Transcription and Translation

1. Important Features
• a. DNA contains genetic template" for
proteins.

• b. DNA is found in the nucleus

• c. Protein synthesis occurs in the

cytoplasm - ribosome.

• d. "Genetic information" must be

transferred to the cytoplasm where
proteins are synthesized.
 2. Processes of Protein
Synthesis
• a. Transcription - genetic
template for a protein is copied
and carried out to the cytoplasm

• b. Translation - template serves

as a series of codes for the
amino acid sequence of the
protein
 Cells Use RNA to Make Protein
• The RNA Players – mRNA, rRNA, tRNA
• During polypeptide synthesis, ribosomal
RNA (rRNA) is the site of polypeptide
assembly.
– Transfer RNA (tRNA) transports and positions
amino acids.
– Messenger RNA (mRNA) directs which amino
acids are assembled into polypeptides.
• Central Dogma
– DNA 🡪 RNA🡪 Protein
Central Dogma of Gene
Expression
 Gene Expression

• Transcription – in the nucleus (if you have one)

– DNA sequence is transcribed into RNA sequence
• initiated when RNA polymerase binds to
promoter binding site
– moves along DNA strand and adds corresponding
complementary RNA nucleotide
» disengages at stop signal
 3. Steps of Transcription
a. DNA unwinds, Helicase breaks H bonds
b. One side of DNA "codes for a protein"
c. Genetic code of DNA is a triplet code of 3 nucleotides
or bases
d. Each triplet is specific for the coding of a single amino
acid
e. Sequence of triplet codes on DNA will specify the
amino acid sequence on the protein
f. Major step is the synthesis of the coded "messenger"
molecule – mRNA
g. mRNA is "transcribed" from DNA by complementary
base pairing (mRNA has no thymine, which is replaced
by uracil)
h. mRNA passes out to cytoplasm to the ribosome
 Genetic Code

• Genetic code consists of a series of

information blocks called codons.
– reading frame (triplet)
• each codes for one amino acid
– genetic code is nearly universal
 The Genetic Code
1.A triplet code comprised of three nucleotide
bases in a sequence.
2.How many triplet codes?
20 common amino acids in a protein
4 diff. bases on DNA A,T,C, & G
| | | |
4 diff. bases on RNA U,A,G, & C
Why Triplet Code

The logic is that the nucleotide code must be able to

specify the placement of 20 amino acids. Since there are
only four nucleotides, a code of single nucleotides would
only represent four amino acids, such that A, C, G and U
could be translated to encode amino acids. A doublet code
could code for 16 amino acids (4 x 4). A triplet code could
make a genetic code for 64 different combinations (4 X 4
X 4) genetic code and provide plenty of information in the
DNA molecule to specify the placement of all 20 amino
acids.
 The 64 triplet codes
• 60 code for amino acids
• 4 act as "stop" and "start codes
• Degenerate Code- more than
one triplet code for some amino
acids e.g.,
GGG
GGU All code for the
amino acid glycine
GGC
GGA
 Transcription

• RNA polymerase
– only one of two DNA strands
(template) is transcribed
– non-transcribed strand is termed
coding strand - same as RNA (except
T’s are U’s)
– In both bacteria and eukaryotes, the
polymerase adds ribonucleotides to
the growing 3’ end of an RNA chain.
• synthesis proceeds in 5’🡪3’ direction
 Transcription

• Promoter
– Transcription starts at RNA
polymerase binding sites called
promoters on DNA template strand.
• Initiation
– Other eukaryotic factors bind,
assembling a transcription complex.
• RNA polymerase begins to unwind DNA
helix, as Helicase breaks the H bonds.
 Transcription

• Elongation
– Transcription bubble moves down
DNA at constant rate leaving growing
RNA strands protruding from the
bubble.
• Termination
– Stop sequences at the end of the
gene cause phosphodiester bond
formation to cease, transcription
bubble to dissociate, and RNA
 Transcription

• Eukaryotic transcription differs from

prokaryotic transcription:
– three RNA polymerase enzymes
– initiation complex forms at promoter
– RNAs are modified after transcription
 Spliced Gene Transcripts
• DNA sequence specifying a protein is broken
into segments (exons) scattered among longer
noncoding segments (introns).

• Initially, primary RNA transcript is produced for

the entire gene.
– Small nuclear ribonuclearproteins (snRNPs)
associate with proteins to form spliceosomes.
• Excise introns and splice exons to form mature mRNA.
 RNA Splicing

• During RNA processing, intron

sequences are cut out of primary
transcript before it is used in
polypeptide synthesis.

• remaining exon sequences are spliced

together to form final processed mRNA
Transcription Bubble
Eukaryotic Genes are
Fragmented
Summary
Transcription video
 mRNA

G
U
C
A

DNA
Replication vs Transcription
Now TRANSLATION!!!!
 4. Translation
overview
a. mRNA attaches to the
ribosome
b. tRNA's attach to free amino
acids in the cytoplasmic
"pool" of amino acids
c. tRNA carries its specific
amino acid to the ribosome
 Translation overview
(cont.)
d. tRNA "delivers" its amino acid based on
complementary pairing of a triplet code
(anticodon) with the triplet code (codon) of
the mRNA.
e.Enzyme "hooks" the amino acid to the last
one in the chain forming a peptide bond.
f. Protein chain continues to grow as each
tRNA brings in its amino acid and adds it
to the chain. - This is translation!!
 Gene Expression
• Translation – in the cytoplasm at ribosome
– nucleotide sequence of mRNA transcript is
translated into amino acid sequence in the
polypeptide
• rRNA recognizes and binds to start sequence
– moves three nucleotides at a time
» disengages at stop signal
• Gene expression - collective of transcription
and translation
 Translation

• Begins when initial portion of mRNA

molecule binds to rRNA in a
ribosome
– tRNA molecule with complimentary
anticodon binds to exposed codon on
mRNA
• some tRNA molecules recognize more
than one codon
 Translation

• Start and stop signals

– start signal coded by AUG codon
– stop signal coded by one of three
nonsense codons: UAA - UAG - UGA
• Initiation
– Polypeptide synthesis begins with the
formation of an initiation complex.
• initiation factors
 Translation

• Translocation
– ribosome moves nucleotides along
mRNA molecule
• Termination Translation
– Nonsense codons are recognized by release
factors that release the newly made polypeptide
from the ribosome.
aminoacyl tRNA
synthetase
Peptidyl
Transferase
ACTIVITY
ACTIVITY

AUGCCCGGAUAUGCGAUGAUGAGUACCUAGCC

AUG-CCC-GGA-UAU-GCG-AUG-AUG-AGU-ACC-UAG

UACGGGCCUAUACGCUACUACUCAUGGAUCGG

MET-PRO-GLY-TYR-AL-MET-MET-SER-THR-STOP
 Differences Between
Prokaryotic and
Eukaryotic Gene Expression
• Eukaryotic mRNA molecules have introns cut
out and exons joined together before
translation.
• Eukaryotic ribosomes are larger than
prokaryotic ribosomes.
Replication, Transcription and Translation
Animation