Nutrition and Cancer

ISSN: 0163-5581 (Print) 1532-7914 (Online) Journal homepage: https://www.tandfonline.com/loi/hnuc20

Cytotoxic Activity of Boesenbergia rotunda Extracts

against Nasopharyngeal Carcinoma Cells (HK1).
Cardamonin, a Boesenbergia rotunda Constituent,
Inhibits Growth and Migration of HK1 Cells by
Inducing Caspase-Dependent Apoptosis and G2/
M–Phase Arrest

Mohammed Khaled Bin Break, Michelle Chiang, Christophe Wiart, Chiew-

Foan Chin, Alan Soo Beng Khoo & Teng-Jin Khoo

To cite this article: Mohammed Khaled Bin Break, Michelle Chiang, Christophe Wiart, Chiew-Foan
Chin, Alan Soo Beng Khoo & Teng-Jin Khoo (2020): Cytotoxic Activity of Boesenbergia�rotunda
Extracts against Nasopharyngeal Carcinoma Cells (HK1). Cardamonin, a Boesenbergia�rotunda
Constituent, Inhibits Growth and Migration of HK1 Cells by Inducing Caspase-Dependent Apoptosis
and G2/M–Phase Arrest, Nutrition and Cancer, DOI: 10.1080/01635581.2020.1751217

To link to this article: https://doi.org/10.1080/01635581.2020.1751217

Published online: 09 Apr 2020.

Submit your article to this journal

View related articles

View Crossmark data

Full Terms & Conditions of access and use can be found at

https://www.tandfonline.com/action/journalInformation?journalCode=hnuc20
NUTRITION AND CANCER
https://doi.org/10.1080/01635581.2020.1751217

Cytotoxic Activity of Boesenbergia rotunda Extracts against Nasopharyngeal

Carcinoma Cells (HK1). Cardamonin, a Boesenbergia rotunda Constituent,
Inhibits Growth and Migration of HK1 Cells by Inducing Caspase-Dependent
Apoptosis and G2/M–Phase Arrest
Mohammed Khaled Bin Breaka, Michelle Chiangb, Christophe Wiartb, Chiew-Foan Chinc, Alan Soo Beng
Khood, and Teng-Jin Khoob
a
Department of Pharmaceutical Chemistry, College of Pharmacy, University of Hail, Hail, Saudi Arabia; bCentre for Natural and
Medicinal Product Research, School of Pharmacy, University of Nottingham Malaysia, Semenyih, Malaysia; cSchool of Biosciences,
University of Nottingham Malaysia, Semenyih, Malaysia; dUnit of Molecular Pathology, Cancer Research Centre, Institute for Medical
Research, Kuala Lumpur, Malaysia

ABSTRACT ARTICLE HISTORY

Boesenbergia rotunda (L.) Mansf. is an edible herb that is commonly used in the cuisine of Received 31 October 2019
several Asian countries. Studies have shown that it possesses high bioactivity against a var- Accepted 29 March 2020
iety of cancer cells. In this study, we investigated the cytotoxic activity of Boesenbergia
rotunda rhizomes and some of its constituents on nasopharyngeal carcinoma cells (HK1).
MTT assay results showed that the methanolic and hexane extracts of Boesenbergia rotunda
decreased HK1 cell viability with IC50 values of 136 mg/ml and 66 mg/ml, respectively.
Cardamonin, a constituent of Boesenbergia rotunda, exhibited the highest cytotoxic activity
with an IC50 value of 27 lg/ml. Further studies on cardamonin revealed that it inhibited the
migration of HK1 cells, caused G2/M-phase arrest and induced apoptosis. Apoptosis was
induced via activating caspase-8 and caspase-3, but independent of caspase-9. This indi-
cated that cardamonin induced extrinsic apoptosis. Western blot analysis further showed
that cardamonin caused extrinsic apoptosis, as the expression levels of intrinsic apoptosis-
related proteins (Bcl-XL, Bcl-2 and Bax), were not affected. Finally, JC-1 staining of HK1 cells
revealed an increase in the mitochondrial membrane potential after treatment, further prov-
ing that cardamonin did not induce apoptosis via the intrinsic pathway. These results reflect
cardamonin’s potential as an anticancer agent.

Introduction Asian countries such as Malaysia, China and India,

Nasopharyngeal carcinoma (NPC) consists of cancer
cells that lie in the upper part of the throat behind
the nose and near the base of the skull known as the
nasopharynx. This type of cancer is rare, but it is
endemic in certain regions of the world, especially
Southeast Asia where the incidence rate is about 20
per 100000 people yearly, and it has a low survival
rate making it a serious health problem (1).
Natural products have always been a rich source of
anticancer drugs and several plant-derived molecules
have been found to possess cytotoxic activity (2).
Boesenbergia rotunda (L.) Mansf. is an edible ginger
species that belongs to the Zingiberaceae family and
grows in Southeast Asia, India, Sri Lanka and China.
It is a common ingredient in the cuisine of several
whereby it is often added to food, such as curry, in
order to enhance the flavor and promote appetite (3).
Furthermore, the fresh rhizomes of B. rotunda have
been traditionally used to treat a variety of illnesses,
such as inflammatory diseases, dry cough, mouth
ulcers and diarrhea (3, 4). Recent studies have shown
that B. rotunda possesses cytotoxic activity against a
wide range of cell lines such as MCF7, HT29, HL60
and HeLa cells (4–6). Moreover, it was found that
pure compounds isolated from B. rotunda, such as
cardamonin and boesenbergin A, possess significant
cytotoxic activity (7–9). These results reflect the
potential of B. rotunda as a source for future anti-
cancer agents. However, there were no studies

CONTACT Teng-Jin Khoo TengJin.Khoo@nottingham.edu.my Centre for Natural and Medicinal Product Research, School of Pharmacy, University of
Nottingham Malaysia, 43500 Semenyih, Malaysia.
ß 2020 Taylor & Francis Group, LLC
2 M. K. B. BREAK ET AL.
performed on the cytotoxic activity of B. rotunda on
nasopharyngeal carcinoma cells (HK1).
Therefore, the main aim of the present study is to
investigate the cytotoxic activity of B. rotunda and
some of its constituents against nasopharyngeal car-
cinoma cells (HK1). The study involved initial assess-
ment of cytotoxic activity of B. rotunda’s extracts and
some of its pure constituents via MTT assay.
Cardamonin, the most active pure constituent, was
subjected to further studies to investigate its action on
HK1 cells. Induction of apoptosis by cardamonin and
related protein expressions were investigated via sev-
eral methods such as Western blotting and qPCR. We
were able to successfully demonstrate the significant
cytotoxic activity of cardamonin, a constituent of B.
rotunda, against nasopharyngeal carcinoma cells
(HK1) in detail for the first time.
Materials and Methods
Chemicals and Reagents
Solvents were of analytical grade and purchased from
RCI Labscan (Thailand). Cardamonin, pinostrobin,
naringin, hesperidin and trypan blue were obtained
from Sigma-Aldrich (USA). Cell culture media RPMI
1640 supplemented with 10% Fetal Bovine Serum
(FBS) and MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphe-
nyltetrazolium bromide) were purchased from Gibco,
Life Technologies (USA). Propidium iodide (PI), acrid-
ine orange (AO), Caspase-3 DEVD-R110 Fluorometric
and Colorimetric assay kit, Caspase-8 IETD-R110
Fluorometric and Colorimetric assay kit were pur-
chased from Biotium (Canada). JC-1 Mitochondrial
Membrane Potential Assay Kit was obtained from
Abnova (Taiwan). RNAqueousV-4PCR Total RNA
R
Isolation Kit, SuperScriptV III PlatinumV SYBRV Green
R R R
One-Step qRT-PCR Kit were purchased from
Invitrogen, Life Technologies (USA). PRO-PREP pro-
tein extraction kit was purchased from iNtRON
Biotechnology (Korea). Anti-Bcl-2, anti-Bcl2-L1, anti-
Bax and goat anti-Rabbit IgG peroxidase-conjugated
secondary antibodies were purchased from
Abgent (USA).
Collection and Extraction of Plant Material
Boesenbergia rotunda (L.) Mansf. rhizomes were
obtained from Pasar Tani, Kajang, Malaysia


(3
00 2500 N, 101 480 2600 E). The plant material was iden-
tified by Dr. Haiz, Universiti Putra Malaysia, and a
voucher specimen (No. UNMC178) was deposited at
the School of Pharmacy, University of Nottingham
Malaysia herbarium. The plant material was macer-
ated in hexane, ethyl acetate and methanol in a 1:10
ratio (1 g in 10 ml of solvent) for 3 days for each solv-
ent. Maceration was repeated three times for each
solvent used. Each extract was filtered and later con-
centrated to yield the plant crude extracts.
Cell Culture
HK1 cells were obtained from Prof. Tsao (The
University of Hong Kong) (10) and were cultured in
RPMI media supplemented by 10% FBS and 5% peni-
cillin-streptomycin. NP69 cells were cultured in
Keratinocyte-SFM containing 0.025% bovine pituitary
extract, 0.014% recombinant epidermal growth factor
(EGF) and 5% penicillin-streptomycin. Cells were
maintained at 37
C in a humidified atmosphere with
5% CO2.
Cell Viability Assay
HK1 and NP69 cell lines were seeded on a 96-well
plate at 7  103 cells per well. After 24 h, samples were
dissolved in DMSO at various concentrations (0,
3.125, 6.25, 12.5, 25, 50, 100 and 200 mg/ml) and
added to the cells. After an incubation time of 48 h,
MTT solution was added. The absorbance of each
well was finally read at 540 nm using a plate reader.
Migration Assay
HK1 cells were seeded and left to grow until conflu-
ency. This was followed by forming a “wound” in the
layer of cells. The cells were then incubated with car-
damonin at about (1=4  IC50 concentration) in the
presence of 10% FBS for 48 h. Finally, images of cells
were analyzed via the software “ImageJ”.
Acridine Orange/Propidium Iodide Double
Staining Assay
HK1 cells were seeded on a chamber slide at cell dens-
ity of 6  104 cells per chamber. 10 lg/ml of acridine
orange (AO) and 10 lg/ml of propidium iodide (PI)
were added to each chamber. It was then observed
under Fluoview 1000 laser scanning confocal micro-
scope (Olympus IX 81 Motorized Inverted Microsope).
Caspase-3 and Caspase-8 Activity Assay
Caspase-3 and caspase-8 activity were evaluated using
Caspase-3 DEVD-R110 Fluorometric and Colorimetric

Assay Kit and Caspase-8 IETD-R110 Fluorometric
and Colorimetric Assay Kit. Untreated cells and cells
treated with cardamonin at about (1  IC50) concen-
tration were incubated for 24 h at 37
C under 5%
CO2. Fluorescence was measured at 470 nm excitation
and 520 nm emission.
qPCR Assay
Quantitative RT-PCR was performed on an ECO
Illumina Real-Time PCR machine using a Superscript
III Platinum SYBR Green One-Step qRT-PCR kit
(Invitrogen). Thermal cycling conditions were set for
one cycle for 3 min at 50
C, followed by another cycle
for 5 min at 90
C. Then 40 cycles of 95
C for 15 s
and 60
C for 30 s. Specific primers used were Homo
caspase-9 forward (F) primer (50 -TGTCCTACTCT
ACTTTCCCAGGTTTT-30 ), homo caspase-9 reverse
(R) primer (50 -GTGAGCCCACTGCTCAAAGAT-30 ),
GAPDH forward (F) primer (50 -ACACCCACTCCTC
CACCTTT-30 ) and GAPDH reverse (R) primer (50 -T
AGCCAAATTCGTTGTCATACC).
Western Blot Assay
Untreated cells and cells treated with cardamonin at
about (1  IC50) concentration were incubated for 3,
6, 9 and 12 h at 37
C under 5% CO2. The cells were
later harvested and cell lysate was obtained. 30 lg of
protein lysate was separated on 4–12% Tris-HCl SDS-
PAGE gel and blotted onto a hybond ECL nitrocellu-
lose membrane (GE Healthcare and Life Sciences).
Membrane was blocked with 5% low fat milk in Tris
Buffered Saline (TBS) containing 1% Tween-20
(TBST). Then, membrane was incubated with primary
antibody (1:1500 dilution) for 2 h with agitation
(60 rpm) at room temperature. The membrane was
later washed with TBST prior to incubation with sec-
ondary antibody (1:1500 dilution). After that, mem-
brane was washed with TMB Membrane Peroxidase
Substrate Ready-To-Use (Rockland Immunochemicals)
until protein bands were observed.
JC-1 Mitochondrial Membrane Potential Assay
Mitochondrial membrane potential was evaluated
using JC-1 Mitochondrial Membrane Potential Assay
Kit (Abnova). The ratio of fluorescent intensity of J-
aggregates to monomers is used as an indicator of cell
health. In this experiment, untreated cells and cells
treated with cardamonin at about (1  IC50) concen-
tration were incubated for 3 h at 37
C under 5% CO2.
NUTRITION AND CANCER 3
JC-1 staining solution was later added to the cells and
fluorescence readings were taken. Changes in mito-
chondrial membrane potential stained with JC-1 were
analyzed using Fluoview 1000 laser scanning confocal
microscope (Olympus IX 81 Motorized
Inverted Microsope).
Cell-Cycle Analysis
Untreated cells and cells treated with cardamonin at
about (1  IC50) concentration were incubated for
12 h at 37
C under 5% CO2. Cells were then fixed in
20
C overnight prior to cell cycle analysis. RNase A
solution (1 mg/ml) was later added and cells were
incubated at 37
C for 15 min. Then, propidium iodide
(PI) (1 mg/ml) was added to the cells which were left
on ice in the dark for 10 min prior to cell cycle ana-
lysis (Beckman Coulter).
Data Analysis
All experiments were performed in triplicates and
data were expressed as mean ± S.D. IC50 values were
calculated using nonlinear regression with a variable
slope fit function in Graphpad Prism program.
Statistical differences among means have been ana-
lyzed by One-way ANOVA followed by a Dunnett
multiple comparisons test, in addition to student’s t-
test using Graphpad Prism. Data represent significant
values as p < 0.05 and p < 0.001.
Results and Discussion
Methanol and Hexane Extracts of B. rotunda
Decreased HK1 Cell Viability While Showing Low
Toxicity toward Normal NP69 Cells
Methanol, ethyl acetate and hexane extracts of B.
rotunda were screened against HK1 cells to examine
their cytotoxic activity (Figure 1). The bioactive
extracts were further screened against normal naso-
pharyngeal epithelial cell lines (NP69) in order to
assess their toxicity toward normal and healthy cells
(Figure 1). Results showed that methanol and hexane
extracts decreased HK1 cell viability significantly with
IC50 values of 136 mg/ml and 66 mg/ml after 48 h,
respectively (Table 1). The cytotoxic activity of metha-
nol and hexane extracts were comparable to that of 5-
Fluorouracil (positive control), which further confirms
their significant bioactivity. However, ethyl acetate
extract exerted low cytotoxic activity against
HK1 cells.
4 M. K. B. BREAK ET AL.

Figure 1. (A) Cell viability (MTT assay) of HK1 cells pretreated with methanol, ethyl acetate and hexane extracts of B. rotunda at
different concentrations for 48 h. (B) Cell viability (MTT assay) of NP69 cells pretreated with methanol and hexane extracts of B.
rotunda at different concentrations for 48 h. The assay was repeated three times. Bars and error bars refer to mean ± S.D.
p < 0.05 vs. control, p < 0.001 vs. control.

Table 1. IC50 values of B. rotunda extracts against HK1 and extracts of B. rotunda possessed higher selectivity
NP69 cells. 5-Fluorouracil is reported as a positive control. toward HK1 cancer cells with much lower effect on
IC50 (mg/ml)a normal NP69 cells.
Sample HK1 NP69
Methanol extract 136.7 ± 14.5 >200
Ethyl acetate extract >200 –
Cardamonin, a Constituent of B. rotunda,
Hexane extract 65.9 ± 11.9 >200 Decreased HK1 Cell Viability and Showed Low
5-Fluorouracil 48.2 ± 1.1 –
Toxicity on Normal NP69 Cells
IC50 values are reported as the mean (IC50 ± S.D.) of three independent
a

experiments. Only compounds that showed cytotoxic activity against
HK1, were further tested against NP69 cells. IC50 values were calculated
using nonlinear regression with a variable slope fit function in
Graphpad Prism program.
Furthermore, the bioactive methanol and hexane
extracts showed lower cytotoxic activity on healthy
NP69 cells with IC50 values of >200 mg/ml (Table 1).
This clearly indicates that methanol and hexane
The cytotoxic activity demonstrated by methanol and
hexane extracts of B. rotunda encouraged us to further
investigate potential compounds or constituents pre-
sent that could have been responsible for the extracts’
bioactivity. Several studies have already isolated and
identified pure compounds from B. rotunda (4, 9, 11,
12). Based on these studies, we then decided to inves-
tigate the cytotoxic activity of the following com-
pounds that were previously isolated from methanol
 NUTRITION AND CANCER 5

Figure 2. (A) Cell viability (MTT assay) of HK1 cells pretreated with cardamonin, hesperidin, naringin and pinostrobin at different
concentrations for 48 h. (B) Cell viability (MTT assay) of NP69 cells pretreated with cardamonin at different concentrations for 48 h.
The assay was repeated three times. Bars and error bars refer to mean ± S.D. p < 0.05 vs. control, p < 0.001 vs. control.

and hexane extracts of B. rotunda: Cardamonin, hes- Table 2. IC50 values of cardamonin, hesperidin, naringin and
peridin, naringin and pinostrobin. These compounds pinostrobin against HK1 and NP69 cells. 5-Fluorouracil is
reported as a positive control.
of natural plant origins were then obtained from our
IC50 (mg/ml)a
source supplier.
The pure compounds were all screened against Compound HK1 NP69
Cardamonin 26.7 ± 8.6 >200
HK1 cells, but only the compounds that demonstrated Hesperidin >200 –
bioactivity against HK1 cells were further screened Naringin >200 –
Pinostrobin >200 –
against healthy NP69 cells (Figure 2). Results have 5-Fluorouracil 48.2 ± 1.1 –
shown that only cardamonin exerted significant cyto- a
IC50 values are reported as the mean (IC50 ± S.D.) of three independent
toxic activity against HK1 cells with an IC50 value of experiments. Only compounds that showed cytotoxic activity against
HK1, were further tested against NP69 cells. IC50 values were calculated
26.7 mg/ml after 48 h (Table 2). Moreover, it was more using nonlinear regression with a variable slope fit function in
active than 5-fluorouracil (positive control), which Graphpad Prism program.
further reflects cardamonin’s high cytotoxic activity
against HK1 cells. However, cardamonin exerted
much lower activity on normal NP69 cells with an note that previous studies on cardamonin have also
IC50 value of >200 mg/ml after 48 h, which shows that reported its high cytotoxic activity on different cell
it possesses higher selectivity toward cancer cells with lines, which further demonstrates its potential as an
no significant effect on normal cells. It is crucial to anticancer agent (13–15).
6 M. K. B. BREAK ET AL.
Figure 3. Cardamonin inhibited the migration of HK1 cells. (A) The migration assay involved forming a “scratch” or “wound” across
a layer of cells followed by adding cardamonin at about (1=4  IC50 concentration) for 48 h. Representative “wound” closure images
are shown in the figure. (B) Cell migration was expressed as a percentage of the “wound” area that has been covered by the
migrating cells relative to the initial “cell-free” wound area. The assay was repeated three times. Bars and error bars refer to
mean ± S.D. p < 0.05 vs. control.
Based on these significant results, cardamonin was
then subjected for further study in order to investigate
the mechanism by which it causes cell death.
Cardamonin Inhibited the Migration of HK1 Cells
Cancer cells tend to migrate or metastasize from their
place of origin to other organs in the body and this
results in the spread of cancer. Therefore, the effect of
cardamonin on the migration of HK1 cancer cells was
investigated via a wound-healing (scratch) migration
assay. The assay involves forming a “wound” or
“scratch” across a layer of cells and then allowing the
cells to grow back for a certain time period in order
to close and cover this “wound”.
In this study, a “scratch” or “wound” was made
across a layer of HK1 cells followed by treatment with
cardamonin for 48 h. It was found that the percentage
area of the wound covered by HK1 cells after 48 h
was less in the cardamonin-treated cells relative to the
untreated control cells (Figure 3). This indicates that
cardamonin was able to decrease the migration rate of
HK1 cells. Cancer cells metastasis is dependent on
several factors such as the cells’ migration ability,
therefore, these results demonstrate the potential abil-
ity of cardamonin to inhibit or reduce the rate of
metastasis in cancer patients (16).
Cardamonin Induced Apoptosis-Related
Morphological Changes in HK1 Cells
Microscopic Observation of Apoptosis-Related
Morphological Changes
The effect of cardamonin on the morphology of HK1
cells was examined using an inverted microscope
(Figure 4). It was found that treatment with
cardamonin at IC50 concentration resulted in signifi-
cant changes in morphology of HK1 cells. Chromatin
condensation was first observed after 6 h of treatment,
followed by membrane blebbing and cell shrinkage
about 9 h later. Ultimately, nuclear fragmentation and
apoptotic bodies were observed after 12 h and 18 h,
respectively. These morphological changes indicate
that cardamonin induces apoptosis in HK1 cells.
Apoptosis Investigation Using Acridine Orange/
Propidium Iodide Double Staining Assay
HK1 cells treated with cardamonin at about (1  IC50)
concentration for 24 h and 48 h were double-stained
with two DNA-binding dyes; acridine orange (AO)
and propidium iodide (PI) to identify stages of apop-
tosis occurring in a time-dependent manner (Figure
5). Untreated cells were also double-stained with the
dyes. The untreated cells showed green fluorescence
with normal cell morphology after 24 h, while carda-
monin-treated cells showed orange-coloured nuclei
after 24 h indicating the induction of late apoptosis in
the cells. The cells exhibited darker orange-coloured
fluorescence after 48 h. However, cells with fully red-
coloured fluorescence, indicating necrosis, were not
observed even after 48 h treatment. This further
proves that cardamonin induces apoptosis in
HK1 cells.
Cardamonin Induced Apoptosis in HK1 Cells via
the Extrinsic Pathway
Cardamonin Activated Caspase-3 and Caspase-8 but
Had No Effect on Caspase-9
Apoptosis in cells can be induced via the intrinsic
(mitochondrial) or the extrinsic pathway. The activa-
tion of caspases is considered to be a main indicator

Figure 4. Morphology of HK1 cells treated with cardamonin at IC50 concentration as seen under the microscope. Apoptosis-related
morphological features, such as chromatin condensation and nuclear fragmentation, were clearly observed and marked with
Red Arrows.
of apoptosis, and caspase-3 is considered to be the
most crucial one (17, 18). In the intrinsic pathway,
caspase-3 is activated by caspase-9, while the extrinsic
pathway involves the activation of caspase-3 by cas-
pase-8 (19). Therefore, the effect of cardamonin on
caspase activation was investigated in order to under-
stand the mechanism of apoptosis induced by it in
HK1 cells. Caspase-3 and caspase-8 activation was
investigated using Caspase-3 and Caspase-8
Colorimetric Assay Kit, respectively. The results
showed that cardamonin activated caspase-3 and cas-
pase-8 while the caspase inhibitor decreased the activ-
ity of each caspase to almost that of the untreated
cells (Figure 6). Therefore, results indicate that carda-
monin causes caspase-dependent apoptosis in HK1
cells via the extrinsic pathway.
Caspase-9 activity after treatment with cardamonin
was investigated via qPCR analysis. The analysis
showed that caspase-9 mRNA expression level did not
NUTRITION AND CANCER 7
change after treatment with cardamonin (Figure 7).
This shows that cardamonin induced apoptosis inde-
pendent of caspase-9 activation.
Cardamonin Had No Effect on Expression Level of
Intrinsic Apoptosis-Related Proteins
In order to further confirm that cardamonin induced
apoptosis in HK1 cells via the extrinsic pathway, we
examined cardamonin’s effect on the expression levels
of proteins related to the intrinsic apoptosis pathway,
via Western blotting. These proteins included the
anti-apoptotic proteins; Bcl-XL and Bcl-2 as well as
the pro-apoptotic protein; Bax. Results of the Western
blot analysis showed that cardamonin failed to signifi-
cantly regulate the expression levels of Bcl-XL, Bcl-2
and Bax (Figure 8). This further shows that cardamo-
nin induced apoptosis in HK1 cells via the extrinsic
pathway and not the intrinsic pathway.
8 M. K. B. BREAK ET AL.

Figure 5. (A) Untreated cells showed green fluorescence with no signs of apoptosis or necrosis. (B & C) Orange-coloured fluores-
cence was observed after treatment of HK1 cells with cardamonin at about (1  IC50) concentration for 24 h. This represents the
hallmark of late apoptosis. (D & E) A darker orange-coloured fluorescence was observed after 48 h of treatment, representing late
apoptosis. No necrotic cells were observed.

Figure 6. Caspase-3 and Caspase-8 activity in HK-1 cells after
treatment with cardamonin at about (1  IC50) concentration
for 24 h. Some cardamonin-treated cells were also treated with
a caspase inhibitor for 24 h. The assay was repeated three
times. Bars and error bars refer to mean ± S.D. p < 0.05 vs.
control, p < 0.001 vs. control.
Figure 7. mRNA expression of caspase-9 in HK1 cells after
treatment with cardamonin at about (1  IC50) concentration
for 24 h, as determined by qPCR. mRNA expression levels were
normalized to GAPDH and compared with the untreated con-
trol. The assay was repeated three times. Bars and error bars
refer to mean ± S.D. The result was statistically not significant.
 NUTRITION AND CANCER 9

Cardamonin Increased the Mitochondrial Membrane

Figure 8. Western blot analysis of intrinsic apoptosis-related
proteins. HK1 Cells were treated with cardamonin at about
(1  IC50) concentration for 3, 6, 9 and 12 h. GAPDH was used
as an internal control. Results showed no significant changes
in the protein expression levels indicating that cardamonin did
not induce apoptosis via the intrinsic pathway.
Potential in HK1 Cells
The intrinsic (mitochondrial) apoptotic pathway
involves the release of certain apoptogenic proteins,
from the mitochondria, and that is usually accompa-
nied by a decrease in the mitochondrial membrane
potential (20). Therefore, it is possible to investigate
whether cardamonin induced apoptosis via the intrin-
sic pathway by measuring the change in the mito-
chondrial membrane potential.
In this study, mitochondrial membrane potential
was assessed by JC-1 staining of HK1 cells. At high
membrane potential, JC-1 forms red-fluorescent
aggregates, while green-fluorescent monomers are
formed at low membrane potential. Therefore, the

Figure 9. Mitochondrial membrane potential was assessed by JC-1 staining of HK1 cells after 3 h treatment with cardamonin at
about (1  IC50) concentration followed by measuring the resulting fluorescence. Results showed that cardamonin increased the
mitochondrial membrane potential of HK1 cells indicating that cardamonin induced apoptosis independent of the mitochondria.
(A) Representative images of JC-1 staining from control and treated groups; JC-1 shows red fluorescence at high membrane poten-
tial, while green fluorescence is manifested at low membrane potential (B) The changes in the mitochondrial membrane potential
of HK1 cells were represented as ratio between red and green fluorescence of JC-1. Data were normalized to control as 100%. The
assay was repeated three times. Bars and error bars refer to mean ± S.D. p < 0.05 vs. control.
10 M. K. B. BREAK ET AL.
Figure 10. Flow cytometric analysis of cell-cycle parameters following 12 h of treatment with cardamonin at about (1  IC50) con-
centration in HK1 cells. Results are representative of three independent experiments.
fluorescence ratio of red to green was used to detect
and measure changes in the mitochondrial membrane
potential. Results of the assay showed that cardamo-
nin caused a 5-fold increase in the red/green fluor-
escent ratio which indicates that cardamonin resulted
in an increase in the mitochondrial membrane poten-
tial of HK1 cells (Figure 9). Therefore, it can be
deduced that cardamonin did not induce apoptosis
via the intrinsic (mitochondrial) pathway, rather it
induced apoptosis via the extrinsic pathway as has
been shown by the other assays that were conducted
in this study.
Cardamonin Induced G2/M-Phase Cell-Cycle Arrest
Accompanied by an Increase in the Apoptotic
Population in HK1 Cells
Cell cycle is the set of events that take place in order
to enable cell division, and it consists of phases; G1, S
and G2/M phase (21). Cell cycle analysis of HK1 cells
treated with cardamonin for 12 h showed an increase
in the proportion of cells in the G2/M phase (49.57%
compared to 3.58% in the control (untreated) cells).
There was also a slight increase in the proportion of
cells at the S-phase (39.23% compared to 26.01% in
the control (untreated) cells) and a decrease in the
number of cells in the G1-phase (11.20% compared to
70.41% in the control (untreated) cells). It is also
important to note that the number of apoptotic cells
in the sub-G1-phase has significantly increased after
treatment, which further shows that cardamonin
causes apoptosis in HK1 cells (36.91% compared to
2.64% in the control (untreated) cells) (Figure 10).
Therefore, it can be deduced that cardamonin induces
G2/M-phase cell-cycle arrest in HK1 cells.
Conclusion
In this study, the cytotoxic activity of B. rotunda
extracts and some of its pure constituents were eval-
uated against nasopharyngeal carcinoma (HK1) cells
for the first time. Cardamonin, a chalcone from B.
rotunda, demonstrated the highest cytotoxic activity
with low effect on healthy normal NP69 cells.
Furthermore, it inhibited the migration of HK1 cells
and induced apoptosis via the extrinsic pathway. This
research contributes toward a better understanding of
cardamonin’s cytotoxic activity on a type of cells that
was not examined in detail before, and the positive
results obtained are expected to encourage more stud-
ies to be conducted in the future to fully assess carda-
monin’s potential as an anticancer agent.
Disclosure of Interest
The authors report no conflict of interest.
Authors’ Contributions
M.K.B. and M.C. performed the experiments, analyzed the
results and wrote the manuscript. C.W., C.F.C. and T.J.K.
supervised the research study and provided the necessary
laboratory equipment and some funding for the project.
A.S.B.K provided the research team with the HK1 cells that
were used in the study. Authors have approved the submis-
sion of the manuscript.

Funding
This work was supported by Public Service Department of
Malaysia (JPA).
References
1. Han P, Chen R-H, Wang F, Zeng J-Y, Yu S-T, Xu L-
H, Cai Q, Liang F-Y, Xia T-L, Lin Z-R, et al. Novel
chimeric transcript RRM2-c2orf48 promotes metasta-
sis in nasopharyngeal carcinoma. Cell Death Dis.
2017;8(9):e3047. doi:10.1038/cddis.2017.402
2. Newman DJ, Cragg GM. Natural products as sources
of new drugs from 1981 to 2014. J Nat Prod. 2016;
79(3):629–61. doi:10.1021/acs.jnatprod.5b01055
3. Eng-Chong T, Yean-Kee L, Chin-Fei C, Choon-Han
H, Sher-Ming W, Li-Ping CT, Gen-Teck F, Khalid N,
Abd Rahman N, Karsani SA, et al. Boesenbergia
rotunda: From ethnomedicine to drug discovery.
Evid-Based Complement Altern Med. 2012;2012:1–25.
doi:10.1155/2012/473637
4. Jing LJ, Mohamed M, Rahmat A, Bakar MFA.
Phytochemicals, antioxidant properties and anticancer
investigations of the different parts of several gingers
species (Boesenbergia rotunda, Boesenbergia pulchella
var attenuata and Boesenbergia armeniaca). J Med
Plants Res. 2010;4:27–32.
5. Kirana C, Record IR, McIntosh GH, Jones GP.
Screening for antitumor activity of 11 species of
Indonesian Zingiberaceae using human MCF-7 and
HT-29 cancer cells. Pharm Biol. 2003;41(4):271–6.
doi:10.1076/phbi.41.4.271.15673
6. Sukari MA, Ching AYL, Lian GEC, Rahmani M,
Khalid K. Cytotoxic constituents from Boesenbergia
pandurata (roxb.) schltr. Nat Prod Sci. 2007;13:110–3.
7. Isa NM, Abdul AB, Abdelwahab SI, Abdullah R,
Sukari MA, Kamalidehghan B, Hadi AHA, Mohan S.
Boesenbergin A, a chalcone from Boesenbergia
rotunda induces apoptosis via mitochondrial dysregu-
lation and cytochrome c release in A549 cells in vitro:
Involvement of HSP70 and Bcl2/Bax signalling path-
ways. J Funct Foods. 2013;5(1):87–97. doi:10.1016/j.jff.
2012.08.008
8. James S, Aparna JS, Paul AM, Lankadasari MB,
Mohammed S, Binu VS, Santhoshkumar TR, Reshmi
G, Harikumar KB. Cardamonin inhibits colonic neo-
plasia through modulation of MicroRNA expression.
Sci Rep. 2017;7(1):13945. doi:10.1038/s41598-017-
14253-8
9. Mohammed IA, Akhtar MN, Biau FJ, Tor YS, Zareen
S, Binti Shahabudin S, Binti Abd Hamid H, Ul Haq
Z, Khalil R, Khalaf RM, et al. Isolation of cardamonin
and pinostrobin chalcone from the rhizomes of
Boesenbergia rotunda (L.) Mansf. and their cytotoxic
effects on H-29 and MDA-MB-231 cancer cell lines.
Nat Prod J. 2019;9(4):341–8. doi:10.2174/
2210315509666190117151542
NUTRITION AND CANCER 11
10. Huang DP, Ho JHC, Poon YF, Chew EC, Saw D, Lui
M, Li CL, Mak LS, Lai SH, Lau WH, et al.
Establishment of a cell line (NPC/HK1) from a differ-
entiated squamous carcinoma of the nasopharynx. Int
J Cancer. 1980;26(2):127–32. doi:10.1002/ijc.
2910260202
11. Ching AYL, Wah TS, Sukari MA, Lian GEC,
Rahmani M, et al. Characterization of flavonoid deriv-
atives from Boesenbergia rotunda (L.). Malaysian J
Anal Sci. 2007;11:154–9.
12. Morikawa T, Funakoshi K, Ninomiya K, Yasuda D,
Miyagawa K, Matsuda H, Yoshikawa M. Medicinal
foodstuffs. XXXIV. Structures of new prenylchalcones
and prenylflavanones with TNF-a; and aminopepti-
dase N inhibitory activities from Boesenbergia
rotunda. Chem Pharm Bull. 2008;56(7):956–62. doi:
10.1248/cpb.56.956
13. Park S, Gwak J, Han SJ, Oh S. Cardamonin sup-
presses the proliferation of colon cancer cells by pro-
moting b-catenin degradation. Biol Pharm Bull. 2013;
36:1040–4.
14. Gonçalves LM, Valente IM, Rodrigues JA. An over-
view on cardamonin. J Med Food. 2014;17(6):633–40.
doi:10.1089/jmf.2013.0061
15. Niu P-G, Zhang Y-X, Shi D-H, Liu Y, Chen Y-Y,
Deng J. Cardamonin inhibits metastasis of Lewis lung
carcinoma cells by decreasing mTOR activity. PLoS
One. 2015;10(5):e0127778. doi:10.1371/journal.pone.
0127778
16. Nandakumar N, Muthuraman S, Gopinath P, Nithya
P, Gopas J, Kumar RS. Synthesis of coumaperine
derivatives: Their NF-jB inhibitory effect, inhibition
of cell migration and their cytotoxic activity. Eur J
Med Chem. 2017;125:1076–87. doi:10.1016/j.ejmech.
2016.10.047
17. Nomura M, Takahashi T, Uesugi A, Tanaka R,
Kobayashi S. Inotodiol, a lanostane triterpenoid, from
Inonotus obliquus inhibits cell proliferation through
caspase-3-dependent apoptosis. Anticancer Res. 2008;
28(5A):2691–6.
18. Gong L, Tang Y, An R, Lin M, Chen L, Du J. RTN1-
C mediates cerebral ischemia/reperfusion injury via
ER stress and mitochondria-associated apoptosis path-
ways. Cell Death Dis. 2017;8(10):e3080. doi:10.1038/
cddis.2017.465
19. Ichim G, Tait SWG. A fate worse than death: apop-
tosis as an oncogenic process. Nat Rev Cancer. 2016;
16(8):539–48. doi:10.1038/nrc.2016.58
20. Henry-Mowatt J, Dive C, Martinou J-C, James D.
Role of mitochondrial membrane permeabilization in
apoptosis and cancer. Oncogene. 2004;23(16):2850–60.
doi:10.1038/sj.onc.1207534
21. Ding D, Guo Y-R, Wu R-L, Qi W-Y, Xu H-M. Two
new isoquinoline alkaloids from Scolopendra subspi-
nipes mutilans induce cell cycle arrest and apoptosis
in human glioma cancer U87 cells. Fitoterapia. 2016;
110:103–9. doi:10.1016/j.fitote.2016.03.004