DNA alteration (Mutations)

Definition:
- Mutation is the change of base sequence of nucleotides(Each nucleotide
includes a sugar, phosphate and one of four possible nitrogenous bases
(adenine and guanine [both purines], and thymine and cytosine [both
pyrimidines]) in the genetic code due to replacement, deletion (removal)
or insertion (addition) of one or more bases resulting in altered gene
product and/or regulation, or a change in gene copy number, or a
structural or numerical abnormality in chromosomes.
Causes:
• Physical (most common) such as: UV, X and  radiations.
• Chemical carcinogens such as anticancer base analogs and alkylating
agents.
• Environmental pollutants-derived oxidative free radical such as nitrous
acid.
• Genomic instability, errors of DNA replication and defective repair.
 Gene mutations which affect
only one gene

DNA sequence
↓
Transcription
mRNA sequence
↓
Translation Polypeptide

© 2010 Paul Billiet ODWS

 Mutations: Substitutions
Normal gene Substitution mutation
GGTCTCCTCACGCCA GGTCACCTCACGCCA
↓ ↓
CCAGAGGAGUGCGGU CCAGUGGAGUGCGGU
Codons
↓ ↓
Pro-Glu-Glu-Cys-Gly Pro-Arg-Glu-Cys-Gly
Amino acids
Substitutions will only affect a single codon
Their effects may not be serious unless they affect an amino acid that is
essential for the structure and function of the finished protein molecule (e.g.
sickle cell anaemia)
© 2010 Paul Billiet ODWS
Types of DNA mutation or alteration:
a) Single base alteration (point mutation):
• Deamination, e.g., adenine into hypoxanthine
and cytosine into uracil.
• Depurination or depyrimidination, i.e.,
removal of a purine or a pyrimidine base.
• Alkylation of a base (mostly guanine) by
covalent addition of an alkyl radical.
• Insertion or deletion of a nucleotide.
• Base-analog incorporation.
 :b) Two bases alteration •
.UV-induced thymine–thymine dimer •
.Cross linkage caused by bifunctional alkylating agent •
c) Strand breakage: Single-strand breaks are less •
harmful than double- strand breaks in the
:phosphodiester backbone. It is caused by
.Ionizing radiation •
.Radioactive disintegration of incorporated element •
.Oxidative free radical formation •
:d) Cross-linkage •
.Two bases in same strand or opposite strands •
DNA cross-linkage to histones or other proteins •
 Point mutations
• Definition and types:
- It is a single base change that can be
Transition mutation: a purine base is
changed to another purine base, e.g., adenine
into guanine or a pyrimidine base to another
pyrimidine base, e.g., thymine into cytosine.
Or, transversion mutation: a purine base is
changed into a pyrimidine base and vice
versa. And/or insertion or deletion of one or
two bases that cause frame shift mutation.
 Types of mutations
A mistake that changes one base on a DNA •
.molecule is called a point mutation
:Two forms •
Transition: one pyrimidine (T or C) substituted for the –
other pyrimidine or one purine substituted for the
.other purine (A or G)
Transversion: purine substituted for pyrimidine or vice –
versa
Fig 4.4
 DNA metabolism
DNA Repair
DNA damage from:
1. spontaneous loss of exocyclic amino group
(deamination)

C  U occurs once every 107 C residues in a

day (100x a day)

A  G (Hyp) occurs 100x slower

2. Hydrolysis of bond between sugar and base

(apurinic residue)

Occurs once every 105 purines in a day (10,000x a day)

Slower for pyrimidines

Fate (or effect) of point mutation:
• Silent mutation, i.e., the changed base leads to a
codon, which produces the same amino acid. In
this case, the change lies in the third base of the
codon, which has several alternative names for
same amino acid.
• Missense mutation, i.e., the change occurred
either in first or second base of the codon producing
a different amino acid. The effect of missense
mutation on the protein produced is dependent on
the position and nature of the replacement amino
acid. This protein could be normally functioning,
partially functioning, non-functioning or not produced
at all because of defective RNA processing.
Example is Sickle cell anemia or hemoglobin S with
normal two  chains and abnormal two  chains
leading to rapid hemolysis due to mutant glutamate
at position 6 into valine.
• Non-sense mutation, i.e., the altered base results
in a non-sense termination codon. This leads to
pre-mature stopping of protein synthesis leading to
truncated protein e.g., c-erbB2 oncogene or no
protein is produced at all.
• Frame shift mutation, i.e., shift in the trinucleotide
reading frame e.g., in the BAX gene in ovarian
cancer resulting in:
• Truncated protein if a non-sense codon is
developed due to the shift.
• Garbled translation into totally different protein after
the shift point.
• A protein may not be produced at all because
mRNA is degraded.
• - Insertion or deletion of three bases produces a
protein with an extra or lacking an amino acid. It
has a moderate effect on the produced protein.
 Point Mutations
Silent mutation = no change to protein •
AUGCGUGUAUACGCAUGCGAGUGA

MetArgValTyrAlaCysGluStop
Does
Thethis
codechange
has
repeats in it!
the protein?
Why not?
AUGCGUGUAUACGCUUGCGAGUGA

MetArgValTyrAlaCysGluStop
Point Mutations
 Point Mutations
Nonsense mutation = change to STOP •
AUGCGUGUAUACGCAUGCGAGUGA

MetArgValTyrAlaCysGluStop
Really destroyed
that protein!

AUGCGUGUAUAAGCAUGCGAGUGA

MetArgValStop
Base-Pair Substitution Ex)
Missense Mutation
One Amino Acid Substituted for Another •
Sickle Cell Anemia •
Valine is replaced with Glutamic Acid –
 Sickle cell anemia
Hemoglobin protein in red blood cells •
strikes 1 out of 400 African Americans –
limits activity, painful & may die young –
Normal Misshapen
round cells sickle cells

Only 1 out of
146 amino acids
 Frameshift Mutations
Addition = add one or more bases •
AUGCGUGUAUACGCAUGCGAGUGA

MetArgValTyrAlaCysGluStop
Does this change
the protein?
A LOT!
AUGCGUGUAUACGUCAUGCGAGUGA

MetArgValTyrValMetArgValA
 Frameshift Mutations
Deletion = lose one or more bases •
AUGCGUGUAUACGCAUGCGAGUGA

MetArgValTyrAlaCysGluStop
Does this change
the protein?
A LOT!
AUGCGUGUAUACGAUGCGAGUGA

MetArgValTyrAspAlaSerGA
 Mutations: genetic material changes in a
cell
.…Point mutations •
Changes in 1 or a few base
pairs in a single gene
Base-pair substitutions: –
•silent mutations
no effect on protein
•missense
∆ to a different amino acid
(different protein)
•nonsense
a∆ to a stop codon and
nonfunctional protein
Base-pair insertions or –
deletions:
additions or losses of
nucleotide pairs in a gene;
alters the ‘reading frame’ of
triplets~frameshift mutation
Mutagens: physical and •
chemical agents that change
DNA
Gene Mutation
Animation
 Mechanisms of repair of DNA
Damage
1. Excision repair:
- Used to correct many types of DNA damage that
affects only one strand. It has three mechanisms as
follows,
A. Nucleotide excision repair of thymine-thymine
(or pyrimidine) dimer:
• - Thymine-thymine dimer is covalent linkage of two
adjacent thymine bases in a single strand and occurs
spontaneously, or due to chemical, radiation, or
ultraviolet (UV) light damage to DNA segment.
• - These dimers prevent DNA polymerase from
replicating DNA strand beyond the site of the dimer.
There are two ways of correcting such damage:
• DNA photolyase enzyme is photo-reactivated by
photons of UV or blue spectral region of light to
cleave the dimer into its original bases.
• UV-specific endonuclease:
- This enzyme recognizes the dimer and makes a nick
in the affected DNA strand 8 nucleotides away
from the dimer site to the 5'-side. DNA
polymerase I fills the gap with new nucleotides
using the healthy strand as a template in the
5'3' direction by nick translation. Then, UV-
specific endonuclease cut the freed damaged
sequence 4 nucleotides from the dimer site away
to the 3'-side. Then, the damaged piece of DNA
diffuses away. Then, DNA ligase joins the 3' end
of the new DNA and the 5' end of the original
DNA. See the following figure.
5' 3'
3' 5'
UV-specific
endonuclease
5' 3'
3' 5'

DNA polymerase I

5' 3'
3' 5'

DNA polymerase I
5' 3'
3' 5'

DNA polymerase I

5' 3'
3' 5'

DNA ligase
5' 3'
3' 5'
B. Mismatch Repair:
• - Mismatch, e.g., G-T, is due to copying errors during
replication that may also lead to 1 - 5 bases unpair
loops.
• - The mismatch is recognized by a group of proteins
called MutS, MutL and MutH that identify the parent
DNA strand by its methylation at GATC sequences.
Once identified the mismatch, they cut the defective
DNA strand at the 3’ side of the mismatch dimer.
• - A special exonuclease (exonuclease 1) hydrolyzes
DNA in 3'5' direction to a few nucleotides 5' the
mismatch and releases free DNA nucleotides.
• - A new DNA is synthesized to fill the gap by DNA
polymerase III and DNA ligase joins the 3'-end of the
new DNA and the 5'-end of the DNA ahead of it.
• - Defects in these Mut proteins lead to specific types
of hereditary types of cancer, e.g., hereditary
nonpolyposis colorectal cancer, see the figure below.
3' 5'
G
5' T 3'

MutL
MutH
MutS
3' 5'
G
5' T 3'

Exonuclease 1
3' 5'
G
5' 3'

DNA polymerase III

3' 5'
G
5'
C
3'

DNA polymerase III

5' 5'
G
C
3' 3'
DNA ligase

3' 5'
G
C
5' 3'
C. Base excision repair or correction of
deamination of cytosine to uracil:
• - Oxidative deamination of cytosine into uracil,
adenine into hypoxanthine and guanine into xanthine
occurs spontaneous, or due to chemical or radiation
damage to a single base.
• - Since uracil, hypoxanthine and xanthine are foreign
to DNA; they are recognized and removed from the
DNA strand by specific-DNA glycosylase that cuts
the bond between the deoxyribose and the base
leaving apyrimidinic or apurinic site, i.e., AP.
• - An AP-endonuclease cuts the deoxyribose-
phosphate backbone of the affected strand at 5' end of
the AP site and removes a few nucleotides.
• - Then, DNA polymerase I excise the residual
deoxyribose phosphate unit and inserts
cytosine, as dictated by the presence of
guanine on the undamaged complementary
strand. Then, the deoxyribose-phosphate
backbone is rejoined by a Ligase.
• - Defective repair of this damage leads to A-U
mutation in place of the original G-C because U
base pairs with A and in a subsequent
replication A-U is replaced by A-T.
DNA Base-excision Repair
DNA metabolism

DNA glycosylases recognize deaminations and remove them leaving an apurinic/apyrimidinic

site (AP site)
2. Recombinational double strand breaks
repair:
• - The figure below illustrates the mechanism of repair of
double DNA strand breaks that are due to ionizing radiation,
chemotherapy and oxidative free radicals.
• Two proteins are involved; Ku and DNA-dependent protein
kinase. Both of them attach to each end of the double
strand break, activate one another other, unwind the duplex
(Ku has helicase activity) and search for the closest DNA
sequence of minimum complementarity in the opposite
strands.
• - The extranucleotide tails are degraded into free nucleotides
by exonuclease and the gaps are filled by DNA polymerase
III and DNA ligase seals the free ends.
 Ku

DNA-dependent
protein kinase

Exonuclease

DNA ligase DNA polymerase III

Diseases related to defective repair of DNA
damage:
I- Xeroderma Pigmentosum:
• - It is an autosomal recessive disease. It is an
example of a defective mechanism for the repair of
pyrimidine dimers in DNA. It is due to absence of the
UV-specific endonuclease enzyme and defective
correction of thymine dimer. Patients are highly
sensitive to sunlight or UV light and their skin cells
contain multiple thymine dimer. They develop skin
cancer.
II- Ataxia Telangiectasia:
• - It is an autosomal recessive disease. Ataxia and
malignant neoplasms of the reticuloendothelial
system are the major symptoms. There is impaired
repair of DNA strand breaks leading to increased
sensitivity to X-ray-induced damage.
III- Fanconi’s Anemia:
• - It is an autosomal recessive anemia. It is
associated with increased susceptibility to
malignant neoplasms. It is due to failure of
correction of cross-linkage damage, e.g., thymine-
thymine dimer.
IV- Hereditary Nonpolyposis Colorectal Cancer
(HPCC):
• - It is Lynch syndrome in which patients develop
cancer in the colon with cancer also in stomach
and/or uterus. It is due to defective DNA mismatch
repair due to mutations in two genes, hMSH2 and
hMLH1 (human analogs of MutS and L).
!!Don’t let this happen to you