGC803 or SGC7901 cells
were treated with rapamycin (100 nM) and/or celecoxib (40 μM) for 24 h;
the phosphorylation status of mTOR and Akt was analyzed by Western
blotting
Treatment with celecoxib alone significantly increased Cbl-b
protein levels within 8 h of exposure to celecoxib, and this
increase was evident up to 24 h after treatment (Fig. 3a).
Combined treatment with celecoxib and rapamycin also up-
regulated Cbl-b to a similar level (Fig. 3b). Furthermore, RT-
PCR analysis showed that Cbl-b mRNA expression was in-
creased following treatment with celecoxib (Fig. 3c). These
results suggest that celecoxib-mediated Akt deactivation
might be at least in part triggered by upregulation of Cbl-b
protein.
Celecoxib-mediated Cbl-b upregulation enhanced sensitivity
of MCG803 and SGC7901 cells to rapamycin
Next, Cbl-b gene expression in MGC803 and SGC7901 cells
was inhibited by treatment with shRNA and siRNA to deter-
mine whether Cbl-b was responsible for the impaired Akt
phosphorylation following celecoxib treatment. Repression
of Cbl-b resulted in increased levels of Akt phosphorylation,
whereas control had no effect on p-Akt levels (Fig. 4a). These
 Tumor Biol.

Fig. 3 Celecoxib increased Cbl-b

protein levels. a MGC803 or
SGC7901 cells were treated with
40 μM Celecoxib for 8, 16, or
24 h; the protein expression level
of Cbl-b was analyzed by Western
blotting. b MGC803 or SGC7901
cells were treated with rapamycin
(100 nM) and/or celecoxib
(40 μM) for 24 h; the protein
expression level of Cbl-b was
analyzed by Western blotting. c
MGC803 or SGC7901 cells were
treated with 40 μM celecoxib for
8, 16, or 24 h; the mRNA
expression level of Cbl-b was
analyzed by RT-PCR. Actin was
used as an internal control. M
indicated marker

results suggest that Cbl-b downregulated the levels of p-Akt.
Furthermore, combination treatment with celecoxib and
rapamycin following knockdown of Cbl-b expression demon-
strated that knockdown of Cbl-b attenuated celecoxib-
mediated Akt deactivation (Fig. 4b). Compared with controls,
combined treatment with celecoxib and rapamycin signifi-
cantly attenuated growth inhibition by 26.01±3.81 % and
36.69±2.82 % in MGC803 and SGC7901 cells, respectively
(P<0.05; Fig. 4c). These results suggest that upregulation of
Cbl-b protein, at least in part, contributed to the additive effect
of celecoxib and rapamycin on cell growth inhibition.
Discussion
The mTOR inhibitors temsirolimus and everolimus have been
approved for the treatment of patients with metastatic renal
cell carcinoma [27, 28]. However, monotherapy with mTOR
inhibitors often yields only modest therapeutic activity in ad-
vanced gastric cancer [14], and the emergence of drug resis-
tance may ultimately limit the utility of mTOR inhibitors [15].
Our present data and those from others [17] indicate that gas-
tric cancer cells are resistant to rapamycin. We detected in-
creased levels of p-Akt in rapamycin-resistant MGC803 and
SGC7901 cells following rapamycin exposure. Moreover,
inhibition of Akt signaling increased cell sensitivity to
rapamycin, consistent with previous findings from Ji et al.
[17]. These results suggest that Akt activation is critical for
the development of rapamycin resistance in gastric cancer
cells.
Combinatorial cancer therapies can provide a more syner-
gistic anticancer effect and less systemic toxicity than the use
of a lone therapeutic agent [29, 30]. Recent studies have dem-
onstrated that celecoxib can enhance the antitumor activity of
rapamycin in malignant melanoma and angiosarcoma cell
lines [31, 32]. However, the mechanisms underlying this ef-
fect were not elucidated. Suppression of COX-2 activity has
been identified as the mechanism responsible for the chemo-
preventive effects of NSAIDs [30, 33]. However, more recent
reports have suggested that celecoxib may exert antitumor
activities through COX-2-independent mechanisms [30, 34].
To address this, we treated COX-2 over-expressing SGC7901
and COX-2-deficient MGC803 cell lines with celecoxib and
measured effects on cell survival. Celecoxib inhibited prolif-
eration in a dose-dependent manner in both cell lines, consis-
tent with the findings of Cho et al. who performed similar
experiments using the gastric cancer cell lines AGS and
MKN-45 [35]. Furthermore, the growth inhibitory effects of
combined celecoxib and rapamycin were similar in both cell
lines. This finding suggests that the additive anticancer effect
Tumor Biol.
Fig. 4 Celecoxib-mediated Cbl-b upregulation enhanced the antitumor
activity of rapamycin in MGC803 and SGC7901 cells. a MGC803 cells
were stably transfected with control shRNA or Cbl-b shRNA. The control
shRNA and Cbl-b.shRNA MGC803 cells were untreated or treated with
100 nM rapamycin and/or 40 μM celecoxib for 48 h. Cell survival was
determined by MTT assay. Results from three independent experiments
are shown. Student’s t test, *P<0.05 for the comparisons between two
arms as indicated. b SGC7901 cells were transiently transfected with
control siRNA or Cbl-b siRNA. At 48 h after transfection, the cells were
of combined celecoxib and rapamycin therapy is at least
partially mediated by a COX-2-independent pathway.
Given that recent studies have identified the Akt signaling
pathway as a major COX-2-independent target of
celecoxib [19, 20], we further investigated the role of this
pathway in mediating the anticancer effect of celecoxib
and rapamycin. We found that celecoxib significantly re-
pressed rapamycin-induced Akt phosphorylation in both cell
lines. Together, these results demonstrate that celecoxib can
sensitize gastric cancer cells to rapamycin by suppressing Akt
signaling, at least in part, independently of its COX-2 inhibi-
tory function.
The mechanisms by which celecoxib suppresses Akt phos-
phorylation in the proposed COX-2-independent pathway are
not fully understood. Previous studies identified
phosphoinositide-dependent kinase (PDK)-1 as a direct target
of celecoxib [36]. However, more recent studies have found
that celecoxib can induce apoptosis in mouse embryonic stem
treated with the combination of 100 nM rapamycin and 40 μM celecoxib
for 48 h. Cell survival was determined by MTT assay. Results from three
independent experiments are shown. Student’s t test, *P<0.05 for the
comparisons between two arms as indicated. c, d After the transfection,
MGC803 or SGC7901 cells were untreated or treated with 100 nM
rapamycin and/or 40 μM celecoxib for 24 h. The protein expression
levels of Cbl-b and the phosphorylation status of mTOR and Akt were
analyzed by Western blotting
cells lacking the PDK1 gene [37]. This indicates that other
factors may be involved in the celecoxib-mediated suppres-
sion of Akt phosphorylation. Recent studies by us and others
have shown that Cbl-b is a negative regulator of the PI3K/Akt
pathway [23, 26]. Additionally, we have demonstrated that
Cbl proteins can regulate the sensitivity of gastric and breast
cancer cells to treatment with a combination of tumor necrosis
factor-related apoptosis-inducing ligand and interferon-α or
bufalin [38, 39]. Therefore, we investigated whether Cbl-b is
involved in the suppression of Akt phosphorylation in gastric
cancer cells exposed to celecoxib. To the best of our knowl-
edge, this is the first report of Cbl-b upregulation by celecoxib.
Moreover, knockdown of Cbl-b attenuated celecoxib-
mediated inhibition of Akt signaling, which partially
abolished the additive anticancer effect of celecoxib and
rapamycin. Together, these results suggest that Cbl-b upregu-
lation contributes to the additive anticancer effect of celecoxib
and rapamycin in gastric cancer cells.

We demonstrate that celecoxib can sensitize human gastric
cancer cells to rapamycin by inhibiting rapamycin-induced
Akt signaling. Furthermore, celecoxib upregulates Cbl-b pro-
tein expression, which likely plays a role in this celecoxib-
mediated Akt deactivation and sensitization to rapamycin.
These results have important implications for the design of
future combination therapies for gastric cancer treatment in-
volving rapamycin.
Acknowledgments This research was supported by the following
grants: National Natural Science Foundation of China (nos. 81372546,
81372547, and 81372485), Science and Technology Project of Liaoning
Province (no. 2012225001), and Science and Technology Plan Project of
Liaoning Province (no. 2011404013-1).
Conflicts of interest None
References
1. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global
cancer statistics. CA Cancer J Clin. 2011;61:69–90.
2. Wagner AD, Grothe W, Haerting J, Kleber G, Grothey A, Fleig WE.
Chemotherapy in advanced gastric cancer: a systematic review and
meta-analysis based on aggregate data. J Clin Oncol. 2006;24:
2903–09.
3. Power DG, Kelsen DP, Shah MA. Advanced gastric cancer–slow but
steady progress. Cancer Treat Rev. 2010;36:384–92.
4. Menges M, Hoehler T. Current strategies in systemic treatment of
gastric cancer and cancer of the gastroesophageal junction. J
Cancer Res Clin Oncol. 2009;135:29–38.
5. Bang YJ, Van Cutsem E, Feyereislova A, Chung HC, Shen L, Sawaki
A, et al. ToGA Trial Investigators. Trastuzumab in combination with
chemotherapy versus chemotherapy alone for treatment of HER2-
positive advanced gastric or gastro-oesophageal junction cancer
(ToGA): a phase 3, open-label, randomised controlled trial. Lancet.
2010;376:687–97.
6. Al-Batran SE, Ducreux M, Ohtsu A. mTOR as a therapeutic target in
patients with gastric cancer. Int J Cancer. 2012;130:491–6.
7. Fingar DC, Richardson CJ, Tee AR, Cheatham L, Tsou C, Blenis J.
mTOR controls cell cycle progression through its cell growth effec-
tors S6K1 and 4E-BP1/eukaryotic translation initiation factor 4E.
Mol Cell Biol. 2004;24:200–16.
8. Sarbassov DD, Ali SM, Sengupta S, Sheen JH, Hsu PP, Bagley AF,
et al. Prolonged rapamycin treatment inhibits mTORC2 assembly
and Akt/PKB. Mol Cell. 2006;22:159–68.
9. Gupta M, Ansell SM, Novak AJ, Kumar S, Kaufmann SH, Witzig
TE. Inhibition of histone deacetylase overcomes rapamycin-mediated
resistance in diffuse large B-cell lymphoma by inhibiting Akt signal-
ing through mTORC2. Blood. 2009;114:2926–35.
10. Fuereder T, Jaeger-Lansky A, Hoeflmayer D, Preusser M, Strommer
S, Cejka D, et al. mTOR inhibition by everolimus counteracts VEGF
induction by sunitinib and improves anti-tumor activity against gas-
tric cancer in vivo. Cancer Lett. 2010;296:249–56.
11. Shigematsu H, Yoshida K, Sanada Y, Osada S, Takahashi T, Wada Y,
et al. Rapamycin enhances chemotherapy-induced cytotoxicity by
inhibiting the expressions of TS and ERK in gastric cancer cells. Int
J Cancer. 2010;126:2716–25.
12. Lim T, Lee J, Lee DJ, Lee HY, Han B, Baek KK, et al. Phase I trial of
capecitabine plus everolimus (RAD001) in patients with previously
treated metastatic gastric cancer. Cancer Chemother Pharmacol.
2011;68:255–62.
Tumor Biol.
13. Yoon DH, Ryu MH, Park YS, Lee HJ, Lee C, Ryoo BY, et al. Phase II
study of everolimus with biomarker exploration in patients with ad-
vanced gastric cancer refractory to chemotherapy including
fluoropyrimidine and platinum. Br J Cancer. 2012;106:1039–44.
14. Ohtsu A, Ajani JA, Bai YX, Bang YJ, Chung HC, Pan HM, et al.
Everolimus for previously treated advanced gastric cancer: results of
the randomized, double-blind, phase III GRANITE-1 study. J Clin
Oncol. 2013;31:3935–43.
15. Carew JS, Kelly KR, Nawrocki ST. Mechanisms of mTOR inhibitor
resistance in cancer therapy. Targeted Oncol. 2011;6:17–27.
16. He X, Wang Y, Zhu J, Orloff M, Eng C. Resveratrol enhances the
anti-tumor activity of the mTOR inhibitor rapamycin in multiple
breast cancer cell lines mainly by suppressing rapamycin-induced
Akt signaling. Cancer Lett. 2011;301:168–76.
17. Ji D, Zhang Z, Cheng L, Chang J, Wang S, Zheng B, et al. The
combination of RAD001 and MK-2206 exerts synergistic cytotoxic
effects against PTEN mutant gastric cancer cells: involvement of
MAPK-dependent autophagic, but not apoptotic cell death pathway.
PLoS One. 2014;9:e85116.
18. Leng J, Han C, Demetris AJ, Michalopoulos GK, Wu T.
Cyclooxygenase-2 promotes hepatocellular carcinoma cell growth
through Akt activation: evidence for Akt inhibition in celecoxib-
induced apoptosis. Hepatology. 2003;38:756–68.
19. Kim N, Kim CH, Ahn DW, Lee KS, Cho SJ, Park JH, et al. Anti-
gastric cancer effects of celecoxib, a selective cox-2 inhibitor, through
inhibition of Akt signaling. J Gastroenterol Hepatol. 2009;24:480–7.
20. Pang RP, Zhou JG, Zeng ZR, Li XY, Chen W, Chen MH, et al.
Celecoxib induces apoptosis in COX-2 deficient human gastric can-
cer cells through Akt/GSK3beta/NAG-1 pathway. Cancer Lett.
2007;251:268–77.
21. Chen L, He Y, Huang H, Liao H, Wei W. Selective COX-2 inhibitor
celecoxib combined with EGFR-TKI ZD1839 on non-small cell lung
cancer cell lines: in vitro toxicity and mechanism study. Med Oncol.
2008;25:161–71.
22. Wang YX, Gao JX, Wang XY, Zhang L, Liu CM. Antiproliferative
effects of selective cyclooxygenase-2 inhibitor modulated by
nimotuzumab in estrogen-dependent breast cancer cells. Tumour
Biol. 2012;33:957–66.
23. Qu X, Zhang Y, Li Y, Hu X, Xu Y, Xu L, et al. Ubiquitin ligase Cbl-b
sensitizes leukemia and gastric cancer cells to anthracyclines by ac-
tivating the mitochondrial pathway and modulating Akt and ERK
survival signals. FEBS Lett. 2009;583:2255–62.
24. Zhang Y, Qu X, Hu X, Yang X, Hou K, Teng Y, et al. Reversal of P-
glycoprotein-mediated multi-drug resistance by the E3 ubiquitin li-
gase Cbl-b in human gastric adenocarcinoma cells. J Pathol.
2009;218:248–55.
25. Rao N, Dodge I, Band H. The Cbl family of ubiquitin ligases: critical
negative regulators of tyrosine kinase signaling in the immune sys-
tem. J Leukoc Biol. 2002;71:753–63.
26. Brennan T, Adapala NS, Barbe MF, Yingling V, Sanjay A.
Abrogation of Cbl-PI3K interaction increases bone formation and
osteoblast proliferation. Calcif Tissue Int. 2011;89:396–410.
27. Hudes G, Carducci M, Tomczak P, Dutcher J, Figlin R, Kapoor A,
et al. Temsirolimus, interferon alfa, or both for advanced renal-cell
carcinoma. N Engl J Med. 2007;356:2271–81.
28. Motzer RJ, Escudier B, Oudard S, Hutson TE, Porta C, Bracarda S,
et al. Efficacy of everolimus in advanced renal cell carcinoma: a
double-blind, randomised, placebo-controlled phase III trial. Lancet.
2008;372:449–56.
29. Mustafa A, Kruger WD. Suppression of tumor formation by a
cyclooxygenase-2 inhibitor and a peroxisome proliferator-activated
receptor gamma agonist in an in vivo mouse model of spontaneous
breast cancer. Clin Cancer Res. 2008;14:4935–42.
30. Liu B, Wen JK, Li BH, Fang XM, Wang JJ, Zhang YP, et al.
Celecoxib and acetylbritannilactone interact synergistically to
Tumor Biol.
suppress breast cancer cell growth via COX-2-dependent and -
independent mechanisms. Cell Death Dis. 2011;2:e185.
31. Bundscherer A, Hafner C, Maisch T, Becker B, Landthaler M, Vogt T.
Antiproliferative and proapoptotic effects of rapamycin and celecoxib
in malignant melanoma cell lines. Oncol Rep. 2008;19:547–53.
32. Bundscherer A, Vogt T, Kohl G, Landthaler M, Hafner C.
Antiproliferative effects of rapamycin and celecoxib in angiosarcoma
cell lines. Anticancer Res. 2010;30:4017–23.
33. Liu M, Li CM, Chen ZF, Ji R, Guo QH, Li Q, et al. Celecoxib regulates
apoptosis and autophagy via the PI3K/Akt signaling pathway in SGC-
7901 gastric cancer cells. Int J Mol Med. 2014;33:1451–8.
34. Gallouet AS, Travert M, Bresson-Bepoldin L, Guilloton F, Pangault
C, Caulet-Maugendre S, et al. COX-2-independent effects of
celecoxib sensitize lymphoma B cells to TRAIL-mediated apoptosis.
Clin Cancer Res. 2014;20:2663–73.
35. Cho SJ, Kim N, Kim JS, Jung HC, Song IS. The anti-cancer effect of
COX-2 inhibitors on gastric cancer cells. Dig Dis Sci. 2007;52:1713–21.
36. Arico S, Pattingre S, Bauvy C, Gane P, Barbat A, Codogno P, et al.
Celecoxib induces apoptosis by inhibiting 3-phosphoinositide-
dependent protein kinase-1 activity in the human colon cancer HT-
29 cell line. J Biol Chem. 2002;277:27613–21.
37. Kardosh A, Wang W, Uddin J, Petasis NA, Hofman FM, Chen TC,
et al. Dimethyl-celecoxib (DMC), a derivative of celecoxib that lacks
cyclooxygenase-2-inhibitory function, potently mimics the anti-
tumor effects of celecoxib on burkitt’s lymphoma in vitro and
in vivo. Cancer Biol Ther. 2005;4:571–82.
38. Qu J, Zhao M, Teng Y, Zhang Y, Hou K, Jiang Y, et al. Interferon-
alpha sensitizes human gastric cancer cells to TRAIL-induced apo-
ptosis via activation of the c-CBL-dependent MAPK/ERK pathway.
Cancer Biol Ther. 2011;12:494–502.
39. Yan S, Qu X, Xu C, Zhu Z, Zhang L, Xu L, et al. Down-regulation of
Cbl-b by bufalin results in up-regulation of DR4/DR5 and sensitiza-
tion of TRAIL-induced apoptosis in breast cancer cells. J Cancer Res
Clin Oncol. 2012;138:1279–89.