Professional Documents
Culture Documents
一个新的水稻白化转绿突变体的生理特性和基因定位
一个新的水稻白化转绿突变体的生理特性和基因定位
2
(3:1)
P
Qiufeng Qiufeng M 37 0 196 59 0.38 0.50-0.75
Qiufeng M Qiufeng 21 0 118 46 0.66 0.25-0.50
Peiai 64S Qiufeng M 44 0 2,543 813 1.03 0.25-0.50
A mapping population consisting of 28 recessive
individuals was analyzed to confirm the linkage rela-
tion between markers and mutated gene. The band
types of RM318, RM530, and RM406 on chromo-
some 2 distorted to that of Qiufeng M, the segregation
ratios of Peiai 64S homozygote, heterozygote, and
Qiufeng M homozygote derived from the cross
Peiai 64SQiufeng M were 1:19:8, 2:17:9, and
6:12:10. This result implied that this mutated gene
was located on rice chromosome 2.
On the basis of the experiment above, six pairs
of SSR markers were detected, which were polymor-
phic, from 42 pairs of SSR markers published on a
website (www.gramene.org) or developed by the
laboratory here (Table 4). The green-revertible albino
gene was located between two SSR markers, RM475
and RM2-22 (Fig. 2) on the long arm of chromosome
2, using 209 recessive mutant individuals from F
2
population from the cross Peiai 64S Qiufeng M.
The genetic distances were 17.3 cM and 2.9 cM, re-
spectively (Fig. 3). This novel green-revertible albino
gene in rice is tentatively designated as gra
(t).
3 Discussion
Natural leaf color is the result of evolution in
plants, and the change of leaf color can lead to growth
retardation, weakness in competitiveness, decrease of
biomass yield or even death. Green-revertible albino
mutant is an important plant germplasm. The mecha-
nism of green-revertible albino can be illuminated,
through gene mapping, cloning, functional analysis,
expression, and regulation in basic research. This
mutation also has much practical value in rice breed-
ing. On the one hand, the male-sterile lines carrying
this mutated gene grow well without influencing the
seed production. On the other hand, it can be used as
a recessive phenotypic marker for monitoring seed
purity in seed production of hybrid rice, especially in
two-line hybrid rice in which seed purity is usually
affected by temperature.
Expression of the green-revertible albino in
Qiufeng M is not similar to W
1
, W
17
, W
24
, W
25
,
W
29
[30]
, Yutu S, and Baifeng A. The first three leaves
do not convert to green until senescence and the color
of green revertible leaves and glume are virescent.
These characters ensure the purity of hybrids in all
growth stages effectively.
The mutated gene has an influence only on neck
length and 1,000-grain-weight. The neck length of
Qiufeng M is shorter than that of Qiufeng. It is pre-
sumed that it may be because of the multi-effect of
the mutated gene. The lighter grain weight may be the
result of insufficient grain filling because of the pig-
ment deficiency in the mutant
[31]
.
Table 4 Polymorphic SSR markers developed on chromosome 2 of rice
Markers Forward sequences (53) Reverse sequences (53) GenBank No.
Anneal tem-
perature()
Size of amplified
fragment (bp)
RM2-22 TTTACTTTGACTCGTCCTGT CTGATCCAGTGATCCTCC AP004059 51.2 167
RM2-33 TCTTACCTGTTACGGAGTAC GCGTTATGCGATGGAGC AP006168 49.7 144
RM2-37 CACCACCAAACGGAAGG CTGGCAATCACAGCAGTAGC AP006452 53.4 106
336 Journal of Genetics and Genomics Vol.34 No.4 2007
www.jgenetgenomics.org
Fig. 2 The parental polymorphism of SSR marker RM2-22 and its segregation in some F
2
plants
M: 50 bp ladder; P
1
: Peiai 64S; P
2
: Qiufeng M; F
1
: Peiai 64SQiufeng M; Number: the genotype symbols of F
2
plants.
Fig. 3 Genetic linkage map of gra
(t)
on chromosome 2
The sensitivity to environmental factors must be
considered, when the leaf color is selected as a phe-
notypic marker. The occurrence of albino in Qiufeng
M does not associate with temperature. Therefore, in
terms of stability, this mutant meets the requirement
of a potential screening marker
[32]
.
Gene nominated gra in Yutu S was mapped be-
tween the two SSR markers of RM496 and RM590 on
rice chromosome 10 by Zhao et al
[18]
. However, gra
(t)
was located on chromosome 2 in this study. It was
obvious that they were not the same genes. The action
mechanism of gene gra
(t)
for leaf color and neck
length remains unclear.
References
1 Espineda CE, Linford AS, Devine D, Brusslan JA. The AtCAO
gene, encoding chlorophyll a oxygenase, is required for chloro-
phyll b synthesis in Arabidopsis thaliana. Proc Natl Acad Sci
USA, 1999, 96(18): 1050710511.
2 Yu QB, Jiang H , Mi HL, Zhou GY, Yang ZN. The physiological
character and molecular mapping in rice albino21 mutant. Journal
of Shanghai Normal University (Natural Sciences), 2005, 34(1):
7075 (in Chinese with an English abstract).
3 Schultes NP, Sawers RJH, Brutnell TP, Krueger RW. Maize high
chlorophyll fluorescent 60 mutation is caused by an Ac disruption
of the gene encoding the chloroplast ribosomal small subunit pro-
tein 17. Plant J, 2000, 21(4): 317327.
4 Rzeznicka K, Walker CJ, Westergren T, Kannangara CG, Wett-
stein DV, Merchant S, Gough SP, Hansson M. Xantha-l encodes a
membrane subunit of the aerobic Mg-protoporphyrin IX mono-
methyl ester cyclase involved in chlorophyll biosynthesis. Proc
Natl Acad Sci USA, 2005, 102(16): 58865891.
5 Guo AG, Feng XZ, Zhao LL, Wang PH. Studies on the activity of
translation and transcription in the leaves of wheat albescent line.
Acta Agricultural Boreali-Occidentalis Sinica, 1996, 24(1): 14
(in Chinese with an English abstract).
6 Dong Z, Liu JY, Ma HM, Xu CK, Sun H, Zhang JD. Chlorophyll
contents and chloroplast ultrastructure of chlorophyll deficient
mutant in B. napus. Chinese Journal of Oil Crop Sciences, 2000,
22(3): 2729 (in Chinese with an English abstract).
7 Wettstein DV, Gough S, Kannangara CG. Chlorophyll Biosyn-
thesis. Plant Cell, 1995, 7(7): 10391057.
8 Beale SI. Enzymes of chlorophyll biosynthesis. Photosynth Res,
1999, 6(1): 4373.
9 Eckhardt U, Grimm B, Hortensteiner S. Recent advances in chlo-
rophyll biosynthesis and breakdown in higher plants. Plant Mol
Biol, 2004, 56(1): 114.
10 Sundberg E, Slagter JG, Fridborg l, Cleary SP, Robinson C,
Coupland G. Albino3, an Arabidopsis nuclear gene essential for
Tao Chen et al.: Physiological Character and Gene Mapping in a New Green- revertible Albino Mutant in Rice 337
www.jgenetgenomics.org
chloroplast differentiation, encodes a chloroplast protein that
shows homology to proteins present in bacterial membranes and
yeast mitochondria. Plant Cell, 1997, 9(5): 717730.
11 Kumar AM, Soll. Antisense HEMA1 RNA expression inhibits
heme and chlorophyll biosynthesis in Arabidopsis. Plant Physiol,
2000, 122(1), 4955.
12 Terry MJ, Kendrick RE. Feedback inhibition of chlorophyll syn-
thesis in the phytochrome chromophore-Deficient aurea and yel-
low-green-2 Mutants of Tomato. Plant Physiol, 1999, 119(1):
143152.
13 Ishikawa A, Okamoto H, Iwasaki Y, Asahi T. A deficiency of
coproporphyrinogen III oxidase causes lesion formation in
Arabidopsis. Plant J, 2001, 27(2): 8999.
14 Huang XQ, Zhao HX, Dong CL, Sun YY, Wang PR, Deng XJ.
Chlorophyll-deficit rice mutants and their research advances in
Biology. Acta Botanica Boreali-Occidentalia Sinica, 2005, 25(8):
16851691 (in Chinese with an English abstract).
15 Jung KH, Hur JH, Ryu CH, Choi YJ, Chung YY, Miyao A, Hiro-
chika H, An GH. Characterization of a rice chlorophyll-deficient
mutant using the T-DNA gene-trap system. Plant Cell Physiol,
2003, 44(5): 463472.
16 Lee S, Kim JH, Yoo ES, Lee CH, Hirochika H, An GH. Differen-
tial regulation of chlorophyll a oxygenase genes in rice. Plant Mol
Biol, 2005, 57(6): 805818.
17 Shu QY, Chen SF, Wu DX, Shen SQ, Cui HR, Xia YW. Studies
on breeding of a new type of cytoplasmic male sterile rice line
Quanlong A. Scientica Agricultura Sinica, 2001, 34(4): 349354
(in Chinese with an English abstract).
18 Zhao HJ, Wu DX, Shu QY, Shen SQ, Ma CX. Breeding and
characteristics of photo-thermo sensitive genic male sterile rice
Yutu S labeled with green-revertible albino leaf marker. Chinese
Journal of Rice Science, 2004, 18(6): 515521 (in Chinese with
an English abstract).
19 Shen SQ, Shu QY, Bao JS, Wu DX, Cui HR, Xia YW. Develop-
ment of a greenable leaf colour mutant Baifeng A and its applica-
tion in hybrid rice production. Chinese Journal of Rice Science,
2004, 18(1): 3438 (in Chinese with an English abstract).
20 Arnon DI. Copper enzymes in isolated chloroplasts poly-
phenoloxidase in Beta vulgaris plant. Plant Physiol, 1949, 24(1):
115.
21 Li HS, Sun Q, Zhao SJ, Zhang WH. Principles and Techniques of
Plant Physiological Biochemical Experiment. 1st. Beijing: China
Higher Education Press, 2000, 134137.
22 Shu QY, Liu GF, Xia YW. Temperature-sensitive leaf color mu-
tation in rice (Oryzae sativa L.). Acta Agriculturae Nucleatae
Sinica, 1996, 10(1): 610 (in Chinese with an English abstract).
23 Dellaporta SL, Wood J, Hicks JB. A plant DNA minipreparation:
Version. Plant Mol Biol Rep, 1983, 1(1): 1921.
24 Temnykh S, Park WD, Ayres NS, Cartinhour N, Hauck L,
Lipovich YG, Cho TI, McCouch SR. Mapping and genome or-
ganization of microsatellite sequences in rice (Oryzae sativa L.).
Theor Appl Genet, 2000, 100(5): 697712.
25 McCouch SR, Teytelman L, Xu YB, Lobos KB, Clare K, Walton
M, Fu BY, Maghirang R, Li ZK, Xing YZ, Zhang QF, Kono I,
Yano M, Fjellstrom R, DeClerrck G, Schneider D, Cartinhour S,
Ware D, Stein L. Development and mapping of 2240 new SSR
markers for rice (Oryza sativa L.). DNA Res, 2002, 9(6):
199207.
26 Chen X, Temnykh S, Xu Y, Cho YG, McCouch SR. Development
of a microsatellite framework map providing genome-wide cov-
erage in rice (Oryza sativa L.). Theor Appl Genet, 1997, 95(4):
553567.
27 Li Q, Wan JM. SSRHunter: Development of a local searching
software for SSR sites. Hereditas (Beijing), 2005, 27(5): 808810
(in Chinese with an English abstract)
28 Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln
SE, Newburg L. MAPMAKER: an interactive computer package
for constructing primary genetic linkage maps of experimental
and natural populations. Genomics, 1987, 1(2): 174181.
29 Liu RH, Meng JL. MapDraw: A microsoft Excel Macro for
drawing genetic linkage maps based on given genetic linkage data.
Hereditas (Beijing), 2003, 25(3): 317321(in Chinese with an
English abstract).
30 Xia YW, Liu GF, Shu QY, Jiang RH, Xie JH. A preliminary
study induction and identification of chlorophyll mutants of in-
dica type temperature sensitive genic male-sterile rice. Acta Ag-
riculturae Nucleatae Sinica, 1995, 9(3): 129133 (in Chinese
with an English abstract).
31 Sun JX, Tang LH, Zhu QS, Yang JC, Yang YH. Relationship
between chlorophyll content of rice glume and grain filling. Ji-
angsu Journal of Agricultural Sciences, 2001, 17(1): 2427 (in
Chinese with an English abstract).
32 Wu DX, Shen SQ, Cui HR, Xia YW, Shu QY. A novel
thermo/photoperiod-sensitive genic male-sterile (T/PGMS) rice
mutant with green-revertible albino leaf color marker induced by
gamma irradiation. Field Crops Research, 2003, 81(2): 141147.
338 Journal of Genetics and Genomics Vol.34 No.4 2007
www.jgenetgenomics.org
1, 2
2
2
2
1, 2
2
1. 210095
2. 210014
M
M
MM
209
64S M F
2
2 SSR RM475
RM2-22 17.3 cM2.9 cMgra
(t)
; ; ; SSR
(1980-); E-mailchentao19801014@126.com