Professional Documents
Culture Documents
3) During translation initiation in prokaryotes, the amino acid on the initiator tRNA is
A) methionine (Met).
B) N-formylmethionine (fMet).
C) acetylated.
D) IF-1.
E) added using ATP as the energy source.
Answer: B
Section: 9.2
Skill: Knowledge/Comprehension
1
Copyright © 2013 Pearson Education, Inc.
5) How does the eukaryotic initiation complex locate the true start codon?
A) The true start codon is the first ATG encountered downstream of the Shine-Dalgarno sequence.
B) The initiation complex moves the small ribosomal subunit through the 5′ UTR, scanning for the start
AUG.
C) The preinitiation complex moves the ribosome through the 3′ UTR, scanning for the Kozak sequence.
D) The true start codon is the first ATG encountered downstream of the Kozak sequence.
E) The true start codon is the formyl-ATG, which will encode for fMet in the protein.
Answer: B
Section: 9.2
Skill: Application/Analysis
8) What would you expect to find bound to the stop codon at the A site?
A) a charged tRNA with the anticodon TAG
B) a charged tRNA with the anticodon ATC
C) an uncharged tRNA
D) a release factor
E) Nothing binds to a stop codon, which is why the peptide is released.
Answer: D
Section: 9.2
Skill: Knowledge/Comprehension
11) What result would you expect if you mutate one of the four arms of a tRNA?
A) The tRNA will fit into the A site but will not release the peptide at the P site.
B) The tRNA will not be recognized by tRNA synthetase and cannot be charged.
C) The tRNA will be charged with the wrong amino acid.
D) The tRNA will not be able to undergo traditional complementary base pairing.
E) There will be no effect on function, so long as the anticodon region is intact.
Answer: B
Section: 9.4
Skill: Application/Analysis
12) Heinz Fraenkel-Conrat induced point mutations in the coat proteins of TMV and looked for
mutations in the resulting proteins. By examining single-base changes in the mRNA, Conrat proved that
A) the genetic code is overlapping.
B) the genetic code is nonoverlapping.
C) the genetic code is redundant.
D) there are 20 amino acids.
E) the genetic code is triplet.
Answer: B
Section: 9.5
Skill: Application/Analysis
13) A mutagen has introduced a frame-shift mutation by adding one nucleotide base. Which of the
following would be classified as a reversion mutation for this particular mutant?
A) deleting 2 bases
B) adding 1 base
C) deleting 1 base or adding 1 base
D) deleting 1 base or adding 3 bases
E) deleting 1 base or adding 2 bases
Answer: E
Section: 9.5
Skill: Application/Analysis
3
Copyright © 2013 Pearson Education, Inc.
14) You have identified a bacterial protein that has retained the starting fMet in its protein sequence.
Which of the following is likely true of this protein?
A) It is likely nonfunctional, since bacteria use posttranslational cleavage of fMet to make functional
proteins.
B) It will show improper protein sorting and will likely remain in the ER.
C) It will be not be able to be chemically modified, so it will be sent to the Golgi for secretion.
D) It will be a functional bacterial protein, since all functional proteins must begin with fMet.
E) It will likely form a disulfide bond with a second peptide chain, forming a protein complex.
Answer: A
Section: 9.5
Skill: Application/Analysis
15) Experiments by Chapeville and colleagues proved that the genetic code derives its specificity
through what interactions?
A) hydrogen bonds and disulfide bonds that maintain the shape of the tRNAs
B) complementary base pairing between amino acids and tRNA
C) complementary base pairing between tRNA and mRNA
D) ionic bonds between the small and large subunits of the ribosome
E) hydrogen bonding between the ribosomal subunits and the mRNA
Answer: C
Section: 9.5
Skill: Knowledge/Comprehension
16) In the unlikely event that a tRNA has been charged with the wrong amino acid, what high-fidelity
enzyme is likely to blame?
A) peptidyl transferase
B) DNA polymerase I
C) DNA polymerase III
D) aminoacyl synthetase
E) aminoacyl peptidase
Answer: D
Section: 9.5
Skill: Application/Analysis
17) Which of these choices represents one possible corresponding mRNA sequence that can be
transcribed from the following DNA template?
5′ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3′
A) 5′ - ATG CGA TTT GGG TGC TAG - 3′
B) 5′ - AUG CGA UUU GGG UGC UAG - 3′
C) 5′ - AUG CGA UUU GGG UGC - 3′
D) 5′ - CTA GCA CCC AAA TCG CAT TAG - 3'
E) 3′ - GGA CAU AGG UAC GUG GGU UUA GCG UAA UCC UG - 5′
Answer: B
Section: 9.6
Skill: Application/Analysis
4
Copyright © 2013 Pearson Education, Inc.
18) Given the following mRNA sequence, what is the amino acid sequence for the corresponding
polypeptide?
19) Given the following mRNA sequence, which of the following mutations would affect the protein
sequence?
20) Which single-base mutation would insert a premature stop codon into the following protein
sequence?
N—Met-Gln-Leu-Arg-Cys—C
A) 5′ - AUG CAG AUA GCG UGC UAG - 3′
B) 5′ - AUG AAG UUA GCG UGC UAG - 3′
C) 5′ - AUG CAG UAA GCG UGC UAG - 3′
D) 5′ - AUG CAG UUA UUG UGC UAG - 3′
E) 5′ - AUG CAG UUA GCG UGC AAG - 3′
Answer: C
Section: 9.6
Skill: Application/Analysis
5
Copyright © 2013 Pearson Education, Inc.
9.2 Short-Answer Questions
1) Ribosomal subunits are measured in which units, which describe the speed of sedimentation of a
substance during centrifugation?
Answer: Svedberg units (S)
Section: 9.1
Skill: Application/Analysis
3) The preinitiation complex forms when the start codon is recognized through binding of 16srRNA and
what region of mRNA?
Answer: Shine-Dalgarno sequence
Section: 9.2
Skill: Knowledge/Comprehension
5) If the pH gradient in a two-dimensional gel is lost, which step during two-dimensional electrophoresis
would be affected?
Answer: isoelectric focusing (first dimension)
Section: 9.2
Skill: Application/Analysis
6) What reaction provides the energy for the eukaryotic ribosome to search for the start ATG during the
process of scanning?
Answer: ATP hydrolysis
Section: 9.2
Skill: Application/Analysis
7) During elongation, where does the charged tRNA is recruited to which location on the ribosome?
Answer: A site
Section: 9.2
Skill: Knowledge/Comprehension
8) If you are designing an antibiotic that inhibits peptide bond formation, what protein would you target?
Answer: peptidyl transferase
Section: 9.2
Skill: Application/Analysis
6
Copyright © 2013 Pearson Education, Inc.
9) Binding of what protein initiates translation-termination events that result in polypeptide release and
dissociation of ribosomal subunits?
Answer: release factor (RF)
Section: 9.3
Skill: Knowledge/Comprehension
10) In a polyribosome, which end of the mRNA would have the shortest polypeptides?
Answer: 5′ end
Section: 9.3
Skill: Application/Analysis
11) Thanks to flexible base pairing, the wobble nucleotides in anticodons can be any of the RNA
nucleotides or which modified nucleotide?
Answer: inosine (I)
Section: 9.4
Skill: Knowledge/Comprehension
12) Eighteen of the amino acids have two or more synonymous codons. Which two amino acids are the
exceptions?
Answer: Met and Trp
Section: 9.4
Skill: Application/Analysis
13) How many different aminoacyl-tRNA synthetases can be found in a given cell?
Answer: 20
Section: 9.4
Skill: Application/Analysis
14) Khorana used synthetic mRNAs to determine genetic code possibilities. To do so, he translated
synthetic mRNA in vitro in the presence of individual 14C-labeled amino acids. What polypeptide did
he identify using the repeating dinucleotide Poly-UG?
Answer: Cys-Val-Cys-Val
Section: 9.5
Skill: Application/Analysis
15) Sidney Brenner designed an experiment to determine if the triplet code was overlapping or
nonoverlapping. If the code were overlapping, how many complete codons would the following
sequence encode before encountering a stop codon?
5′ - AUGCGAUUAUAGUGC - 3′
Answer: 9 (AUG UGC GCG CGA GAU AUU UUA UAU AUA UAG)
Section: 9.5
Skill: Application/Analysis
16) Sidney Brenner proved that the triplet code is, in fact, nonoverlapping. Assuming a nonoverlapping
code, how many complete codons would the following sequence encode before encountering a stop
codon? 5′ - AUGCGAUUAUAGUGC - 3′
Answer: 3 (AUG CGA UUA UAG)
Section: 9.5
Skill: Application/Analysis
7
Copyright © 2013 Pearson Education, Inc.
17) Many antibiotics cause mispairing between codons and anticodons. What fatal effect would this
mispairing have on the cell?
Answer: defective protein synthesis
Section: 9.6
Skill: Application/Analysis
19) In the Golgi, what type of protein modification will signal the polypeptide destination by
determining the receptor to which the peptide will bind?
Answer: glycosylation
Section: 9.6
Skill: Application/Analysis
20) In the ER, misfolded proteins are identified and bound by what molecules?
Answer: chaperones
Section: 9.6
Skill: Knowledge/Comprehension
1) ________ help control ribosome formation and binding of the initiator tRNA.
Answer: Initiator factor proteins
Section: 9.1
Skill: Knowledge/Comprehension
2) In eukaryotes, the initiation factor proteins eIF1A and eIF3 join with ________ to form the
preinitiation complex.
Answer: charged tRNAMet
Section: 9.2
Skill: Knowledge/Comprehension
3) Bacteria group their genes such that they share a single promoter and the mRNA transcript
synthesizes several different polypeptides. Collectively, these are referred to as ________ mRNAs,
which are part of the operon system.
Answer: polycistronic
Section: 9.3
Skill: Knowledge/Comprehension
4) Using mathematical reasoning, a triplet genetic code gives a possible ________ different codons,
while a doublet genetic code would yield ________ different codons. Thus, the triplet code accounts for
20 known amino acids and indicates redundancy in the genetic code.
Answer: 64; 16 (4n, where n = # of nucleotides per codon)
Section: 9.4
Skill: Knowledge/Comprehension
8
Copyright © 2013 Pearson Education, Inc.
5) A signal sequence at the N-terminus of newly synthesized proteins will direct the protein to the
________ for protein packaging.
Answer: endoplasmic reticulum (ER)
Section: 9.6
Skill: Knowledge/Comprehension
1) Describe the process of two-dimensional gel electrophoresis. What are the two dimensions referring
to? How is this technique different from conventional gel electrophoresis, and when would it be used?
Answer: In 2-D gel electrophoresis, proteins are separated in the first dimension by a version of gel
electrophoresis known as isoelectric focusing. In this procedure, proteins are separated exclusively by
their charge. A protein's pH environment affects its charge, and every protein has a pH–called the
isoelectric point–at which it has neutral charge and cannot move in an electrical field. In isoelectric
focusing, proteins migrate through a pH gradient to their isoelectric point, where they stop.
Once isoelectric focusing is complete, protein separation takes place in the second dimension that uses
sodium dodecyl sulfate (SDS) gel electrophoresis. SDS is a strong anionic detergent that denatures
proteins by disrupting the interactions that keep them folded. Denatured proteins migrate through the gel
at a rate determined by their mass, that is, by the number of amino acids they contain. In the SDS gel
dimension of two-dimensional gel electrophoresis, each protein has a unique starting point
corresponding to its isoelectric point. Proteins with large mass (more amino acids) migrate a short
distance in the second dimension, whereas proteins with small mass (fewer amino acids) migrate a
greater distance.
One-dimensional gel electrophoresis uses a buffered solution to maintain constant pH throughout the
gel, while isoelectric focusing gels contain a pH gradient. Therefore, two-dimensional gel
electrophoresis separates proteins based on charge and mass.
Section: 9.2
Skill: Application/Analysis
9
Copyright © 2013 Pearson Education, Inc.
2) Starting translation at the authentic (correct) start codon is essential for translation of the correct
polypeptide. Errant translation starting at the wrong codon, or even at the wrong nucleotide of the start
codon, may produce an abnormal polypeptide and result in a nonfunctional protein. Compare and
contrast the mechanisms used by bacteria and eukaryotes to identify the authentic start codon during
translation initiation.
Answer: In bacteria (specifically E. coli), six components are involved in translation initiation: (1)
mRNA, (2) small ribosomal subunit, (3) the large ribosomal subunit, (4) the initiator tRNA, (5) three
essential initiation factor proteins, and (6) GTP.
The preinitiation complex forms when the authentic start codon sequence is identified by base pairing
that occurs between the 16S rRNA in the 30S ribosome and a short mRNA sequence located a few
nucleotides upstream of the start codon in the 5′ UTR of mRNA. The complex knows where to assemble
on the mRNA because of the Shine-Dalgarno sequence, a purine-rich sequence of about six nucleotides
located three to nine nucleotides upstream of the start codon. A complementary pyrimidine-rich segment
containing the sequence UCCUCC is found near the 3′ end of 16S rRNA, and it pairs with the Shine-
Dalgarno sequence to position the mRNA on the 30S subunit such that it recognizes the correct start
codon.
In eukaryotes, the preinitiation complex is recruited to the 5′-cap region of mRNA, located at the end of
the 5′ UTR. Once the eukaryotic initiation complex is formed, it embarks on a process called scanning,
in which it uses ATP hydrolysis to move the small ribosomal subunit through the 5′ UTR in search of
the start codon. About 90% of eukaryotic mRNAs use the first AUG encountered by the initiation
complex as the start codon. The initiation complex is able to accurately locate the authentic start codon
because the codon is embedded in a consensus sequence, the Kozak sequence, which reads 5' -
ACCAUGG - 3'.
Section: 9.2
Skill: Application/Analysis
10
Copyright © 2013 Pearson Education, Inc.
4) Polypeptides must be sorted after translation. Does protein sorting occur in both prokaryotes and
eukaryotes? Describe the process of protein sorting and explain how the signal sequence is involved.
What would you expect to see if the signal sequence has been mutated or deleted?
Answer: Protein sorting is a process that uses signal sequences of amino acids at the N-terminal end of
a polypeptide to sort proteins and direct them to their cellular destinations.
Protein sorting is needed in bacterial cells because of the many proteins specifically destined for the cell
membrane. In eukaryotes, however, protein sorting is far more complex than in bacteria; proteins are
dispatched to particular cellular organelles, such as the chloroplast, mitochondrion, lysosome, and
nucleus, and certain proteins are secreted from the cells. If the signal sequence is mutated, proteins may
not be secreted or processed properly and will begin to accumulate within the cell. Ultimately, this will
result in cell death and impaired protein secretion.
Section: 9.6
Skill: Application/Analysis
5) Describe what is meant by a "conformational disease" and give an example. Why do you think these
diseases exhibit late age of onset?
Answer: Diseases resulting from the death of cells due to accumulation of misfolded proteins are
classified as conformational diseases. Several human protein conformational diseases are known, and
they are often neurodegenerative disorders and dementias. For example, Alzheimer disease is produced
by the accumulation of misfolded β-amyloid protein that leads to the destruction of certain brain cells. A
familial form of Parkinson disease produced by the accumulation of misfolded α-synuclein protein also
results in the destruction of certain brain cells. Similarly, Huntington disease is produced by the
destruction of neurons due to the accumulation of misfolded huntingtin protein. Each of these diseases
has a late age of onset that is due to gradual cell death caused by the presence of abnormal aggregates of
misfolded protein. These diseases are neuronal because that is where the genes encoding the proteins are
expressed.
Section: 9.6
Skill: Application/Analysis
6) Compare and contrast the mechanism of action of two commonly used antibiotics. Include details
about which steps of translation are inhibited, and explain how the antibiotic accomplishes this
inhibition.
Answer: Antibiotics target different aspects of microbe biology to kill microorganisms. Familiar
antibiotics such as tetracycline, streptomycin, and chloramphenicol target different stages of microbial
translation, as do less familiar antibiotics such as erythromycin, puromycin, and cycloheximide. Each
antibiotic contains a different active compound that takes advantage of unique features of bacterial
translation to disrupt the production of bacterial proteins while not interfering with the translation of
proteins in our cells. That is how the antibiotic selectively kills the bacteria and does not harm our cells.
11
Copyright © 2013 Pearson Education, Inc.
Answers may vary, but some potential answers are listed below.
Section: 9.6
Skill: Application/Analysis
12
Copyright © 2013 Pearson Education, Inc.
Another random document with
no related content on Scribd:
motiveeranneet nuo ihmiset vaarallisiksi, sanoneet heidän levittävän
myrkkyään yhteiskunnassa ja olevan ilman moraalia, ilman uskontoa
ja ajattelevan vain omia nautintojaan. Tuo mies kai oli tuommoinen
uudenaikainen ihminen, joka nauraa kaikelle ja jolle mikään ei ole
pyhää. — — —
*****
Hän oli yksinään maailmassa. Hän tapasi erään kirjailijan, jota hän
aikaisemmin oli paljon ajatellut ja jota hän oli ihaillut, kuten monia
muitakin. Tämä mies oli viisas, ironinen, kylmä, häntä vihattiin ja
hänestä pidettiin, mutta häntä kohtaan tunnettu viha oli ehkä
suurempi kuin rakkaus. Tällä miehellä oli tapana osoittaa
ylemmyyttään äänensä sävyllä ja eräällä ominaisella kädenliikkeellä,
joka helposti loukkasi ihmisiä. Tämä mies laski leikkiä ihmisten
heikkouksista, leikki niiden kanssa kuin kissa hiiren kanssa. Tämä
mies nauroi niin herttaisesti ja niin katkerasti sille kullalle, jolla
ihmiskunta niin kernaasti itseään kultaa. Tämä mies oli intohimoisen
kiihkeä, egoisti, — mutta välillä taas melankolinen, raskasmielinen,
pilkallinen, hermostuneen eloisa, iloinen, mutta ilo oli jäistä iloa. He
olivat tuttavia, mutta kuitenkin toisilleen täysin tuntemattomia. He
olivat molemmat kaksoisluonteita omalla tavallaan. Se oli lyhyt ja
kiihkeä tuttavuus, ilman aikaa ja ilman valmistelua.» ‒ ‒ ‒
XI.
LAURI KIVEKÄS.
»En voi oikein paperilla kuvata tätä iltaa — Kivekäs puhui — moni
muu puhui — jokaisen silmät kiilti, jokaisen povi kohoili — eläköön
isänmaa — suomalaisuus — eläköön Kivekäs —! Maljat kilisi —
laulut helisi, booli virtaili! —»
*****
Minä en tiedä mitä sinä nyt tällä hetkellä ajattelet ja tunnet, vaan
minä rakastan sinua, minä annan henkeni sinulle ja rukoilen
Jumalaa varjelemaan sinua minulle.
Ida.»
»Sunnuntaina.
»Perjantai ilta.
»Armas!
»Oma Laurini! Minä kaduin että olin sinun antanut huomata sitä
levottomuutta joka minussa vallitsi ja joka kirjeissäni liian paljon tuli
esille. Mutta se on tullut omantunnon asiaksi ilmoittaa sinulle kaikki
vivahdukset. Minulla oli niin ikävä jäädä yksin tähän etäiseen
kaupunkiin» (nim. Viipuriin) »tuntui kuin kaikki lempeät tuulet ja
kauniit ilmat olisivat kadonneet sinun kerrallasi. Minä tunsin itseni
niin hyljätyksi ja yksinäiseksi. Minä sanon kun sinä, minä varmaan
pidän sinusta liian paljon.» —
»Laurini, armaani!
Ida.»