Molecular Biology (BIOL 409) Quiz #8 Fall 2013 Multiple Choice: Choose the best answer from the

list provided 1. Under which of the following conditions would DNA be most likely to utilize the base-excision repair pathway? A. A single-stranded break B. A double-stranded break C. A thymidine dimer D. U-A base pair E. C-T base pair 2. How does the mismatch repair pathway determine which strand is correct? A. The selection is random. B. It utilizes a second copy of the chromosome. C. It selects the methylated strand. D. It uses an error-prone polymerase. E. It selects A-T base pairs over G-C base pairs. 3. Which diagram best describes the activity of the specialized nuclease (an excinuclease) in nucleotide-excision DNA repair? Each line represents a single strand of a DNA duplex. A. B. C. D. E. Questions 4-7 require you to consider the model of homologous replication that we discussed in class. Place the following steps in the proper order: A. B. C. D. E. 4. 5. 6. 7. Resolution of the Holliday intermediate by a specialized nuclease Generation of 3 overhangs Sequence-specific recognition by a recombinase enzyme A strand from one chromosome invades its homolog Double-stranded cleavage of one homolog by a specialized nuclease

First E Second B Third D Fourth A

8. Which of these DNA template sequences looks most like an intrinsic (rho-independent) transcription terminator? A. GTCGCGGTCAAAAGACCGCGCCCCCCC B. GTCGCGGTCAAAACGCGGTCAAAAAAA C. GTCGCGGTCAAAAGACCGCGAAAAAAA D. GUCGCGGUCAAAAGACCGCGUUUUUUU E. GTCGCGGTCAAAACGCGGTCGGGGGGG 9. In eukaryotes, a mutation in the TATA binding protein (TBP) that inhibits interactions with its binding partners would A. inhibit telomerase function. B. inhibit functional RNA production (e.g. rRNA, tRNA) (1) Protein (3) C. inhibit mRNA production. No A Proteins D. inhibit all transcription. Protein (2) A & B E. not effect transcription. 10. You digest a piece of DNA with a nuclease in the absence of protein (1), and in the presence of protein A (2) or proteins A & B (3). A gel showing the resulting fragments is shown to the right. What do you conclude about protein B? A. It must be an inhibitor of the nuclease you used. B. It must be a DNA binding protein. C. It must inhibit the interaction between DNA & protein A. D. It must be an endonuclease that cleaves DNA. E. It must compete with protein A to bind DNA.

11. Sigma factors () control gene expression by regulating: A. transcription initiation. B. transcription elongation. C. transcription termination. D. transcriptional pausing. E. transcript cleavage.