Erwin Kristanto

Forensic Medicine and Medicolegal Departement

University of Sam Ratulangi
INTRODUCTION
DNA testing is to justice what the telescope is for the
stars; not a lesson in biochemistry,
not a display of the wonders of magnifying glass, but a
way to see things as they really are.
(Barry Scheck and Peter Neufeld, Actual Innocence)
History
 ‘DNA fingerprinting’ or DNA typing (profiling) as it is
now known, was firstd escribed in 1985 by an English
geneticist named Alec Jeffreys. Dr. Jeffreys found that
certain regions of DNA contained DNA sequences that
were repeated over and over again next to each other.
 These DNA repeat regions became known as VNTRs,
which stands for variable number of tandem repeats.
The technique used by Dr. Jeffreys to examine the
VNTRs was called restriction fragment length
polymorphism (RFLP).
Terminologi
 What is a Locus?
A locus is simply a location in the DNA. The plural of
locus is, loci
 What are alleles?
Alleles are just variations at a particular site on a
chromosome. Since each chromosome has a similar
chromosome partner (except for males with their X
and Y chromosomes) each locus is duplicated. Loci
can vary a bit. If a person has two identical versions of
the locus, they are said to be homozygous GUS). If
there is a difference, they are said to be heterozygous.
Terminologi
 PCR is an abbreviation for "polymerase chain reaction.”
PCR increases the amount of DNA available for typing.
 STR stands for Short Tandem Repeat. STRs are the type of
DNA used in most of the currently popular forensic DNA
tests. STR is a generic term that describes any short,
repeating DNA sequence.
 Suppose that laboratory data revealed the following DNA
sequence:
ATGCTAGTATTTGGATAGATAGATAGATAGATAGATAGAT
AAAAAAATTTTTTTT--
The STR is underlined and consists of the sequence, GATA
repeated 7 times
IDENTIFICATION
 Identification means comparing 2 data
 The DNA material in chromosomes is composed of
‘coding’ and ‘non-coding regions. The coding regions
are known as genes and contain the information
necessary for a cell to make proteins.
 Polymorphic (variable) markers that differ among
individuals can be found throughout the non-coding
regions of the human genome.
DNA Typing Technologies
PROCESS
STR