Professional Documents
Culture Documents
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 23 September 2015
Accepted 6 October 2015
Available online 19 October 2015
Curcumin, a yellow polyphenol extracted from the rhizome of turmeric root (Curcuma longa) has potent
anti-cancer properties in many types of tumors with ability to reverse multidrug resistance of cancer
cells. However, widespread clinical application of this agent in cancer and other diseases has been
limited due to its poor aqueous solubility. The recent ndings of polymeric nanoparticle formulation of
curcumin (NFC) have shown the potential for circumventing the problem of poor solubility, however
evidences for NFC's anti-cancer and reverse multidrug resistance properties are lacking. Here we provide
models of human hepatocellular carcinoma (HCC), the most common form of primary liver cancer,
in vitro and in vivo to evaluate the efcacy of NFC alone and in combination with sorafenib, a kinase
inhibitor approved for treatment of HCC. Results showed that NFC not only inhibited the proliferation
and invasion of HCC cell lines in vitro, but also drastically suppressed primary tumor growth and lung
metastases in vivo. Moreover, in combination with sorafenib, NFC induced HCC cell apoptosis and cell
cycle arrest. Mechanistically, NFC and sorafenib synergistically down-regulated the expression of MMP9
via NF-kB/p65 signaling pathway. Furthermore, the combination therapy signicantly decreased the
population of CD133-positive HCC cells, which have been reported as cancer initiating cells in HCC. Taken
together, NanoCurcumin provides an opportunity to expand the clinical repertoire of this agent. Additional studies utilizing a combination of NanoCurcumin and sorafenib in HCC are needed for further
clinical development.
2015 Elsevier Inc. All rights reserved.
Keywords:
Curcumin
Sorafenib
Hepatocellular carcinoma
NF-kB
MMP-9
1. Introduction
Liver cancer is the second most common cause of cancer death
among men, and the sixth leading cause of cancer death among
* Corresponding author. Liver Cancer Institute, Fudan University, 136 Yi Xue Yuan
Road, Shanghai, 200032, PR China.
** Corresponding author.
E-mail addresses: rander54@jhmi.edu (R.A. Anders), drxuyang@gmail.com
(Y. Xu).
1
These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.bbrc.2015.10.031
0006-291X/ 2015 Elsevier Inc. All rights reserved.
women. Almost half of liver cancer cases and deaths worldwide are
estimated to have occurred in China and hepatocellular carcinoma
(HCC) accounts for 70%e85% of liver cancers globally [1,2]. Because
tumors can develop resistance to chemotherapeutic agents, there is
an urgent need for the development of agents that can reverse
drug-resistance and suppress proliferation and metastasis of HCC
without toxicity to normal cells [3].
Sorafenib is a vascular endothelial growth factor receptor and
multikinase inhibitor, approved for the treatment of unresectable
HCCs. This drug has been used as a rst-line treatment for advanced
HCC. Although sorafenib can prolong median survival time by
526
performed in triplicate.
2.4. Cell cycle analysis and apoptosis assay
Huh7 and MHCCLM3 cells were seeded into 6-well plates,
incubated overnight, and then treated with 1% DMSO, 40 mM NFC,
10 mM sorafenib, or 40 mM NFC 10 mM sorafenib for 48 h. For cell
cycle analysis, the cells were xed in 75% ethanol for 1 h at 4 C, and
stained with the DNA-binding dye propidium iodide (1 mg/mL) and
RNase (0.5 mg/mL) for 30 min at 37 C. Finally, the DNA changes in
cells were examined with a ow cytometer (Beckman cytomics
FC500). For apoptosis assay, the cells were stained using the
Annexin-V-FITC/PI apoptosis detection kit (BD Biosciences, USA)
according to the manufacturer's instructions. Each test was performed in triplicate.
2.5. Orthotopic xenograft models of HCC
MHCCLM3-RFP cells (1 106) in 0.2 mL serum-free culture
medium were injected subcutaneously into three 4- to 6-week old
male athymic BALB/c nu/nu mice (Shanghai Institute of Material
Medical, Chinese Academy of Science). The mice were housed at the
Zhongshan Hospital of Fudan University and the experimental
protocol was approved by the Animal Welfare Committee of Fudan
University.
When the subcutaneous tumor reached 1 cm in diameter, it
was minced into pieces (approximately 2 mm3) and then
implanted into the livers of 24 mice. The mice were randomly
divided into four groups according to treatment: 1) control (PBS,
100 ml, intraperitoneal injection), 2) NFC (1.56 g/kg, daily intraperitoneal injection), 3) sorafenib (30 mg/kg, daily oral administration), and 4) NFC plus sorafenib (administered as described for
single agent treatments). After 4 weeks, the mice were sacriced
by overdosage of pentobarbital, and the tumors were removed for
measurement and analysis by western blot, quantitative reverse
transcription-polymerase chain reaction (qRT-PCR), and immunohistochemical staining. Primary tumor volumes were calculated
using the formula V 1/2a b2, where a is the longest tumor axis,
and b is the shortest tumor axis. Each metastatic tumor in the
lungs was cryosectioned and observed under uorescence microscopy (for excitation of RFP at 584 nm). Finally, the lung sections were stained with hematoxylin and eosin (H&E) to quantify
metastatic foci.
2.6. Western blot analysis
The concentration of protein extracted from the HCC cell lines
and mouse tumor tissue was determined by using the BCA Protein
Assay Kit (Pierce, USA). Samples were analyzed with primary antibodies against matrix metalloproteinase 9 (MMP-9; AB911, R&D
Systems, 1:1000), tissue inhibitor of metalloproteinases-1 (TIMP-1;
No. 8946, Cell Signaling Technology, 1:1000), nuclear factor-kappalight-chain-enhancer of activated B cells (NF-kB; No. 3034, Cell
Signaling Technology, 1:1000), unphosphorylated extracellular
signal-related kinase (ERK1/2; ab17942, Abcam, 1:1000), and
phosphorylated ERK1/2 (No. 9102, Cell Signaling Technology,
1:1000).
2.7. Enzyme-linked immunosorbent assay (ELISA)
MHCCLM3 and Huh7 cells were treated with 1% DMSO, 40 mM
NFC, 10 mM sorafenib, or 40 mM NFC 10 mM sorafenib for 48 h.
Samples were incubated with a monoclonal anti-MMP-9 antibody
(AB911, R&D Systems), and incubated with an enzyme-linked
polyclonal antibody specic for MMP-9 (KHC3061, Life
Technologies). After washing away the unbound conjugate, a substrate solution was added to each well, and absorbance at 450 nm
was determined using a microplate reader (Bio-Rad). All measurements were performed in duplicate, and MMP-9 concentration
was expressed in pg/mL.
527
3. Results
3.1. NanoCurcumin inhibits HCC cell proliferation and invasion
in vitro
Results of the CCK8 assay showed that NanoCurcumin signicantly inhibited the viability of Huh7 and MHCCLM3 cells (P < 0.01;
Fig. S1). In MHCCLM3 cells the half maximal inhibitory concentration (IC50) of NanoCurcumin was 40 mM at 24 h, 35 mM at 48 h, and
33 mM at 72 h, and in Huh7 cells, the IC50 of NanoCurcumin was
74 mM (24 h), 30 mM (48 h), and 27 mM (72 h). Although combination treatment appeared to more strongly inhibit cell proliferation, the inhibition was not statistically signicant from that of
NanoCurcumin or sorafenib alone (Fig. 1A).
To further determine the cellular effects of NanoCurcumin on
HCC, we performed wound healing and migration assays. We found
that the wound healing ability of combination treatment was at
least 2-fold lower than that of sorafenib alone (Fig. 1BeC). Consistent with these results, NanoCurcumin substantially reduced the
migration of both MHCCLM3 and Huh7 cells in the Boyden chamber
migration assay compared with the control (P < 0.01), and the
combination treatment reduced the migration of MHCCLM3 cells
(P < 0.05) (Fig. 1D).
2.9. qRT-PCR
3.2. NanoCurcumin induces HCC cell apoptosis and cell cycle arrest
Total RNA was extracted from cell lines and frozen tumor
specimens using Trizol reagent (Invitrogen), and 1 mg total RNA
was reverse transcribed using the PrimeScript RT Reagent kit
(Takara Bio, Tokyo, Japan). Real-time PCR was performed using a
SYBR PrimeScript RT-PCR Kit (Takara Bio) and ABI7300 instrument (Applied Biosystems) according to the manufacturer's instructions. Three independent experiments were performed, and
all reactions were performed in triplicate with glyceraldehyde 3phosphate dehydrogenase (GAPDH) as the internal control.
Primer sequences for NF-kB, MMP-9, and GAPDH were as
follows:
NF-kB,
forward
GGGGGTTGCCCCAGTTTAATTCCCCAGCCTTG, reverse CAAGGCTGGGGAATTAAACTGGGGCAACCCCC;
MMP-9 forward GCCAACTACGACACCGACGAC, reverse TTGGCC
TTGGAAGATGAATGGA; CD133 forward CTGGGGCTGCTGTTTATTATTCTG, reverse ACGCCTTGTCCTTGGTAGTGTTG; and GAPDH
forward GGCATCCTGGGCTACACTGA, reverse GTGGTCGTTGAG
GGCAATG. Relative mRNA levels were calculated according to the
equation: 2DCt [DCt Ct (target) Ct (GAPDH)].
2.8. Immunohistochemistry
528
Fig. 1. Effect of NanoCurcumin and/or sorafenib (SO) on cell proliferation, migration and invasion in vitro. (A) Viability of Huh7 and MHCCLM3 cells was decreased by 48-h
treatment with NanoCurcumin (40 mM) and/or SO (10 mM). (B,C) The wound healing abilities of Huh7 and MHCCLM3 cells were evaluated after NanoCurcumin and/or SO treatment.
(D) To determine effects on invasion and migration, Huh7 and MHCCLM3 cells were seeded onto Matrigel-coated Boyden chamber insert containing NanoCurcumin (40 mmol/L), SO
(10 mmol/L), or NanoCurcumin (40 mmol/L) SO (10 mmol/L). The cells were stained and quantied after 8 h. Results are expressed as mean SE of at least three independent
experiments. *P < 0.05, #P < 0.01 compared with vehicle control. Magnication, 100 (D). Scale bar, 200 mm.
3.4. NanoCurcumin in combination with sorafenib regulates MMP9 and its endogenous inhibitors in vivo and in vitro
To investigate the mechanism by which NanoCurcumin and
sorafenib inhibit HCC metastasis, we evaluated expression of MMP9, an important marker of HCC migration [22,23]. Our results
demonstrated that combination treatment decreased MMP-9
mRNA levels both in vitro and in vivo (Figs. 3A and 4A). Furthermore, both western blot and ELISA results demonstrated that
combination treatment decreased MMP-9 and increased TIMP-1,
the inhibitor of MMP-9, compared with single agent treatments
(Figs. 3D, E and 4D, E). Similar results were obtained by immunohistochemical staining (Fig. 3A).
3.5. NanoCurcumin in combination with sorafenib inhibits MMP-9
expression by inactivating NF-kB/p65 in vivo and in vitro
In human head and neck squamous cell carcinoma cells, curcumin has been shown to suppress MMP-9 expression through
529
Fig. 2. Effect of NanoCurcumin on tumor growth and metastasis of MHCCLM3-RFP cells in vitro and in vivo. (A) Huh7 cells and (B) MHCCLM3 cells were treated with
NanoCurcumin (40 mmol/L), SO (10 mmol/L), or NanoCurcumin (40 mmol/L) SO (10 mmol/L) for 48 h and analyzed by ow cytometry. The X-axis represents Annexin V, and the Yaxis represents propidium iodide. Cell cycle analysis of (C) Huh7 cells and (D) MHCCLM3 was assessed by ow cytometry. The Y-axis represents number of cells, and the X-axis
represents DNA content as uorescence intensity of propidium iodide staining. Results are expressed as mean SE of three independent experiments, *P < 0.05, #P < 0.01 compared
with controls. (E) One week after MHCCLM3-RFP cell implantation, male athymic BALB/c nu/nu mice underwent 28-day treatment with NanoCurcumin (1.56 g/kg daily), sorafenib
(SO, 30 mg/kg daily), or both. Representative orthotopic and subcutaneous tumor xenografts for each treatment group. (F) Tumor volumes of treated mice were smaller than those
of untreated mice (*P < 0.05, #P < 0.01). (G) Left panel: hematoxylin and eosin staining of a metastatic nodule in the lung; magnication of the selected areas showing number of
tumor cells within a single nodule. Right panel: representative image of metastasis in the lung visualized as uorescence of MHCCLM3-RFP cells. Flow cytometry analysis of (H)
Huh7 cells and (I) MHCCLM3 cells showed that NanoCurcumin and/or sorafenib signicantly decreased CD133-positive cells in vitro. Results expressed as mean SE of at least three
independent experiments.
Table 1
Summary of orthotopic xenograft liver tumor model.
Pulmonary metastasis
Percentage
Tumor weight (g)
Control
NFC
SO
NFC SO
6/6
100%
1.53 0.48
3/6
50%
0.75 0.96
4/6
66.7%
0.48 0.11
1/6
16.7%
0.41 0.14
0.182
0.001
0.455
<0.001
0.015
<0.001
530
Fig. 3. Effect of NanoCurcumin on NF-kB/p65, MMP-9, and CD133 in vitro. Huh7 and MHCC97L cell lines were treated with NanoCurcumin (40 mM), sorafenib (SO, 10 mM), or
NanoCurcumin (40 mM) SO (10 mM) for 48 h. Results of qRT-PCR showing mRNA levels of (A) MMP-9, (B) p65, and (C) CD133. Protein levels of MMP-9, p65 (whole cell, cytoplasm
and nucleus), TIMP-1, ERK1/2 (total and phosphorylated), as determined by (D) ELISA and (E) western blot analysis.
531
Fig. 4. Mechanism of action of NanoCurcumin in HCC xenograft model. After 28-day treatment with NanoCurcumin and/or sorafenib (SO), mRNA levels of (A) MMP-9, (B) p65,
and (C) CD133 levels in orthotopic tumors were determined by qRT-PCR. Protein levels of MMP-9, p65 (whole cell, cytoplasm, and nucleus), TIMP-1, ERK1/2 (total and phosphorylated), as determined by (D) ELISA and (E) western blot. Results are expressed as mean SE of at least three independent experiments. *P < 0.05, #P < 0.01 compared with
controls. Magnication, 400 (D). Scale bar, 200 mm.
532
[10] C.L. Yang, Y.Y. Liu, Y.G. Ma, Y.X. Xue, D.G. Liu, et al., Curcumin blocks small cell
lung cancer cells migration, invasion, angiogenesis, cell cycle and neoplasia
through Janus kinase-STAT3 signalling pathway, PLoS One 7 (2012) e37960.
[11] D. Sinha, J. Biswas, B. Sung, B.B. Aggarwal, A. Bishayee, Chemopreventive and
chemotherapeutic potential of curcumin in breast cancer, Curr. Drug Targets
13 (2012) 1799e1819.
[12] Z. Wang, Y. Zhang, S. Banerjee, Y. Li, F.H. Sarkar, Notch-1 down-regulation by
curcumin is associated with the inhibition of cell growth and the induction of
apoptosis in pancreatic cancer cells, Cancer 106 (2006) 2503e2513.
[13] S. Lev-Ari, H. Zinger, D. Kazanov, D. Yona, R. Ben-Yosef, et al., Curcumin
synergistically potentiates the growth inhibitory and pro-apoptotic effects of
celecoxib in pancreatic adenocarcinoma cells, Biomed. Pharmacother. 59
(Suppl. 2) (2005) S276eS280.
[14] T.O. Khor, Y.S. Keum, W. Lin, J.H. Kim, R. Hu, et al., Combined inhibitory effects
of curcumin and phenethyl isothiocyanate on the growth of human PC-3
prostate xenografts in immunodecient mice, Cancer Res. 66 (2006) 613e621.
[15] D. Deeb, H. Jiang, X. Gao, M.S. Hafner, H. Wong, et al., Curcumin sensitizes
prostate cancer cells to tumor necrosis factor-related apoptosis-inducing
ligand/Apo2L by inhibiting nuclear factor-kappaB through suppression of
IkappaBalpha phosphorylation, Mol. Cancer Ther. 3 (2004) 803e812.
[16] R.A. Sharma, H.R. McLelland, K.A. Hill, C.R. Ireson, S.A. Euden, et al., Pharmacodynamic and pharmacokinetic study of oral Curcuma extract in patients
with colorectal cancer, Clin. Cancer Res. 7 (2001) 1894e1900.
[17] S. Bisht, G. Feldmann, S. Soni, R. Ravi, C. Karikar, et al., Polymeric nanoparticleencapsulated curcumin (nanocurcumin): a novel strategy for human cancer
therapy, J. Nanobiotechnol. 5 (2007) 3.
[18] D. Ghosh, S.T. Choudhury, S. Ghosh, A.K. Mandal, S. Sarkar, et al., Nanocapsulated curcumin: oral chemopreventive formulation against diethylnitrosamine induced hepatocellular carcinoma in rat, Chem. Biol. Interact. 195
(2012) 206e214.
[19] Y. Li, B. Tian, J. Yang, L. Zhao, X. Wu, et al., Stepwise metastatic human hepatocellular carcinoma cell model system with multiple metastatic potentials
established through consecutive in vivo selection and studies on metastatic
characteristics, J. Cancer Res. Clin. Oncol. 130 (2004) 460e468.
[20] Q.H. Ye, L.X. Qin, M. Forgues, P. He, J.W. Kim, et al., Predicting hepatitis B viruspositive metastatic hepatocellular carcinomas using gene expression proling
and supervised machine learning, Nat. Med. 9 (2003) 416e423.
[21] X.R. Yang, Y. Xu, B. Yu, J. Zhou, J.C. Li, et al., CD24 is a novel predictor for poor
prognosis of hepatocellular carcinoma after surgery, Clin. Cancer Res. 15
(2009) 5518e5527.
[22] H.M. El Tayebi, W. Salah, I.H. El Sayed, E.M. Salam, A.R. Zekri, et al., Expression
of insulin-like growth factor-II, matrix metalloproteinases, and their tissue
inhibitors as predictive markers in the peripheral blood of HCC patients,
Biomarkers 16 (2011) 346e354.
[23] L.X. Qin, Z.Y. Tang, Recent progress in predictive biomarkers for metastatic
recurrence of human hepatocellular carcinoma: a review of the literature,
J. Cancer Res. Clin. Oncol. 130 (2004) 497e513.
[24] S. Aggarwal, Y. Takada, S. Singh, J.N. Myers, B.B. Aggarwal, Inhibition of growth
and survival of human head and neck squamous cell carcinoma cells by
curcumin via modulation of nuclear factor-kappaB signaling, Int. J. Cancer 111
(2004) 679e692.
[25] R. Siegel, D. Naishadham, A. Jemal, Cancer statistics, 2012, CA Cancer J. Clin. 62
(2012) 10e29.
[26] N.N. Rahbari, A. Mehrabi, N.M. Mollberg, S.A. Muller, M. Koch, et al., Hepatocellular carcinoma: current management and perspectives for the future,
Ann. Surg. 253 (2011) 453e469.