DNA Profiling

Iswandi S.Si. M.Farm Apt

FAK Farmasi USB
Human Chromosomes

• 23 pairs

http://bioweb.wku.edu/courses/BIOL115/Wyatt/Nucleic_Acids/Mgk.jpg
DNA Structure

• Double Helix
• Backbone is
alternating
deoxyribose
sugars and
phosphate groups
• 4 bases in pairs
– Adenine with
thymine
– Guanine with
cytosine
• Codon-3 base unit
that codes for a
given amino acid
Genes

• Fundamental unit of heredity

– Inherent one allele (copy) of
gene from each parent

• 30,000 genes make up the

human chromosome

• 3 billion base pairs (rungs on

the ladder) in your DNA
Genes

• What are some examples of

traits controlled by genes?

• How are genes expressed?

DNA Fingerprinting

• Does NOT use all your DNA!

• Does NOT use your genes!

• Does use 13 specific sections of “spacer”

DNA that separates genes

• Called short tandem repeats

• Repeat a short segment of code like GGAC

How many repeats are there?

GGACGGACGGACGGACGGACGGAC
How big a sample do you need?

• Need only 250 pg sample

– 250 trillionths of a gram
– DNA from about 36 cells!!

• DNA segments will be

duplicated a million times in
about and hour
CODIS Loci
Short Tandem Repeats

• Sections of DNA that are repeated

numerous times
– 3 to 7 bases in repeat group, eg. GGAC
– 400 bases in repeated section
• Do NOT code for proteins
• 30% of human genome is tandem
repeat fillers
• All humans have same types of
repeats
• BUT variation in number of repeats
in any individual
What fraction of your DNA is
used?

• 400 base pairs per STR X 2

alleles per locus X 13 Loci=
10400 based pairs used for
identification out of
3,000,000,000
– 0.00034% of your DNA is
enough to uniquely identify you!
Example of STR Use

• D3S1358 repeat sequence

might be TTGGA
• Human population has
variants of 12 to 19 repeats
• Construct a Punnett Square to
see what combinations of
repeats offspring may have
• Suspect must match all pairs
of repeats in each of the 13
loci
Punnett Squares for Location
D3S1358

Mom Anne/ 15 repeats 17 repeats

Dad Bob

15 repeats 15 repeats, 15 repeats,

15 repeats 17 repeats

18 repeats 15 repeats, 17 repeats

18 repeats 18 repeats

Go to page 3 in the Blackett Family DNA Packet

 DNA Profiling Data

Control with
All possible
repeats for
each of the 3
loci

DNA data
from 3 loci
Blackett Family DNA

• Based on the first STR on

page 3, who is the first person
going down who could not be
a child of Bob and Anne?

• Based on vWA (second STR)

who is the first person going
down who could not be a child
of Bob and Anne?
Probability is the Key!

• Each loci is inherited independently

• Suppose there are 8 possible
repeats, each with equal probability
(12.5%)
• Approximate probability will be
(0.125)26 = 3.3 X 10-24
that two people have the same
pairs of repeats
• OR 1 person in 0.3 trillion trillion
people
How Does DNA Profiling Work?

• Only the DNA STR sections are

replicated by Polymerase Chain
Reaction

• STR sections separated by gel

electrophoresis by number of
repeats—
– highest mass move slowest

• List of 13 pairs of STR repeats

matched to database or known
samples
Gel Electrophoresis

• Separates the charged DNA

segments by mass
• Voltage placed across agar gel
• Samples move along separate race
tracks
• Larger fragments move slower
• Stains are added to visualize the
fragment positions
• Standards are added for calibration
Gel Electrophoresis
Gel Electrophoresis
Scanning Electron Microscopy

• SEM Image (~30,000X)

http://www.visions-of-science.co.uk/winners2001/pictures/Syred1.jpg
Schematic of a chromosome

The chromosome is DNA

surrounded by proteins
 Detailed Double Helix

Backbone
Hydrogen bonds
sugars are link base pairs
oriented in
opposite
directions on
the two
strands
 Hydrogen Bonds Link Base Pairs

Easy to
break H-
bonds and
split the
ladder
down the
middle
http://www.people.virginia.edu/~rjh9u/gif/basepairs.gif
DNA Replication

• DNA unwinds
• Hydrogen bonds between base
pairs break
• Free nucleotides attach by new
hydrogen bonds
• Complementary base pair rule
holds
• Identical copy is formed
• Entire process is controlled by
special enzymes
 Nucleotides

• Base + sugar + phosphate

Adenine Thymine

Sugar +
phosphate
form the
sides of the
latter Cytosine
Guanine

http://www.techfak.uni-bielefeld.de/bcd/ForAll/Media/nuc.gif
Complementary Base Pairing

• Key concept in how DNA

functions
• Adenine always pairs with
thymine
• Guanine always pairs with
cytosine
• One double ring base with a
single ring base
– Pairs have same length
Polymerase Chain Reaction

• DNA Thermal Cycler doubles

DNA once each cycle
• 20 cycles  220 = 1048576

$2500
Polymerase Chain Reaction

Critical Technology
– RNA primers to start and end
amplification on either side of the
STR segment
– Only the regions with STRs that
are between where the RNA
primers attach to the DNA can
be copied
DNA Replication Enzymes

http://library.thinkquest.org/04apr/00217/images/content/74-Summary-DNA-Replication.jpg
Strand Replication

• DNA polymerase can only add

to the 3’ position on the sugar
• Mechanism for strand
replication is different for each
strand since they are oriented
in opposite directions!
• DNA polymerase can
“proofread” replication and
correct mistakes
Polymerase Chain Reaction

• Separate the strands (denaturation)

@ 90-96 oC
• Bond 2 RNA primers to single
strand DNA @ 55 oC
– Needed to start and end replication
process
– RNA primers match strings on either
side of DNA region of interest
• Synthesize DNA with polymerase
@ 75 oC
– from bacteria that lives in hot springs
– Lots of nucleotides in the test tube
• Cycle takes 1-3 minutes
• Big worry: contamination!
Polymerase Chain Reaction

• The primers fit on opposite strands

• It takes 3 initial cycles before a
free standing chunk piece of DNA
is produced
Terima Kasih Atas
Perhatiannya