Genetics Essentials Concepts and

Connections 1st Edition Pierce Test

Bank
Visit to download the full and correct content document: https://testbankdeal.com/dow
nload/genetics-essentials-concepts-and-connections-1st-edition-pierce-test-bank/
Chapter 10
From DNA to Proteins: Transcription and RNA
Processing

True/False

1. All RNAs are translated. (F)

2. In transcription, all parts of the DNA molecule are transcribed into RNA. (F)

3. In all organisms, all genes are transcribed from the same strand. (F)

4. Certain RNA molecules behave as enzymes that can catalyze activities such
as RNA processing, RNA replication, and peptide bond formation between amino
acids. (T)

5. The presence of consensus in a sequence of DNA nucleotides usually

indicates that the sequence is associated with an important function. (T)

6. Introns contain no sequence-specific information. (F)

7. Most eukaryotic genes contain more non-coding nucleotides than nucleotides

that encode amino acids in polypeptides. (T)

8. Initiation of transcription does not require a primer. (T)

9. Energy for phosphodiester bond formation comes from the removal of two
phosphates from each added nucleotide. (T)

10. RNA molecules have the same 5′ to 3′ orientation as the DNA template
strands to which they are complementary. (F)

11. Eukaryotic genes usually include a long stretch of T nucleotides that encode
a poly(A) tail at the 3’ end of the corresponding mRNA molecules. (F)

12. Typically, each human gene encodes a single polypeptide. (F)

13. Intron cleavage and exon splicing are both mediated by the spliceosome. (T)

14. Introns are degraded in the cytoplasm. (F)

15. Transcription and translation take place simultaneously in bacterial cells. (T)
From DNA to Proteins: Transcription and RNA Processing

Fill in the Blank

16. Whereas the nucleotide strand used for transcription is termed the template
strand, the nontranscribed strand is called the nontemplate strand.

17. In transcription, nucleotides are always added to the 3′ end of the elongating
strand.

18. In a transcription reaction, two phosphate groups are cleaved from the
incoming ribonucleoside triphosphate; the remaining phosphate group is
attached to the growing RNA molecule by a phosphodiester bond.

19. RNA polymerase must bind to a region of DNA called a(n) promoter in order
to begin transcription.

20. In eukaryotes, RNA polymerase II transcribes the genes that encode

proteins.

Multiple Choice

21. Which statement about RNA polymerase is not true?

a. RNA polymerase can initiate RNA synthesis from scratch and does not require
a primer.
b. RNA polymerase synthesizes RNA 5’ to 3’.
c. RNA polymerase reads DNA 3’ to 5’.
*d. RNA polymerase normally transcribes both strands of DNA during expression
of a particular gene.
e. RNA polymerase must bind to a promoter in order to initiate transcription.

22. Which is a mechanism that allows a single gene to encode more than one
polypeptide?
a. Regulation of mRNA stability
*b. Alternative RNA splicing
c. RNA interference
d. Reverse transcription
e. None of the above

23. If the sequence of an RNA molecule is 5’-GGCAUCGACG-3’, what is the

sequence of the template strand of DNA?
a. 5’-GGCATCGACG-3’
b. 3’-GGCATCGACG-5’
c. 5’-CCGTAGCTGC-3’
*d. 3’-CCGTAGCTGC-5’
e. None of the above

24. During gene expression, which molecule(s) carries the information that
encodes polypeptides?
a. tRNA
 Chapter 10

*b. mRNA
c. rRNA
d. snRNA
e. More than one of the above

25. If the sequence of a nontemplate strand of DNA is

5’-ACCGCATCCGAGTCAC-3’, what is the sequence of the primary product of
transcription?
a. 3’-UGGCGUAGGCUCACUG-5’
b. 3’-TGGCGTAGGCTCACTG-5’
*c. 5’-ACCGCAUCCGAGUCAC-3’
d. 5’-ACCGCATCCGAGTCAC-3’
e. None of the above

26. An in vitro transcription system that contains a bacterial gene initiates

transcription, but from random points on the DNA. Which of the following proteins
most likely is missing from the reaction?
*a. sigma factor
b. rho factor
c. RNA polymerase II
d. TATA-binding protein

27. In eukaryotes, the 5′ cap on an mRNA is important for all the processes listed
below except for the a of an mRNA molecule.
*a. transcription
b. intron removal
c. stability
d. initiation of translation

28. An in vitro transcription system transcribes a bacterial gene but terminates

inefficiently. What is one possible problem?
a. There is a mutation in the –10 consensus sequence, which is required for
efficient termination.
*b. Rho factor has not been added.
c. Sigma factor has not been added.
d. Spliceosomes have not been added.

29. The DNA replication enzyme that most closely resembles RNA polymerase is
a. DNA polymerase I.
b. DNA polymerase III.
*c. primase.
d. telomerase.
e. helicase.

30. Which of the following is not necessary for RNA polymerase to recognize the
promoter of a bacterial gene?
a. sigma factor
*b. origin of replication
From DNA to Proteins: Transcription and RNA Processing

c. –10 consensus sequence

d. –35 consensus sequence

Use the following list for questions 31–35.

a. RNA only
b. DNA only
c. both RNA and DNA
d. neither RNA nor DNA

31. When this molecule is synthesized, both strands of a DNA molecule are used
as a template.
*b

32. This molecule is synthesized using triphosphate nucleotides as a substrate

for a polymerase enzyme that forms phosphodiester bonds.
*c

33. This molecule is synthesized using nucleotides containing the bases adenine,
guanine, cytosine, and uracil.
*a

34. The polymerase that synthesizes this molecule uses DNA as a template and
synthesizes new strands from 5′ to 3′.
*c

35. This molecule is made of nucleotides joined by phosphodiester bonds that

connect the 2′ OH to the 5′ phosphate.
*d

36. If the following DNA strand was used as a template, what would the
sequence of an RNA be?

5′ GTACCGTC 3′

a. 5′ GUACCGUC 3′
b. 5′ GACGGTAC 3′
c. 5′ CAUGGCAG 3′
*d. 5′ GACGGUAC 3′
e. 5′ GUCGGUAC 3′

37. What is the function of eukaryotic RNA polymerase I?

*a. transcription of rRNA genes
b. transcription of mRNA genes
c. transcription of tRNA genes
d. transcription of snRNAs
e. initiation of transcription (but not elongation)
 Chapter 10

38–39. The poly(A) tails found in the 3′ end of an mRNA are important for all the
processes listed below except for c and d .
a. mRNA stability
b. translation
*c. intron splicing
*d. protein stability

Short Answer Discussion

40. What is an snRNP and what role does it play in the cell?

A small nuclear ribonucleoprotein is a complex of small nuclear RNAs

(snRNAs)—U1, U2, etc.—and proteins that catalyze the transesterification
reactions and splicing of exons during eukaryotic mRNA processing.

41. If you were asked to isolate total RNA from two unknown samples and then
were required to identify if the RNA was from prokaryotes or eukaryotes, what
aspects regarding the classes of RNA present would help you distinguish one
from the other?

RNA from prokaryotes will contain mRNA, tRNA, and rRNA. In addition to
these three types of RNA, eukaryotic samples will contain pre-mRNA,
snRNA, snoRNA, miRNA, and siRNA.

42. What are the three different eukaryotic RNA polymerases and what types of
genes do they transcribe?

(1) RNA polymerase I transcribes rRNA.

(2) RNA polymerase II transcribes pre-mRNA and some snRNA.
(3) RNA polymerase III transcribes tRNA, small rRNA, and some snRNAs.

43. What would you add to an in vitro transcription system that contains an E. coli
gene for glyceraldehyde 3-phosphate dehydrogenase, an enzyme in glycolysis,
in order to get transcription that begins from the normal transcription start site?

(1) RNA polymerase

(2) sigma factor
(3) ribonucleoside triphosphates with A, C, G, and U bases (rNTPs)

44. If you remove the TATA box and place it immediately upstream of a
transcription start site of a eukaryotic gene, and subsequently transcription of the
mRNA is assayed, will you still achieve transcription from the same start site?

No. The TATA box needs to be present a certain number of nucleotides

upstream of the transcription start site to allow enough space for the
assembly of TATA-binding protein and other transcription factors on the
core promoter. The RNA polymerase can then be placed appropriately over
the transcription start site.
From DNA to Proteins: Transcription and RNA Processing

45. What provides the energy for RNA synthesis?

Hydrolysis of PPi from each incoming ribonucleoside triphosphate (with

subsequent hydrolysis of PPi to two inorganic phosphates).

46. A new mutation in Saccharomyces cerevisiae, a eukaryotic yeast, causes the

cells to be unable to produce the amino acid histidine. Specifically, they cannot
catalyze the first reaction in the histidine biosynthesis pathway. When examined
closely, they are producing a completely wild-type enzyme for this reaction, but at
greatly reduced levels. Explain the mutation.

The mutation is in the promoter for the gene reducing transcription.

47. What is the RNA sequence transcribed from the DNA shown below?

promoter +1

5′ GTAACTATAATTAACGTAAGACTAT 3′
3′ CATTGATATTAATTGCATTCTGATA 5′

5′ GUAAGACUAU 3′

48. Explain at least two reasons why the following definition of a gene is
inadequate: “A gene consists of DNA sequences that are transcribed into a
single RNA molecule that encodes a single polypeptide.”

(1) Because of alternative splicing, a single gene can yield multiple mRNA
and protein products.
(2) Sometimes, as with ribosomal RNAs, a single transcript is made, but
then several RNA molecules are liberated from it.
(3) Splicing means that not all sequences end up in the mature RNA
(introns removed).
(4) RNA can be the functional product of a gene, so a gene doesn’t always
encode a polypeptide.
(5) Regulatory sequences (i.e., promoters, enhancers, etc.) that control
the timing, degree, and specificity of gene expression are required
elements for expression of any given gene, but they are not
transcribed.

49. In your own words, list a comprehensive definition for “gene” at the molecular
level.

A gene is a sequence of DNA, including all structural and regulatory

sequences, that encodes information dictating synthesis of one or more
functional polypeptides or RNA molecules. Note that this is one possible
definition; see if you can come up with an even better one.
 Chapter 10

Extended Answer Discussion

50. The discovery of ribozymes led to the theory that the evolution of life on earth
began with an “RNA world.”

(a) Describe the chemical properties and functions of RNA that would allow it to
be the basis of the first self-replicating systems.

(1) As a nucleic acid, RNA can serve as a template for self-replication: an

RNA can be copied into a complementary strand that is a template for
generating more of the original RNA.
(2) As a nucleic acid, RNA can carry genetic information in its base
sequence.
(3) RNA possibly could have performed the reactions required of a self-
replicating system because RNA ribozymes have catalytic activity.

(b) Describe how the current cellular role of RNA supports this theory.

(1) RNA is an intermediate between DNA, the permanent genetic

information, and proteins.
(2) RNA has a role as a primer for DNA replication.
(3) RNA is required for protein synthesis as mRNA, rRNA, and tRNA.

(c) What properties of proteins and DNA make them more suitable than RNA as
enzymes and the cell’s genetic material?

(1) Proteins are made of 20 different amino acids; RNA is made of relatively
uniform nucleotides with only four different bases. Because they can be
more chemically diverse, proteins are better suited to catalyzing a
variety of cellular reactions.
(2) DNA is double-stranded, with a structure that protects the molecule
from degradation. The lack of 2′ OH makes the molecule less
susceptible to self-hydrolysis. Because it is more stable, DNA is a better
molecule for the cell’s genetic material.

51. List five different classes of RNA molecules found in eukaryotes and describe
their functions.

(1) Messenger RNA (mRNA): the molecular messenger that carries

functional genetic code, encoded in DNA, to the cytoplasm for
translation into polypeptide products
(2) Ribosomal RNA (rRNA): along with specific proteins, an integral
component of large and small ribosomal subunits
(3) Transfer RNA (tRNA): the “adaptor” molecule that couples the
functional genetic code, carried by mRNA, with ribosomes for
translation into specific polypeptides
From DNA to Proteins: Transcription and RNA Processing

(4) Small nuclear RNAs (snRNAs): integral components of the spliceosome,

which mediates precise processing of pre-mRNA molecules in the
nucleus
(5) Small nucleolar RNAs (snoRNAs): integral components for processing
(primarily) eukaryotic rRNAs; located in the nucleolus

53. In 1958, Francis Crick proposed that genes and their corresponding
polypeptides are “colinear.” Explain why the idea of colinearity must be qualified
for both prokaryotic and eukaryotic genes.

In this context, colinearity simply means that the linear nucleotide

sequence of a given gene corresponds directly to the linear amino acid
sequence in the corresponding polypeptide. This implies that the number
of nucleotides in a gene should be precisely proportional to the number of
amino acids present in the corresponding polypeptide. Colinearity
generally holds true for the coding regions of prokaryotic genes, which in
most cases don’t contain introns. However, intervening sequences
(introns) discovered during the mid-1970s disqualify this idea for the vast
majority of eukaryotic genes. In addition, another exception to colinearity
between genes and polypeptides is the presence of untranslated
sequences, or regions (called UTRs), in both prokaryotic and eukaryotic
genes. The protein-coding sequences in virtually all mRNA molecules
(prokaryotic and eukaryotic) are flanked by 5′ and 3′ UTRs of variable
length.

54. Devise a strategy to prove that splicing occurs in the nucleus.

Collect cells and fractionate them into nuclear and cytoplasmic fractions.
Isolate the proteins from each of the fractions. Add a pre-mRNA (made in
vitro) with introns to each of the protein fractions. Monitor the progressive
decrease in the size of pre-mRNA in the nuclear fraction by separating the
RNA products on a gel, which can resolve size differences between pre-
mRNA (longer) and spliced mRNA (shorter). The cytoplasmic fraction will
be incapable of splicing, and therefore the pre-mRNA remains intact over a
period of time without undergoing splicing. The difference in the ability to
splice suggests that the nuclear fraction contains the machinery essential
for splicing.

55. What are some of the different ways that the word “gene” is defined at the
molecular level? What are some of the advantages and disadvantages of the
different definitions?

(1) Definition of “gene”: A sequence of DNA-carrying information that

encodes a single polypeptide.
Advantages/disadvantages of this definition: This definition does not
take into account either the production of multiple mRNA transcripts via
alternative splicing or the transcription of RNA end products (e.g., tRNA,
rRNA, snRNA, etc.).
 Chapter 10

(2) Definition of “gene”: A sequence of DNA that can be transcribed into an

RNA or protein product(s).
Advantages/disadvantages of this definition: This definition does not
take into account the influence of regulatory sequences (promoters,
termination signals, etc.) that are required for gene function and, in fact,
must be included in any definition of “gene.”

56. Explain how the transcription apparatus knows which strand of DNA on a
gene to transcribe and where to start and stop. Be sure to include in your
answer the names and descriptions of DNA sequence elements on the
transcription unit that are important to this process.

The promoter is a DNA sequence that RNA polymerase binds to and that
determines both the direction of transcription and which DNA strand is to
be transcribed. It also establishes where transcription will begin (the
transcription inititiation site). Promoters generally are found just upstream
from the transcription initiation site. Promoters vary in sequence from
gene to gene, but different promoters share certain conserved sequences
called consensus sequences that the transcription apparatus recognizes
and binds to. The terminator is a sequence near the downstream end of
the RNA-coding sequence that signals the end of transcription. Some
terminators require the action of an ancillary protein called rho factor, while
others do not require rho.

57. Explain why the nematode worm C. elegans has become an important model
system in genetics and developmental biology. Your answer should include
details regarding the anatomy, development, and life cycle of the organism, the
nature of its genome, and the genetic and molecular biology techniques that are
available to researchers.

C. elegans is small, easy to culture, and produces large numbers of

offspring. The generation time is only about 3 days. The worms are
transparent, allowing for easy observation of internal development at all
stages. The body structure is simple with fairly invariant patterns of cell
division leading to a predictable normal body plan. This has allowed
researchers to map the lineages of every cell in the body back to the
zygote. The worms occur as hermaphrodites and males, allowing for them
to fertilize themselves or to be crossed with other worms. The relatively
small size of the genome facilitates genomic analysis, and the genome has
been completely sequenced, allowing for identification of all genes.
Chemical and other mutagens have been used to generate and isolate
many mutations that affect all aspects of development, anatomy, and
physiology. C. elegans is particulary susceptible to RNA interference,
allowing for gene functions to be assayed fairly easily by shutting down
their expression at particular points of development.

Problems and Calculations

From DNA to Proteins: Transcription and RNA Processing

58. On the DNA strands shown below, two RNA polymerase enzymes are using
the top strand as a template. In the boxes, label the 5′ and 3′ ends of the DNA
molecules and the RNA molecules being made. With arrows, indicate the
directions, left to right or right to left, that the polymerases are moving.

*5′ *5′

*3′ *3′
* *
*3′ *5′

*5′ *3'

59. Draw the structure of a typical eukaryotic pre-mRNA molecule transcribed

from a gene containing one intron and two exons. Indicate the introns and exon,
splice sites, branch point, poly(A) site, 5′ UTR, and 3′ UTR.

exon 1 exon 2
GU intron AG
AAUAAA
5′ UTR 3′ UTR
Another random document with
no related content on Scribd:
back
back
back
back
back
back
back
back
back
back
back