BIOCHEMISTRY

Lets Refresh!
Biology -is the
science of life. Its
name is derived from
the Greek words
"bios" (life) and
"logos" (study).
Biologists study the
structure, function,
growth, origin,
evolution and
distribution of living
organisms
 Lets Refresh!
Chemistry -is the
study of matter, its
properties, how
and why
substances
combine or
separate to form
other substances,
and how
substances interact
with energy
 Prokaryotic Cell

*Prokaryotes are the most abundant organisms on earth and fall into two
distinct groups, the bacteria (or eubacteria) and the archaea (or
archaebacteria). A prokaryotic cell does not contain a membrane-bound
nucleus.
*Each prokaryotic cell is surrounded by a plasma membrane. The cell has
no subcellular organelles, only infoldings of the plasma membrane called
mesosomes. The deoxyribonucleic acid (DNA) is condensed within the
cytosol to form the nucleoid
 Prokaryotic Cell

*Prokaryotes are the most numerous and widespread organisms

on earth, and are so classified because they have no defined
membrane-bound nucleus.
Prokaryotes comprise two separate but related groups: the
bacteria (or eubacteria) and the archaea (or archaebacteria).
These two distinct groups of prokaryotes diverged early in the
history of life on Earth.
 Eukaryotic Cell

*Eukaryotic cells have a membrane-bound nucleus and a

number of other membrane-bound subcellular (internal)
organelles, each of which has a specific function.
– Chemistry is the study of material substances and the changes
they undergo. All materials are comprised of matter, which
can be defined as anything that occupies space and has mass.
Matter is composed of extremely small particles called atoms.
There are about a hundred different kinds of atoms in nature.
– matter,
– Atoms
– Atoms are made up of even smaller particles: positively charged
protons, negatively charged electrons, and neutral neutrons
– chemical bonds. Chemical bonds are often shared pairs of
electrons. The arrangement of atoms in a molecule is called the
structure, and chemists have developed some shorthand ways
of representing structures
– Define what is biochemistry?
– Areas of study? General Biochemistry is known as the study of
– What are the uses of biochemistry? structure & chemical functions of living things but
– Why it is important in nursing? in detailed all these are divided into different
Biochemistry Branches.
Immunology.
Animal biochemistry.
Enzymology.
Plant biochemistry.
Cell biology.
Metabolism.
Molecular biology.
Genetics
 A Knowledge of Biochemistry Is Essential to All
Life Sciences

– The biochemistry of the nucleic acids lies at the heart of genetics; in turn, the use of genetic approaches
has been critical for elucidating many areas of biochemistry. Physiology, the study of body function,
overlaps with biochemistry almost completely. Immunology employs numerous biochemical
techniques, and many immunologic approaches have found wide use by biochemists. Pharmacology
and pharmacy rest on a sound knowledge of biochemistry and physiology; in particular, most drugs are
metabolized by enzyme-catalyzed reactions. Poisons act on biochemical reactions or processes; this is
the subject matter of toxicology. Biochemical approaches are being used increasingly to study basic
aspects of pathology (the study of disease), such as inflammation, cell injury, and cancer. Many
workers in microbiology, zoology, and botany employ biochemical approaches almost exclusively.
These relationships are not surprising, because life as we know it depends on biochemical reactions
and processes. In fact, the old barriers among the life sciences are breaking down, and biochemistry is
increasingly becoming their common language.
 BIOCHEMISTRY

– the branch of science concerned with the chemical and

physicochemical processes and substances that occur
within living organisms.
– study of the chemical substances and processes that
occur in plants, animals, and microorganisms and of the
changes they undergo during development and life.
– Next time you’re at the gym, think about the fact that all the
cells in your body are working together to achieve your goals.
Your muscles would rapidly fail without your liver sending
out the sugar they need to contract. You could only last for a
few minutes without your heart pumping oxygen-containing
blood throughout your body. And without your brain sending
signals to mastermind it all, you wouldn’t even make it out of
the locker room. We have to discuss the building blocks of the
organs, cells. We can reduce cells even further down to their
components, the basic biological building blocks called
lipids, carbohydrates, proteins, and nucleic acids. That’s
what biochemistry is all about, trying to understand the whole
from its parts.
 BIOCHEMISTRY & MEDICINE:
INTRODUCTION
– Biochemistry can be defined as the science of the chemical basis of
life (Gk bios "life"). The cell is the structural unit of living
systems. Thus, biochemistry can also be described as the science of
the chemical constituents of living cells and of the reactions and
processes they undergo. By this definition, biochemistry
encompasses large areas of cell biology, molecular biology, and
molecular genetics.
– give information regarding the functioning of cells at the molecular
level. How the food that we eat is digested, absorbed, and used to make
ingredients of the body? How does the body derive energy for the
normal day to day work? How are the various metabolic processes
interrelated? What is the function of genes? What is the molecular basis
for immunological resistance against invading organisms?

– The term "Biochemistry" was coined by Neuberg in 1903 from Greek

words, bios (= life) and chymos (= juice). One of the earliest treatises
in biochemistry was the "Book of Organic Chemistry and its
Applications to Physiology and Pathology",
– The major objective of biochemistry is the complete understanding, at
the molecular level, of all of the chemical processes associated with
living cells. To achieve this objective, biochemists have sought to
isolate the numerous molecules found in cells, determine their
structures, and analyze how they function.
Prelude: Biochemistry and the
Genomic Revolution

GACTTCACTTCTAATGATGATTATGGGAGAACTGGAGCCTT
CAGAGGGTAAAAATTAAGCACAGTGGAAGAATTTCATTC
TGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAG
AAAATATCTTTGGTGTTTCCTATGATGAATATAGATACAG
AAGCGTCATCAAAGCATGCCAACTAGAAGAG.
– Disease and the genome. Studies of the human genome are revealing disease
origins and other biochemical mysteries.
– Human chromosomes, contain the DNA molecules that constitute the human
genome
3
Amino Acids –building blocks of
protein
– Proteins are the most abundant and functionally diverse
molecules in living systems.
– In bone, the protein collagen forms a framework for the
deposition of calcium phosphate crystals, acting like the
steel cables in reinforced concrete.
– In the bloodstream, proteins, such as hemoglobin and
plasma albumin, shuttle molecules essential to life, whereas
immunoglobulins fight infectious bacteria and viruses.
Although more than 300 different amino acids have
been described in nature, only 20 are commonly
found as constituents of mammalian proteins

Each amino acid has a

carboxyl group, a primary
amino group (except for
proline, which has a
secondary amino group),
and a distinctive side
chain (“R group”) bonded
to the α-carbon atom

All amino acids found in proteins have this basic structure,

differing only in the structure of the R-group or the side chain..
The simplest, and smallest, amino acid found in proteins is
glycine for which the R-group is a hydrogen (H).
The standard set of 20 amino acids have different side-chains or R groups and display different
physicochemical properties (polarity, acidity, basicity, aromaticity, bulkiness, conformational
inflexibility, ability to form hydrogen bonds, ability to cross-link and chemical reactivity).
Glycine (Gly, G) has a hydrogen atom as its R group. Alanine (Ala, A), valine (Val, V), leucine
(Leu, L), isoleucine (Ile, I) and methionine (Met,M) have aliphatic side-chains of differing
structures that are hydrophobic and chemically inert. The aromatic side-chains of phenylalanine
(Phe, F),tyrosine (Tyr, Y) and tryptophan (Trp, W) are also hydrophobic in nature. The
conformationally rigid proline (Pro, P) has its aliphatic side-chain bonded back on to the amino
group and thus is really an amino acid. The hydrophobic, sulfur-containing side-chain of cysteine
(Cys, C) is highly reactive and can form a disulfide bond with another cysteine residue. The
basic amino acids arginine (Arg, R) and lysine (Lys, K) have positively charged side-chains,
whilst the side-chain of histidine (His, H) can be either positively charged or uncharged at
neutral pH. The side-chains of the acidic amino acids aspartic acid (Asp, D) and glutamic acid
(Glu, E) are negatively charged at neutral pH. The amide side-chains of asparagine (Asn, N) and
glutamine (Gln, Q), and the hydroxyl sidechains of serine (Ser, S) and threonine (Thr, T) are
uncharged and polar, and can form hydrogen bonds.
Functional Role of Proteins in Human

Proteins perform a surprising variety of essential

functions in mammalian organisms. These may be
grouped into dynamic and structural. Dynamic
functions include transport, metabolic control,
contraction, and catalysis of chemical transformations.
In their structural functions, proteins provide the matrix
for bone and connective tissue, giving structure and
form to the human organism.
 Aliphatic Amino Acids
Aliphatic R groups are nonpolar and hydrophobic. Hydrophobicity increases
with increasing number of C atoms in the hydrocarbon chain. Although these
amino acids prefer to remain inside protein molecules
 Acidic Amino Acids and their Amids
Acidic amino acids are polar and negatively charged at physiological
pH. Both acidic amino acids have a second carboxyl group.
Amides are polar and uncharged, and not ionizable. All are very
hydrophilic.
 Aromatic amino acids
Aromatic amino acids are relatively nonpolar. To different degrees, all
aromatic amino acids absorb ultraviolet light. Tyrosine and tryptophan absorb
more than do phenylalanine; tryptophan is responsible for most of the
absorbance of ultraviolet light
 Basic amino acids
Basic amino acids are polar and positively charged at pH values
below their pKa's, and are very hydrophilic
 Cyclic Amino Acid
Proline is the only cyclic amino acid. It is nonpolar and shares many
properties with the aliphatic group.
Proline is one of the ambivalent amino acids, meaning that it can be
inside or outside of a protein molecule.
 Hydroxyl Amino Acid
Hydroxyl amino acids are polar, uncharged at physiological pH, and
hydrophilic.
 Sulfur-Containing Amino Aids
The sulfur-containing amino acids (cysteine and
methionine) are generally considered to be nonpolar and
hydrophobic. In fact, methionine is one of the most
hydrophobic amino acids and is almost always found on the
interior of proteins
Hydrophobic, aliphatic amino acids
Hydrophobic, aromatic amino acids
Polar, Uncharged amino acids
Functions of essential amino acids
1. Tryptophan: Necessary for the synthesis of neurotransmitter serotonin. It helps
relieve migraine and depression.
2. Tyrosine: Is precursor of dopamine, norepinephrine and adrenaline. It
enhances positive mood. It is also antioxidant.
3. Valine: Essential for muscle development. Side effects of high levels of valine in
the body include hallucinations.
4. Isoleucine: Necessary for the synthesis of hemoglobin, major constituent of red
blood cells.
5. Leucine: Beneficial for skin, bone and tissue wound healing. It promotes growth
hormone synthesis.
6. Lysine: Component of muscle protein, and is needed in the synthesis of
enzymes and hormones. It is also a precursor for L-carathine which is essential
for healthy nervous system function.
7. Methionine: Is antioxidant. It helps in breakdown of fats and aids in reducing
muscle degeneration. It is also good for healthy skin and nail.
8. Phenylalanine: Beneficial for healthy nervous system. It boosts memory and
learning. It may be useful against depression and suppressing appetite.
9. Threonine – augments collagen and tooth enamel
– Acid and Bases
– Myoglobin and Hemoglobin