Accepted Manuscript

Title: Methylation of PARP-1 promoter involved in the regulation of nano-SiO2 -induced decrease of PARP-1 mRNA expression Authors: Chunmei Gong, Gonghua Tao, Linqing Yang, Jianjun Liu, Qingcheng Liu, Wenjie Li, Zhixiong Zhuang PII: DOI: Reference: To appear in: Received date: Revised date: Accepted date: S0378-4274(12)00023-9 doi:10.1016/j.toxlet.2012.01.007 TOXLET 7856 Toxicology Letters 28-11-2011 6-1-2012 6-1-2012

Please cite this article as: Gong, C., Tao, G., Yang, L., Liu, J., Liu, Q., Li, W., Zhuang, Z., Methylation of PARP-1 promoter involved in the regulation of nanoSiO2 -induced decrease of PARP-1 mRNA expression, Toxicology Letters (2010), doi:10.1016/j.toxlet.2012.01.007 This is a PDF le of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its nal form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Highlights

>exposure to nano-SiO2 decreased PARP-1 expression in mRNA and protein level.>PARP-1 expression was regulated by site specific

following DNMT1 knock down.

Ac ce p

te

an
Page 1 of 31

us

DNMT1 knock down. >the level of PARP-1 methylation was also restored

cr

methylation in its promoter.>PARP-1 expression was restored following

ip t

Methylation of PARP-1 promoter involved in the regulation of nano-SiO2-induced decrease of PARP-1 mRNA expression

Chunmei Gonga,b, Gonghua TaobLinqing Yangb, Jianjun Liub, Qingcheng Liu a, Wenjie

School of Public Health, Zhengzhou University, 100 Kexue Boulevard Zhengzhou, Henan

450001, PR China;
b

Shenzhen Center for Disease Control and Prevention, No8. Longyuan Road, Shenzhen

518055, PR China;

Correspondence to Dr. Zhixiong Zhuang, Key Laboratory of Modern Toxicology of

Ac ce p

75525639066; Fax: (+86) 75525639066.

te

Nanshan District, Shenzhen, 518055, CHINA, Email: zxzhuang2007@126.com Tel: (+86)

Shenzhen, Shenzhen Centre for Disease Control and Prevention, No8. Longyuan Road,

an
Page 2 of 31

us

cr

Lia, Zhixiong Zhuangb,*

ip t

Abstract

Nano silicon dioxide (nano-SiO2) is becoming more and more widely applied in the fields of industry. The potential toxic effects of nano-SiO2 and its hazard to human health are drawing more attention. The mRNA expression of poly(ADP-ribose) polymerases-1(PARP-1), a pivotal repair gene, has been decreased by nano-SiO2 exposure. However, the effect of

not been reported. In this study, HaCaT cells with or without DNA methyltransferase 1(DNMT1) knock down were incubated with nano-SiO2 and then further treated with DNMT inhibitor, 5-aza-2-deoxycytidine (DAC),

and western blotting were used to examine the mRNA and protein expression of PARP-1. For promoter methylation status of PARP-1, methylation-specific PCR (MSP) and Bisulfite sequencing assay were performed. Results showed a dramatic decrease of PARP-1 expression on mRNA and protein level and a simultaneously obvious increase in the level of PARP-1 methylation in nano-SiO2-treated cells compared to the control group. Further, the expression and promoter methylation of PARP-1 in HaCaT cells were restored following DNMT1 knock down, suggesting that the effects of PARP-1 promoter hypermethylation are mediated at least in

Ac ce p

te

which is a kind of key epigenetic modification reagents. Real-time Q-PCR

an

epigenetic modification on nano-SiO2-induced low PARP-1 expression has

us

cr

ip t

Page 3 of 31

part by DNMT1. Taken together, methylation of PARP-1 promoter might be involved in the regulation of nano-SiO2-induced decrease of PARP-1 expression. Key words: nano silicon dioxide; nano-SiO2; DNA methylation; PARP-1

Ac ce p

te

an
Page 4 of 31

us

cr

ip t

Introduction

Nano silicon dioxide (nano-SiO2) is becoming more and more widely applied in the fields of industry. The potential toxic effects of nano-SiO2 and its hazard to human health are drawing more attention, because they possess novel properties that are different from those of microsized materials. The results from various studies suggest that these nanomaterials may cause

inflammatory responses via dysfunction of mitochondria or inflammasomes. It is well known that crystalline silica (alpha-quartz) is one of the most serious occupational hazards in mining industries, and has been considered

International Agency for Research on Cancer (IARC) upgraded crystalline silica to a human carcinogen (group 1) based on the epidemiological and the laboratory animal studies (Rothen-Rutishauser et al., 2006) . Extensive data exist regarding biological responses (e.g., oxidative stress) of respiratory tract and lung cells after silica (including micro- and nano-sized silicon dioxide) exposed, the significant attention has been focused on the inspiration of airborne nanosilica and its consequent pulmonary toxicity. To date, however, there is only limited data available on toxicology and biological effect of nano-sized SiO2 on human skin cells-another avenue for

Ac ce p

te

to be the main cause of silicosis in humans. Furthermore, in 1996 the

an

DNA damage by an indirect pathway through promoting oxidative stress and

us

cr

ip t

Page 5 of 31

nanoparticle exposure, especially, when these nanomaterials are produced for biomedical or cosmetic applications. In this context, human keratinocyte cells were chosen for evaluation of dermal toxicity of nano-SiO2 particles. Poly(ADP-ribose) polymerases (PARP) constitute a family of enzymes

recombination, proliferation and genomic stability(Burkle, 2001) PARP is responsible for an early cellular response to DNA damage caused by

cells. PARP is specifically activated by DNA single or double strand breaks, and poly(ADP-ribosylation) is induced after treatment of cells with DNA

was found in a complex with DNMT1, the histone H3K9 methyltransferase G9a and the histone ubiquitin ligase Np95, indicative of a link between poly(ADP-ribosylation) and the epigenome (Shall and de Murcia, 2000) and was described as a fundamental constituent of the transcription machinery that interacts with and modulates the activities of several transcription factors(Kraus, 2008) .However, the potential toxic mechanisms of nano-SiO2 remained unknown. Gaos study suggested that silicon dioxide increased the formation of -H2AX and inhibited the expression of PARP mRNA and

Ac ce p

2000) . PARP-1, the founding member of the PARP family (18 members),

te

increases genomic instability and accelerates apoptosis(Shall and de Murcia,

damaging agents(Delaney et al., 2000) .PARP inactivation or cleavage

an

numerous endogenous and environmental genotoxic agents in mammalian

us

cr

involved in the regulation of many cellular processes such as DNA repair,

ip t

Page 6 of 31

protein in Hela cells(Gao et al., 2009) Therefore, PARP-1 is investigated in this study.

Our present study has shown that nano-SiO2 decreases the mRNA

is thought to be involved in carcinogenesis. However, the detailed mechanisms responsible for low PARP-1 expression have not yet been

epigenetic phenomenon that modulates gene expression via the recruitment of transcription factors. Site-specific methylation within promoters has, in

nano-SiO2-treated cells.

Materials and methods

Materials 15-nm SiO2 as used in our previous study (Gong et al., 2011) was purchased from Wan Jing New Material Co. Ltd. (Hangzhou, Zhejiang, China)and

Ac ce p

whether PARP-1 expression is regulated by an epigenetic mechanism in

te

regulated genes. Therefore, our present studies for the first time focus on

many cases, been associated with the transcriptional silencing of specifically

an

elucidated. It has been suggested that DNA methylation is the first step in

us

cr

expression of PARP-1, a pivotal repair gene. Low expression of the PARP-1

ip t

Page 7 of 31

micro-sized SiO2 (1-5 m) and 5-aza-deoxycytidine (DAC)were supplied by Sigma-Aldrich (Sigma, SL, USA). Human epidermalkeratinocyte cell line HaCaT was purchased from China Centerfor Type Culture Collection (Wuhan, Hubei, China). Lentiviral vector-mediated RNAi HaCaT cell with

MEM culturemedia were purchased from Hyclone Laboratories, Inc. (Logan, UT, USA). Fetal bovine serum (FBS), penicillin-streptomycin for cell

USA). Plasmids and lentivirus infections

fluorescent protein (control vector) and pLKO.1-shDNMT-1(B1, B2, B3, B4), were generously provided by Dr W.C.Hahn (Dana Farber Cancer Institute, Boston, MA) from the RNAi Consortium at the Broad Institute. To introduce short hairpin RNAs (shRNAs), pLKO.1 lentivirus vector system was used. The following were targeting sequences for DNMT1: B1:CGAGAAGAATATCGAACTCT;B2:CGAGAAGAATATCGAACTCT; B3:CGACTACATCAAAGGCAGCA;B4:GCCGAATACATTCTGATGGA; Control shRNAs was targeted against GFP. Infections were performed serially by using drug selection to purify cell populations 48 h after infection.

Ac ce p

te

The small hairpin RNA-expressing vectors, pLKO.1-small hairpin green

an

culture and trypsin were purchased from Gibco/Invitrogen (Carlsbad, CA,

us

cr

DNMT1 knock down (H-shDNMT1) was constructed by our laboratory.

ip t
Page 8 of 31

pLKO.1-small hairpin green fluorescent protein and pLKO.1-shDNMT-1 were introduced into HaCaT cell using lentiviral infection followed by selection with puromycin (1.0 g/ml) to generate stable shDNMT-1-expressing cell lines as described previously(Hahn et al., 2002) . Cell culture and the treatment with SiO2 particles

HaCaT cell with or without DNMT1 knock down were cultured in MEM

particles of different concentration was administered for 24 h when the cell confluence reached up to 80%.The final concentration of nano-SiO2 particles

was treated to 10g/mLnano-SiO2 cells at the concentration of 3M for 48 h. HaCaT cell with DNMT1 knock down cells was treated with 10g/mL nano-SiO2 particles.

Bisulfite Modification of DNA from HaCaT cells treated by nano-SiO2 particles

Genomic DNA was prepared from the cultured cells using Tissue Genomic Extraction Kit (Omega, GA, USA) according to the manufacturers instructions. Genomic DNA (1g) was denatured by adding freshly prepared

Ac ce p

te

For the DNMTs inhibition group, 5-aza-deoxycytidine (DAC, St Louis, MO)

was 2.5, 5, 10g/mL nano-SiO2 particles and 10g/mL micro-SiO2 particles,

an

media containing 10% FBS, 5% carbon dioxide (CO2) at 37. SiO2

us

cr
Page 9 of 31

ip t

3M NaOH and incubating at 55 for 20 min. For complete denaturation, the samples were incubated at 95 for 5min and immediately cooled on ice. Bisulfate solution was prepared by dissolving 5.4 g of sodium bisulfate in 10mL water, adding 666L of a 40mM hydroquinone solution and adjusting

denatured DNA, mixed and incubated at 55 for 16 h in the dark. The DNA was recovered by using the Wizard DNA Clean-Up System (Promega,

4L of 3M NaOH was added, and the samples were incubated for 15 min at 37. The solution was then neutralized by addition of 6M ammonium

Qualitative analysis of DNA methylation by MSP After sodium bisulfite conversion, methylation analysis was performed by PCR assay. The following primer sets were used: for methylated DNA, MF-PARP-1 (5'-GTAGCGGTTCGTAGAGTTTTATTC-3') and MR-PARP-1 (5'-TAATACCTAACCGCGAAAACG-3'), 134 bp fragment (-285 to -154 relative to transcription start site), was chosen to amplify by M primerand for unmethylated DNA, UF-PARP-1 (5'-GGTAGTGGTTTGTAGAGTTTTATTT-3') and

Ac ce p

te

dried and resuspended in 20L of water.

acetate (pH 7.0). The DNA was ethanol precipitated, washed in 70% ethanol,

an

Madison, WI, USA) followed by elution in 40L of water. Subsequently,

us

cr

the pH to 5.0 with 10M NaOH. The bisulfite solution was added to the

ip t

Page 10 of 31

UR-PARP-1 (5'-CTAATACCTAACCACAAAAACACC-3'), a 132 bp fragment (-286 to -155 relative to transcription start site), was chosen to amplify by F primer. Specificity of the reactions for methylated DNA was confirmed separately using human sperm DNA (with very low levels of CpG island

Chemicon, CA, USA) .

Quantitation of DNA methylation by bisulfite sequencing

Genomic DNA was treated with bisulfite as described above. A 132 bp fragment of the PARP-1 promoter representing nucleotides -286bp to -155bp

Biotech CO., Dalian, China), and transfected into E. coli JM109; 10 positive clones from each cell line were selected, followed by sequencing with M13 primers. The number of methylated CpGs at a specific site was divided by the number of clones analyzed (n=10 in all cases) to yield a percentage of methylation at each site. Average percent methylation across all CpG sites was calculated by the number of methylated CpGs divided by the total number of CpGs .

Ac ce p

te

amplified. The PCR fragment was cloned into the pMD20-T vector (TaKaRa,

relative to the transcription start site, located in the methylated region, was

an

us
Page 11 of 31

cr

methylation) and Universal Methylated DNA (heavily methylated,

ip t

Real-time RT-PCR Total RNA was extracted by Trizol Reagent (Invitrogen, AL, USA).

RT reagent Kit (Takara, Dalian China). Quantitative PCR was performed using SYBR-Premix Ex Taq (Takara, Dalian China) and an MX4000

cDNA molecules was normalized to that of ACTB. The sequences of primers for PARP-1, DNMT1and -actin were obtained from by primer 5

AGCGTGCTTCAGTTCATAC-3' as reverse for PARP-1, 5-ACGACCCTGACCTCAAATAT-3 as forward and 5-CCATTAACACCACCTTCAAG A-3as reverse for DNMT1, Simultaneously, -actin was applied as the internal control and amplified with the following primers: 5'-TGGCACCCAGCACAATGAA-3' and 5'CTAAGTCATAGTCCGCCTAGAAGCA-3'. Western blotting

Cells were lysed in 2D lysis buffer (10 mM Tris-HCl, pH=7.5, 7 M Urea, 2 M Thiourea, 4% CHAPS, 2 M Thiourea) with a protease inhibitor cocktail III (Sigma, SL, USA). Protein samples were subjected to western blotting

Ac ce p

te

and were as follows:5'- CCCAGGGTCTTCGGATAG -3' as forward and 5'-

an

us

Cycler Thermal Cycler (Bio-Rad Laboratories, CA, USA). The number of

cr

ip t
Page 12 of 31

The cDNA was synthesized from 2g of total RNA using Prime-Script

using antibodies (Santa Cruz, CA, USA) to PARP-1. The bands were visualized after incubation with chemiluminescent substrate (Thermo scientific, IL, USA). Statistical analysis

All determinations were repeated in triplicate. Data were presented as meansS.D. The comparisons of means were performed using Wilcoxon

samples (SPSS 16 for Windows).

Result

Establishment of HaCaT cells with DNMT1 knock down

exhibits similar biological properties to normal human keratinocyte, and it is an ideal cell model for studying dermal toxicity (Boukamp et al., 1988) .We have established transformed HaCaT cell clones with DNMT1 knock down. The knock-down effect of the corresponding genes transiently and stably was confirmed by real time quantitative PCR (Fig. 1 A and C) and Western blotting (Fig1. B and D). As expected, there is high transfection efficiency in retroviral transcription system and HaCaT cells transfected with small

Ac ce p

HaCaT is an immortalized epithelial cell line from adult human skin that

te

an

signedrank test for two samples or Kruskal-Wallis rank test for more

us

cr

ip t
Page 13 of 31

hairpins resulted in lower expression of DNMT-1 mRNA and protein than those with empty vector or the parental cells (Fig. 1). At the end of selection, the group transfected with B3 hairpin was chosen as the DNMT-1 knock down cell models. The cell groups were named H-shDNMT-1.

Down-regulation of PARP-1 mRNA expression in nano-SiO2 treated cells and restoration of PARP-1 expression by DNMT1 knock down Cells were treated by nano-SiO2 and followed by the epigenetic inhibitors DAC. PARP-1 mRNA expression was monitored by means of real time RT-PCR and Westernblot assay. Results showed a decreased gradually with

DNMT1 knock down can reactivate PARP-1 in mRNA and protein expression (Fig. 2 ).

DNA methylation in CpG island of PARP-1 promoter To assess whether CpGs hypomethylation was involved in transcriptional down-regulation of PARP-1 in nano-SiO2 treated HaCaT cells, we performed a MSP assay and bisulfite sequencing assay for quantitative analysis of DNA methylation.We detected DNA methylation at the CpGs of PARP-1 in different concentration group separately using the MSP assay

Ac ce p

te

protein expression in SiO2-treated cells compared to the control (p < 0.01).

increased concentration of nano-SiO2 particles in the PARP-1 mRNA and

an

us

cr

ip t
Page 14 of 31

qualitatively. Each group of cells had its specific unmethylated level (Fig. 3A), indicating that PARP-1 is unmethylated in the -290 to -159bp site. By analyzing the gray level of amplified fragment briefly, the unmethylation level was gradually decreased with increasing concentration of nano-SiO2

situation. (Fig. 3B). No distinct association was detected between the methylated level and the corresponding mRNA level at the observed

status of the PARP-1 promoter, bisulfite sequencing was used to determine the proportion of methylation at 22 CpG sites within the PARP-1 promoter.

(Fig. 3B and C). Taken together, these observations indicate that the down-regulation of PARP-1 expression nano-SiO2 treated cells is not associated with the total hypermethylation in the CpG island but site specific hypomethylation level.

Discussion

Cosmetic products containing nanoparticles, such as those used in skincare

Ac ce p

site specific methylation level was changed obviously in -229bp location.

te

10g/mL group, 3.18% in DAC group and 1.8% in sh-DNMT1 group, but

The average rate of methylation was1.8% in the control group, 4.09% in the

an

fragment in the promoter of PARP-1.To verify the CpG island methylation

us

cr

particles, the DAC and DNMT1 knocked down can partly reverse the

ip t
Page 15 of 31

treatments, have been on the market for a considerable period. The skin is the largest organ in the human body, which provides protection against heat, cold, electromagnetic radiation and chemical damage. Indeed, skin cells are likely to have the highest frequency of exposure to nanoparticles. Hence, a

is an immortalized epithelial cell line from adult human skin that exhibits similar biological properties to normal human keratinocyte, and is an ideal

the HaCaT human keratinocyte cell line as a model system. Some reports have indicated that intracellular generation of reactive oxygen

cellular processes (Lee and Lee, 2006) . For example, hydroxyl radicals can react with pyrimidines and/or purines as well as chromatin proteins, resulting in base modifications and genomic instability respectively all of which can cause alterations in gene expression (Fruehauf and Jr Meyskens, 2007) . In addition, data have implicated ROS accumulation as being a common phenomenon in many cancer cells. Such accumulation can cause direct DNA damage by increasing a cells mutation rate and/or promoting and maintaining the oncogenic phenotype by acting as a secondary

Ac ce p

oxidative stress is primarily attributed to the genotoxicity of ROS in diverse

te

2009; Nabeshi et al., 2011; Wang et al., 2009) .The carcinogenicity of

species (ROS) is induced by silicon dioxide nanoparticles (Eom and Choi,

an

cell model for studying dermal toxicity. Based on this consideration, we use

us

cr

safety evaluation of nanoparticles using dermal cells is essential. HaCaT cell

ip t

Page 16 of 31

messenger in intracellular signaling cascades(Valko et al., 2006) . In addition to causing genetic changes, ROS may lead to epigenetic alterations that affect the genome and play a key role in the development of human carcinogenesis(Campos et al., 2007) . More specifically, ROS production is

2010) . In addition, ROS-induced oxidative stress can contribute to gene silencing by mechanisms that involve aberrant hypermethylation of tumor

malignant phenotype.

Our study indicated that the decreased expression of PARP-1 mRNA in nano-SiO2-treated HaCaT cells was restored by the DNMT1 knock down alone. The restoration of PARP-1 expression by DNMT1 knock down suggested that PARP-1 down-regulation might be due to aberrant hypermethylation in the PARP-1 promoter. Using MSP and bisulfite sequencing, here we found that the transcriptional decrease of PARP-1 expression in HaCaT cells induced by nano-SiO2 was mediated by specific combinations of epigenetic modifications.

Ac ce p

real time RT-PCR, Western blotting, MSP and bisulfate sequencing assay.

te

mechanism of PARP-1 gene expression in nano-SiO2-treated HaCaT cells by

In this study, we analyzed for the first time the epigenetic regulatory

an

suppressor gene promoter regions and thus lead towards progression to a

us

cr

associated with alterations in DNA methylation patterns(Donkena et al.,

ip t

Page 17 of 31

PARP-1 plays a critical role in the maintenance of chromosome stability. Importantly, PARP-1 is involved in the diverse molecular and cellular functions including transcription, DNA repair and recombination, chromatin remodeling, genome stability(Tong et al., 2001) . PARP-1 is an abundant and

of DNA damage by direct binding to DNA breaks through its zinc finger domains(Kim et al., 2004) . Low expression of the PARP-1, a pivotal repair

present study has shown that the mRNA expression of PARP-1 was inhibited by nano-SiO2. However, the mechanisms responsible for low

It is well recognized that methylation of CpG island located within promoter regions of genes may silence gene expression, described as a hallmark in human cancer. This represents findings early during carcinogenesis and is maintained by DNMTs. Such methylation of the PARP-1 promoter region may be associated with loss of gene expression as reported for benzene-induced 16HBE cells(Gao et al., 2010) . DNA methylation appears to be an important controlling factor in gene expression particularly when found in CpG islands in promoter

Ac ce p

2003) .

te

the epigenetic events can modulate gene expression silence(Herman and Baylin,

PARP-1 expression have not yet been elucidated. It has been suggested that

an

gene, is thought to be involved in carcinogenesis(Delaney et al., 2000) . Our

us

cr

constitutively expressed nuclear protein that is activated upon the induction

ip t
Page 18 of 31

regions(Stirzaker et al., 2004) . In general, loss of DNA methylation can lead to gene activation, whereas inactive genes are often methylated(Jaenisch and Bird,
2003) .

Therefore, our present studies for the first time focus on whether PARP-1

cells. To test whether methylation of the PARP-1 promoter was responsible for silencing its expression, the demethylating agent DAC and DNMT1

inhibitors DAC alone or DNMT1 knock-down can partly reversed nano-SiO2-induced decrease of PARP-1 mRNA expression, but in this study

72hs(Ji et al., 2008; Zhang et al., 2008) , even 150hs (Chik and Szyf, 2011) in our study the time was 48h.

Taken together, these results will be useful in clarifying the relationship between PARP-1 methylation and its expression, thereby providing a potential target for treatment of cancer and a powerful tool for early diagnosis.

Ac ce p

enough, in most experiment the exposure time of DAC was as long as

te

role of DNMT1 knock down, maybe because the exposure time is not long

the effect of DAC on reversal of PARP-1 expression is as significant as the

an

knock-down cells was applied to this study. The data showed that epigenetic

us

cr

expression is regulated by an epigenetic mechanism in nano-SiO2-treated

ip t
Page 19 of 31

Conflict of interest

None of the authors has any potential conflict of interest or financial interests to disclose.

Acknowledgments

This work was supported by the National Natural Science Foundation of

[200901017].

Reference
Boukamp, P., Petrussevska, R.T., Breitkreutz, D., Hornung, J., Markham, A., Fusenig, N.E., 1988. Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. J Cell Biol 106, 761-771. Burkle, A., 2001. Physiology and pathophysiology of poly(ADP-ribosyl)ation. Bioessays 23, 795-806.

Campos, A.C., Molognoni, F., Melo, F.H., Galdieri, L.C., Carneiro, C.R., D'Almeida, V., Correa, M., Jasiulionis, M.G., 2007. Oxidative stress modulates DNA methylation during melanocyte anchorage blockade associated with malignant transformation. Neoplasia 9, 1111-1121.

Chik, F., Szyf, M., 2011. Effects of specific DNMT gene depletion on cancer cell transformation and breast cancer cell invasion; toward selective DNMT inhibitors. Carcinogenesis 32, 224-232. Delaney, C.A., Wang, L.Z., Kyle, S., White, A.W., Calvert, A.H., Curtin, N.J., Durkacz,

Ac ce p

te

an

China [30972505] and Shenzhen Science Technology Plan Key Project

us

cr
Page 20 of 31

ip t

B.W., Hostomsky, Z., Newell, D.R., 2000. Potentiation of temozolomide and topotecan growth inhibition and cytotoxicity by novel poly(adenosine diphosphoribose) polymerase inhibitors in a panel of human tumor cell lines. Clin Cancer Res 6, 2860-2867. Donkena, K.V., Young, C.Y., Tindall, D.J., 2010. Oxidative stress and DNA methylation in prostate cancer. Obstet Gynecol Int 2010, 302051.

Eom, H.J., Choi, J., 2009. Oxidative stress of silica nanoparticles in human bronchial epithelial cell, Beas-2B. Toxicol In Vitro 23, 1326-1332.

death?. Clin Cancer Res 13, 789-794.

expression of poly (ADP-ribose) polymerase mRNA and protein. Cell Biol Int 33, 749-754.

Gao, A., Zuo, X., Liu, Q., Lu, X., Guo, W., Tian, L., 2010. Methylation of PARP-1 promoter involved in the regulation of benzene-induced decrease of PARP-1 mRNA expression. Toxicol Lett 195, 114-118.

Gong, C., Tao, G., Yang, L., Liu, J., He, H., Zhuang, Z., 2011. The role of reactive oxygen species in silicon dioxide nanoparticle-induced cytotoxicity and DNA damage in HaCaT cells. Mol Biol Rep.[ahead of print] Hahn, W.C., Dessain, S.K., Brooks, M.W., King, J.E., Elenbaas, B., Sabatini, D.M., DeCaprio, J.A., Weinberg, R.A., 2002. Enumeration of the simian virus 40 early region elements necessary for human cell transformation. Mol Cell Biol 22, 2111-2123. Herman, J.G., Baylin, S.B., 2003. Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med 349, 2042-2054. Jaenisch, R., Bird, A., 2003. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat Genet 33 Suppl, 245-254. Ji, W., Yang, L., Yu, L., Yuan, J., Hu, D., Zhang, W., Yang, J., Pang, Y., Li, W., Lu, J., Fu, J., Chen, J., Lin, Z., Chen, W., Zhuang, Z., 2008. Epigenetic silencing of

Ac ce p

te

an

Gao, A., Song, S., Wang, D., Peng, W., Tian, L., 2009. Effect of silicon dioxide on

us

Fruehauf, J.P., Jr Meyskens, F.L., 2007. Reactive oxygen species: a breath of life or

cr

ip t
Page 21 of 31

O6-methylguanine DNA methyltransferase gene in NiS-transformed cells. Carcinogenesis 29, 1267-1275. Kim, M.Y., Mauro, S., Gevry, N., Lis, J.T., Kraus, W.L., 2004. NAD+-dependent modulation of chromatin structure and transcription by nucleosome binding properties of PARP-1. Cell 119, 803-814.

Kraus, W.L., 2008. Transcriptional control by PARP-1: chromatin modulation,

enhancer-binding, coregulation, and insulation. Curr Opin Cell Biol 20, 294-302.

stress-mediated carcinogenesis. Mech Ageing Dev 127, 424-431.

T., Akase, T., Nagano, K., Abe, Y., Yoshioka, Y., Kamada, H., Itoh, N., Tsunoda, S., Tsutsumi, Y., 2011. Amorphous nanosilica induce endocytosis-dependent ROS generation and DNA damage in human keratinocytes. Part Fibre Toxicol 8, 1. Rothen-Rutishauser, B.M., Schurch, S., Haenni, B., Kapp, N., Gehr, P., 2006. Interaction of fine particles and nanoparticles with red blood cells visualized with advanced microscopic techniques. Environ Sci Technol 40, 4353-4359. Shall, S., de Murcia, G., 2000. Poly(ADP-ribose) polymerase-1: what have we learned from the deficient mouse model?. Mutat Res 460, 1-15. Stirzaker, C., Song, J.Z., Davidson, B., Clark, S.J., 2004. Transcriptional gene silencing promotes DNA hypermethylation through a sequential change in chromatin modifications in cancer cells. Cancer Res 64, 3871-3877. Tong, W.M., Cortes, U., Wang, Z.Q., 2001. Poly(ADP-ribose) polymerase: a guardian angel protecting the genome and suppressing tumorigenesis. Biochim Biophys Acta 1552, 27-37. Valko, M., Rhodes, C.J., Moncol, J., Izakovic, M., Mazur, M., 2006. Free radicals, metals and antioxidants in oxidative stress-induced cancer. Chem Biol Interact 160, 1-40. Wang, F., Gao, F., Lan, M., Yuan, H., Huang, Y., Liu, J., 2009. Oxidative stress

Ac ce p

te

an

Nabeshi, H., Yoshikawa, T., Matsuyama, K., Nakazato, Y., Tochigi, S., Kondoh, S., Hirai,

us

Lee, K.W., Lee, H.J., 2006. Biphasic effects of dietary antioxidants on oxidative

cr

ip t
Page 22 of 31

contributes to silica nanoparticle-induced cytotoxicity in human embryonic kidney cells. Toxicol In Vitro 23, 808-815. Zhang, W., Ji, W., Yang, J., Yang, L., Chen, W., Zhuang, Z., 2008. Comparison of global DNA methylation profiles in replicative versus premature senescence. Life Sci 83, 475-480.

with different hairpins. mRNA levels was measured by real-time PCR with input normalization by ACTB mRNA level. The results are expressed as

transfected with different hairpins at the end of puromycin selection The protein levels of DNMT1 with or without transfected with different hairpins as indicated were detected by immunoblotting. (B) Protein levels of DNMT-1 in HaCaT cells transfected with different hairpins for 24h. (D) Protein levels of DNMT-1 in HaCaT cells transfected with different hairpins at the end of puromycin selection.

Ac ce p

different hairpins for 24h, (C) mRNA levels of DNMT-1 in HaCaT cells

te

experiments.(A) mRNA levels of DNMT-1 in HaCaT cells transfected with

percentage of the controls (mean SEM) from three independent

an

Figure 1 DNMT-1 expression in HaCaT cells with or without transfected

us

Figures and table legend

cr
Page 23 of 31

ip t

Fig.2. PARP-1 expression in nano-SiO2-treated HaCaT cells with or without DNMT1 knock down. mRNA level was measured by real-time PCR with

percentage of the controls (mean SEM) from three independent experiments. (A) mRNA levels of PARP-1 in nano-SiO2-treated HaCaT

p<0.05 versus cells exposed to 10g/ml nano-SiO2 particles;

(B) The protein levels of PARP-1 in nano-SiO2-treated HaCaT cells with or

Fig.3. Methylation analysis on CpG island of PARP-1 gene. Quantitative methylation analysis of PARP-1 CpG island in HaCaT cells.(A) The amplification results were obtained from the MSP assay of region (286 to 154 bp) . The amplification fragments for primers specific to originally methylated and unmethylated DNA are indicated as M and U separately in each group. (B)Bisulfite sequencing on CpG island (-290 to -159bp) of the PARP-1 gene. For each cell line, 10 clones were selected for sequencing.

Ac ce p

found in cells treated with nano-SiO2 of different concentration .

te

Concentraton-dependent downregulation of PARP-1 protein expression was

without DNMT1 knock down as indicated were detected by immunoblotting.

an

cells with or without DNMT1 knock down .*p<0.05 versus control cells;

us

cr

input normalization by ACTB mRNA level. The results are expressed as

ip t

Page 24 of 31

Methylated CpG site and unmethylated CpG site were marked as solid circle () and open circle (), respectively. The CpG position relative to transcription start site was shown at top of each CpG site. (D) At each CpG site, the area filled with black represents the average percentage of

average percentage was shown at the end of each row.

Ac ce p

te

an
Page 25 of 31

us

cr

methylation across all CpG sites tested in cells indicated. The value of

ip t

Figure(s)

M an
Ctrl

us
pLKO B1 B2 B3 B4

cr
DNMT1

Fig.1.

i
190KD 37KD
GAPDH

ce pt

ed
D
Ctrl pLKO B1

B2

B3

B4

DNMT1 GAPDH

190KD 37KD

Ac

Page 26 of 31

Ac

ce pt

ed

M an

us

cr
Page 27 of 31

Fig.2.

Ac ce pt ed

M an

us

cr

Page 28 of 31

A
Ctrl M U Micro-SiO2 M U
2.5g/mL

5g/mL

M an
10g/mL

us
DAC H-shDNMT1

ed

cr
M U M U M U M U M U

Fig.3.

Ac

ce pt

i
Page 29 of 31

B HaCaT

H-shDNMT1
Page 30 of 31

Ac

DAC

ce pt

ed

10g/mL

M an

us

cr

M an

us

cr

i
HaCaT 10g/mL DAC H-shDNMT1

1.8%

ed

4.09%
3.18% 1.8%

Ac

ce pt
0% 10% 20% 30% 40% 60%

Page 31 of 31