Gene 497 (2012) 307313

Contents lists available at SciVerse ScienceDirect

Gene
journal homepage: www.elsevier.com/locate/gene

Short Communication

Genetic and transcriptional organization of the groEL operon containing trxA in

Gemella morbillorum
Wei-Chun Hung a, Hsiao-Jan Chen a, Sung-Pin Tseng a, Shwu-Jen Liaw a, c, Jui-Chang Tsai b, d,
Po-Ren Hsueh c, Lee-Jene Teng a, c,
a

Department of Clinical Laboratory Sciences and Medical Biotechnology, National Taiwan University College of Medicine, Taiwan
Center for Optoelectronic Biomedicine, National Taiwan University College of Medicine, Taiwan
Department of Laboratory Medicine, National Taiwan University Hospital, Taiwan
d
Division of Neurosurgery, Department of Surgery, National Taiwan University Hospital, Taiwan
b
c

a r t i c l e

i n f o

Article history:
Accepted 21 January 2012
Available online 3 February 2012
Keywords:
groEL
dnaK
Thioredoxin
Heat shock response

a b s t r a c t
Gemella morbillorum, a low G + C content Gram-positive bacterium, is considered to be a commensal organism in humans but occasionally causes endocarditis or other diseases. We determined the sequences of
groESL, dnaK and their anking regions in G. morbillorum. Sequence analysis revealed the presence of putative
CtsR binding sites in both groE and dnaK operons, but the lack of CIRCE in groE and the presence of CIRCE in
dnaK. This nding suggests in addition to the known regulatory systems for the class I heat shock protein
genes, there may be another model in G. morbillorum. Furthermore, an unusual organization of the groE operon as groES-groEL-trxA was found. Genome sequence on GenBank database and southern blot indicate that
there is only one copy of trxA in G. morbillorum. Sequencing of the groE locus from other Gemella species and
clinical isolates revealed the same genetic structure, suggesting the conservation of the structure in Gemella
species. Northern hybridization revealed that there were two transcripts, a large transcript, groES-groEL-trxA
and a small transcript, trxA, in groE operon. Treatment of heat or diamide increased the transcription level of
groES-groEL-trxA, whereas these two stresses did not affect the small trxA transcript. Thus, this study reveals
that the trxA is co-transcribed with the groE operon, and most possibly under the control of the CtsR.
2012 Elsevier B.V. All rights reserved.

1. Introduction
Gemella morbillorum, a low G + C content Gram-positive bacterium, is considered to be a commensal organism of the mouth, gastrointestinal tract, and genitourinary tract of humans and other
warm-blooded animals (Brouqui and Raoult, 2001). It is an anaerobic
to aerotolerant coccus, and its colonies on blood agar plates are pinpoint sized (Kilpper-Balz and Schleifer, 1988). G. morbillorum can
cause severe localized and generalized infection, and the most notable clinical presentation is endocarditis, which was reported to be
usually associated with poor dental state or previously damaged
cardiac valves (Brouqui and Raoult, 2001; La Scola and Raoult,
1998). We seek to understand how Gemella, the fastidious bacterial

Abbreviations: CIRCE, controlling inverted repeat of chaperone expression; HSP,

heat shock proteins; RACE, rapid amplication of cDNA ends; RT-PCR, reverse transcription-polymerase chain reaction; ORF, open reading frame.
Corresponding author at: Department of Clinical Laboratory Sciences and Medical
Biotechnology, National Taiwan University College of Medicine, Taiwan. Tel.: + 886 2
2312 3456x66918; fax: + 886 2 2371 1574.
E-mail addresses: b88404030@ntu.edu.tw (W.-C. Hung), b88404028@ntu.edu.tw
(H.-J. Chen), b86404032@ntu.edu.tw (S.-P. Tseng), sjliaw@ntu.edu.tw (S.-J. Liaw),
jctsai@ntu.edu.tw (J.-C. Tsai), hsporen@ntu.edu.tw (P.-R. Hsueh), ljteng@ntu.edu.tw
(L.-J. Teng).
0378-1119/$ see front matter 2012 Elsevier B.V. All rights reserved.
doi:10.1016/j.gene.2012.01.060

species, survives in stressful environments. However, to the best of

our knowledge, nothing is known about the genetic characterization
of stress responses in G. morbillorum.
Bacteria have developed a series of networks to adapt to environmental changes. The heat shock response is recognized as a universal
system against stress, leading to the synthesis of a group of heat shock
proteins (HSP), such as groEL and dnaK, that assist with protein
refolding or degradation (Masters et al., 2009). Regulation of heat
shock response has been studied in many bacteria. In Escherichia
coli, a specialized sigma factor 32 induces the transcription of
major heat shock genes under stress conditions (Bukau, 1993). In
the low G + C Gram-positive group, which includes Bacillus subtilis
and closely related species, such as Bacillus anthracis, Clostridium perfringens and Listeria monocytogenes, regulation of heat shock response
can be divided into at least 3 classes (Hecker et al., 1996; Schumann,
2003). Class I genes containing only the dnaK and groEL operons are
negatively regulated by HrcA, which recognizes the highly conserved
CIRCE operator sequence (TTAGCACTC-N9-GAGTGCTAA) (Schulz and
Schumann, 1996; Yuan and Wong, 1995; Zuber and Schumann,
1994). Class II genes encode general stress proteins and are under
the control of the stress sigma factor, B. Class III genes encode Clp
ATP-dependent proteases and are repressed in the absence of stress
conditions by CtsR, which recognizes a tandem heptanucleotide

308

W.-C. Hung et al. / Gene 497 (2012) 307313

Table 1
Primers used in this study.
Primer name
Universal amplication
Gor600F
Gor600R
dnaK20F
dnaK710R
LA PCR
C1
C2
LA-Gm-F1
LA-Gm-F2
LA-Gm-R1
LA-Gm-R2
LA-dna-F1
LA-dna-F2
LA-dna-R4
LA-dna-R2
5 Rapid amplication of cDNA ends (5 RACE)
hrcA-GSP-1
Gm ES50R
trxA-GSP
Probe for Northern blot
Gem EL30F
LA-Gm-R1
Gm EL1473-1493F
ORF199-179R
RT-PCR
Gem EL30F
LA-Gm-R1
Gm EL1473-1493 F
ORF199-179R
Probe for Southern blot
Bam-trxA-F
Hin-trxA-R

Sequence (5 to 3)

Gene and nucleotide positions

GGNGAYGGNACNACNACNGCNACNGT
TCNCCRAANCCNGGYGCNTTNACNGC
GGTATWGACTTAGGWACAAC
GCTTTTTCWGCNGCDTCTTT

groEL, 253278
groEL, 842817
dnaK, 1534
dnaK, 715696

GTACATATTGTCGTTAGAACGCGTAATACGACTCA
CGTTAGAACGCGTAATACGACTCACTATAGGGAGA
GTTGAACGTCTTCGTGAAATTAGCGTAAC
AAGTAGGTGCTATTTCTGCTGCGGATGAA
GTCGCTATAGCTTCTTGTTCGACATCATC
GCAGCAGCAACTACTTCTTCTAAAACTGG
CTACACCTTCTGTAGTAGCATTCAAAGG
CGTCAAGCAATCACTAACCCTAATACAG
CGATAATAGCTTGGTCAAAGTCATCCC
GTAGCTAATACTTCGAATACTCCATCTCC

groEL, 377405
groEL, 432460
groEL, 774746
groEL, 723695
dnaK, 104131
dnaK, 163190
dnaK, 622596
dnaK, 572544

CAACGCTACAGTCTTCTTA
CCACTAAGTTGTCGCTTTCTCTACCT
CTAATGTTTCTTTTGGTTGG

hrcA, 699681
groES, 6844
trxA, 283264

CAGAAGATGCTCGCCAAT
GTCGCTATAGCTTCTTGTTCGACATCATC
AGACCCAACGAAAGTAACTCG
CTCCGTATTCTCCAGCTGCTT

groEL, 2340
groEL, 774746
groEL, 14731493
trxA, 199179

CAGAAGATGCTCGCCAAT
GTCGCTATAGCTTCTTGTTCGACATCATC
AGACCCAACGAAAGTAACTCG
CTCCGTATTCTCCAGCTGCTT

groEL 2340
groEL, 774746
groEL, 14731493
trxA, 199179

CGCGGATCCATGAGAGAGATTACA
CCCAAGCTTTTAGATAATAATTG

trxA, 115
trxA, 306292

direct repeat (A/GGTCAAANANA/GGTCAAA) (Kruger and Hecker,

1998; Derre et al., 1999).
The regulatory mechanism of the class I HSP genes, dnaK and
groEL, in some low G + C content Gram-positive bacteria may be different from the mechanism mentioned above. For example, in Staphylococcus aureus and Staphylococcus epidermidis, both the dnaK and
groEL genes are dually regulated by HrcA and CtsR (Chastanet et al.,
2003). In Lactococcus lactis and streptococci, such as Streptococcus
pneumoniae, Streptococcus pyogenes, Streptococcus mutans, and Streptococcus agalactiae, the groEL operon presents both the HrcA and CtsR
target sites, but the dnaK operon displays only the CIRCE operator. In
Oenococcus oeni, no known genes encoding HrcA could be identied
in the whole genome, and CtsR controls both the dnaK and groEL
genes (Grandvalet et al., 2005).
In this study, we sequenced the groE and dnaK loci of G. morbillorum and found an unusual genetic organization. First, we found
both the CIRCE and CtsR binding sites in front of the dnaK operon,
but no CIRCE element in the upstream region of the groE operon,
which might indicate another regulatory model of the class I heat
shock genes. Second, there is a trxA gene downstream of groEL. The
trxA gene encodes thioredoxin, which plays important physiological
roles in bacteria in the protection of cells from oxidative stress and disulde stress (Holmgren, 1985; Zeller and Klug, 2006). We further
analyzed transcription of groEL and trxA in response to heat shock
and oxidative stress to understand the physiological role of the
novel organization as groES-groEL-trxA.
2. Materials and methods
2.1. Bacterial strains and growth conditions
G. morbillorum ATCC 27824, obtained from the American Type Culture Collection (ATCC; Rockville, Md.), was grown in brain heart

infusion broth (BHI) at 37 C. For gene sequence analysis of the groEL

operon in other Gemella species, the bacterial strains consisted of two
reference strains (Gemella haemolysans ATCC 10379 and Gemella sanguinis ATCC 700632) and nine clinical isolates collected in the Bacteriology Laboratory, National Taiwan University Hospital (NTUH), which
is a 2500-bed teaching hospital in northern Taiwan. Identications of
clinical isolates were based on commercial identication systems
(Vitek, API 20 Strep system [bioMerieux Vitek], Phoenix System or
Rapid ID 32 STREP system [bioMerieux Vitek]) and 16S rRNA gene sequencing. For stress response analysis, bacterial cultures grown to midlog phase were challenged with various conditions, including 48 C
heat shock, 1 mM H2O2 or 2 mM diamide for 5, 10, and 15 min.
2.2. Cloning and sequencing of the groEL operon and dnaK operon
Genomic DNA was isolated and puried with a DNA isolation kit
(Puregene, Gentra Systems) according to the manufacturer's instructions. Initially, degenerate PCR primers complementary to highly
conserved regions of groEL and dnaK among the low G + C content
Gram-positive bacteria (Table 1) were designed and used to amplify
partial fragments from G. morbillorum ATCC 27824. Amplication
products of the expected sizes from groEL and dnaK were subsequently sequenced. To obtain the full sequence of the corresponding operon, the partial fragments were used as probes for Southern blot
hybridization to determine the restriction enzyme that was suitable
for further cloning using an LA PCR in vitro cloning kit (Takara
Shuzo Co.). The amplication was performed with a one-cassette
primer (C1 or C2) supplied by the manufacturer and a target genespecic primer (Table 1). Amplication fragments were subsequently
sequenced on an Applied Biosystem model 3100 sequencing system
(Applied Biosystems) using the Taq BigDye-Deoxy Terminator cycle
sequencing kit (Applied Biosystems) according to the manufacturer's
instructions.

W.-C. Hung et al. / Gene 497 (2012) 307313

2.3. RNA extraction

Bacterial cells were suspended in TE buffer (pH 8.0) and disrupted
by lysozyme and lysostaphin. RNA was then extracted by 1 ml TRIzol
reagent (Invitrogen) according to the manufacturer's instructions.
Concentrations of RNA were measured by A260, and RNA integrity
was analyzed by agarose-formaldehyde gel electrophoresis.
2.4. RT-PCR
The extracted RNA was further treated by DNase I (Invitrogen).
The cDNA was then prepared by MMLV reverse transcriptase (Epicentre) using the reverse primer, ORF199-179R (Table 1). PCR was performed using a set of primers, Gm EL1473-1493F and ORF199-179R
(Table 1), to amplify an internal region of groEL-trxA. RNA samples
without RT reactions and chromosomal DNA were used as negative
and positive controls, respectively. PCR products were detected on
ethidium bromide-stained 1.5% agarose gels.
2.5. Northern blot and Southern blot hybridization
For Northern blot hybridization, equal amounts of RNA were separated by 1.0% agarose-formaldehyde gel electrophoresis according to
the protocol described by Ausubel et al. (1987). Separated RNA was
transferred to nylon membranes (Amersham Hybond-N; GE
Healthcare) using standard techniques. The transferred nylon membranes were then UV-cross-linked. A groEL-specic probe and groELtrxA-specic probe were generated by PCR using the sets of primers
as described in Table 1 and simultaneously labeled by incorporation
of digoxigenin-11-dUTP (Roche). For Southern blot hybridization, G.
morbillorum DNA was digested with restriction enzymes and then
separated by agarose gel electrophoresis and transferred to nylon
membranes (Amersham Hybond-N; GE Healthcare) using standard
techniques. A 324-bp digoxigenin-labeled DNA fragment complementary to the trxA gene was used as the probe produced by the
PCR method described above.
After prehybridization, membranes were hybridized with a prepared digoxigenin-labeled probe in 6 SSC (1 SSC is 0.15 M NaCl
plus 0.015 M sodium citrate)0.5% sodium dodecyl sulfate (SDS)
50% formamide at 42 C for 16 h. The detection of hybridization was
performed with an anti-digoxigenin antibody conjugated to alkaline
phosphatase, and CSPD (Roche) was used as a substrate according
to the manufacturer's instructions.
2.6. 5 RACE
The extracted RNA was analyzed with a 5 rapid amplication of
cDNA ends (5 RACE) system kit (Invitrogen) according to the
manufacturer's instructions. In brief, the extracted RNA was annealed
with primers specic to groES, trxA or hrcA (Table 1) and reversetranscribed by SuperScriptTM II reverse transcriptase. The puried
cDNA was TdT-tailed with terminal deoxynucleotidyl transferase.
The tailed cDNA product was amplied by PCR with manufacturersupplied Abridged Anchor Primer (poly (G/I) primer) and the genespecic primer. The resulting PCR products were cloned into a TA
cloning vector, pCR 2.1 (Invitrogen) and subsequently sequenced on
an Applied Biosystem model 3100 sequencing system (Applied
Biosystems) using the Taq BigDye-Deoxy Terminator cycle sequencing
kit (Applied Biosystems), according to the manufacturer's instructions.
2.7. Nucleotide sequence accession numbers
The nucleotide sequences were deposited in the GenBank sequence
database with the following accession numbers: the dnaK operon of G.
morbillorum ATCC 27824 was FJ479608; the groE operon, including the
trxA gene of G. morbillorum ATCC 27824 and other Gemella species and

309

clinical isolates were FJ465092, FJ479605, FJ479606, GQ244302,

HM103916HM103919, HM103922HM103925, as was previously
reported (Hung et al., 2010).
3. Results
3.1. Genetic organization of the G. morbillorum groE locus
Sequence analysis of the G. morbillorum ATCC 27824 groE locus
revealed the organization of groES-groEL-trxA oriented in the same direction (Fig. 1A). The groES gene was 276-nucleotides long and
encoded a polypeptide of 91 amino acids with a predicted molecular
mass of 9.93 kDa. A putative ShineDalgarno sequence was found upstream of the groES start codon preceded by 8 bp. The groEL gene was
1605-nucleotides long, with a putative ribosomal binding site proceeding from the initial codon by 4 bp and separated from groES
gene by an 8-nucleotide spacer. This open reading frame (ORF)
encoded a 534-amino acid polypeptide with a predicted molecular
mass of 57.21 kDa.
The 3-region downstream of groEL contained an ORF that was
306-nucleotides long. This ORF encoded a 101-amino acid protein
with a predicted molecular mass of 11.59 kDa. The protein displayed
69.8, 66.0, and 74.3% of the amino acid similarities with thioredoxin
in S. aureus, Enterococcus faecalis and B. subtilis and contained the conserved -Trp-Cys-Gly-Pro-Cys-motif. The noncoding region between
groEL and trxA was 82 bp in length. In this noncoding region, no signicant stem-loop structure resembling a prokaryotic rhoindependent transcriptional terminator was found, implying that
trxA might have been co-transcribed with groEL. Two possible rhoindependent transcriptional terminators downstream of trxA were
identied.
To determine the transcription initiation site, the 5-terminus of
groES mRNA was mapped by 5 RACE analysis. A transcriptional start
site was identied to be 131 bp upstream of the translation start
codon of groES (Fig. 1A, left panel). The putative 35 box (TTGACT)
and 10 box (TATTAT), separated by 17 nucleotides, were identied
upstream of the transcriptional start site, which is the housekeeping
promoter reported to be in B. subtilis and E. coli (Derre et al., 1999).
In the region surrounding the 35 box, a tandem heptanucleotide direct repeat was found (Fig. 1A, left panel) that was complementary to
the CtsR binding site (A/GGTCAAA-TAA-A/GGTCAAA). No potential
CIRCE element was found at this region. The CIRCE-HrcA regulation
system of the groE operon is widespread among low G + C content
Gram-positive bacteria except O. oeni, which lacks the hrcA gene
through the whole genome (Grandvalet et al., 2005).
In addition, a transcriptional start site upstream of the trxA gene
was determined by 5 RACE analysis, in front of which a housekeeping
promoter was located (Fig. 1A), suggesting that trxA could be transcribed by itself.
3.2. Sequence analysis of the G. morbillorum dnaK locus
Although the CIRCE was absent on the groE in G. morbillorum, our
resolved nucleotide sequence revealed that the dnaK locus was composed of the hrcA-grpE-dnaK-dnaJ (Fig. 1B), which is the most common structure in Gram-positive bacteria with low G + C content.
The 5-end of hrcA mRNA was determined by a 5 RACE experiment.
As shown in Fig. 1B, the transcriptional start site was located at G or
T (in the 51st or 50th nucleotide upstream from the translation
start codon). A putative A-type promoter (TTGACT-N17-TATATT)
was found 6 or 7 bases upstream of the transcriptional start site. Compared with the groEL putative promoter region determined in this
study, it displayed a 2-nucleotide mismatch in the 10 box.
In dnaK locus, two potential CtsR binding sites were found upstream or overlapping with the putative promoter (Fig. 1B). In addition, the CIRCE sequence, a hairpin-like operator of HrcA, was

310

W.-C. Hung et al. / Gene 497 (2012) 307313

Fig. 1. Transcriptional organization of the groEL and dnaK operons in G. morbillorum. (A) A schematic diagram of the groEL operon. The 2778-nt sequence revealed three open reading frames in the order groES-groEL-trxA. Sequences of the groES and trxA upstream regions are shown in the left and right panels. (B) Organization of the G. morbillorum dnaK operon. The sequence revealed open reading frames in the order hrcA-grpE-dnaK-dnaJ. The transcriptional start site determined by 5-RACE is indicated with the vertical arrow. The
putative A-type 35 and 10 boxes are in boldface. The predicted ShineDalgarno sequence (SD) is underlined. Bold arrows underline the predicted CtsR binding site. Dashedline arrows underline the predicted CIRCE.

present downstream of the promoter region. Thus, it is possible that

both HrcA and CtsR may regulate the dnaK operon of G. morbillorum,
which is similar to the dual regulation model in staphylococci
(Chastanet et al., 2003).
3.3. The G. morbillorum chromosome contains only one copy of trxA
Because the copy number of the trxA gene may be more than one
in some organisms (Kreimer et al., 1997), we performed the Southern
blot to determine whether there is another copy other than the one
located downstream of the groE operon in the G. morbillorum genome.
The trxA-specic probe hybridized to a single band of DNA, which was
digested by eight different restriction enzymes (data not shown). In
addition, homology search on recently published shotgun sequences
of G. morbillorum M424 (accession numbers are NZ_ACRX01000001
to NZ_ACRX01000039) also revealed that a single copy of the trxA
gene is present on the G. morbillorum chromosome.
3.4. Similar genetic organization of the groE locus was seen among two
other Gemella species
Due to the organization of groES-groEL-trxA found in G. morbillorum ATCC 27824, we were curious whether other Gemella species
or strains also possessed a similar structure. PCR and sequencing of
the corresponding regions were performed on 11 other strains
(including the clinical isolate of G. morbillorum NTUH_947, G.
haemolysans ATCC 10379; four G. haemolysans-like isolates,
NTUH_1465, NTUH_2196, 4957, and 5572; and G. sanguinis ATCC
700632 and its four clinical isolates) to examine the genetic organization of the groE operon. The sequence analysis revealed no potential

CIRCE operator sequence in the upstream region of the groE operon,

and the presence of the CtsR binding site surrounding the 35 box,
which was the same as G. morbillorum ATCC 27824 (Fig. 2A).
The 11 Gemella strains all displayed the same genetic organization
as groES-groEL-trxA. The lengths of the groES (276 bp) and groEL
(1605 bp) genes were identical among the three Gemella species. In
the resolved trxA partial sequence, the conserved thioredoxin active
site -Trp-Cys-Gly-Pro-Cys- was found in the 27th to 31st amino acid
sequence in all strains, which was the same as in G. morbillorum
ATCC 27824. The sequence of the intergenic noncoding region between groEL and trxA varied with species and was separated by 82,
83, 84, and 79 bp in G. morbillorum, G. haemolysans, G. haemolysanslike isolates and G. sanguinis, respectively. No signicant terminator
is seen in this noncoding region, the same as in G. morbillorum. Instead, the putative housekeeping promoters (35 box and 10
box) and the SD sequence are nearly identical among 12 Gemella
strains with only one nucleotide mismatch (Fig. 2B). This implies
that the novel genetic structure of the groE operon as groES-groELtrxA is much conserved among Gemella species, while the trxA gene
still could transcribed by itself.
3.5. Transcriptional proles under stress
Since the trxA gene is located downstream of groEL and coorganized as an operon, it is possible that the control of trxA expression depends not only on the trxA-self promoter but also on the
CtsR regulation system. Therefore, we examined transcriptional proles under the treatment of heat shock and disulde stress by Northern blot. When using groEL-specic probe, only one transcript was
observed (Fig. 3A, left panel). The length of the RNA transcript

W.-C. Hung et al. / Gene 497 (2012) 307313

311

Fig. 2. Alignment of promoter sequences from 12 strains of Gemella species. (A) The promoter region of groE operon. (B) The partial sequence of the noncoding region between
groEL and trxA. The putative A-type promoter ( 35 and 10 box) is in the square. A bold arrow underlines the putative CtsR binding site. A dash () indicates identical
nucleotides.

correlated well with the predicted size of a groES-groEL-trxA mRNA

(approximately 2.4 kb in length). RT-PCR analysis using primers
that amplied the internal region of groES-groEL and groEL-trxA generated expected molecular sizes (Fig. 3B), further conrming the organization of groES-groEL-trxA. Northern blot hybridization with
trxA-specic probes revealed two bands (Fig. 3A, right panel). The
size of the large RNA transcript was near 2.4 kb of the groES-groELtrxA transcript. The smaller RNA transcript that correlated well with
the size of a single trxA transcript was present in very abundant
amounts even before induction.
The groES-groEL-trxA transcription was induced by both 48 C
thermal upshock and 2 mM diamide (Fig. 3A), but no change while
exposure to 1 or 2 mM H2O2 (data not shown). The small trxA transcript (0.4 kb) was present in very abundant amounts even before
stress. However, the small trxA transcript would not respond to the
stimuli we used, including heat, H2O2 or diamide. It is quite different
from B. subtilis (Nakano et al., 2005) or S. aureus (Uziel et al., 2004), in
which diamide had signicant effect on transcription of trxA gene.
4. Discussion
Heat shock regulons in B. subtilis, E. coli and their related organisms are well studied, but very little was known about heat shock regulons in fastidious bacteria. In this regard, we analyzed GroE and
DnaK chaperones, which are two essential components of heat
shock regulons in bacteria, and found that the genetic structure of
the groE operon in G. morbillorum was distinct from those previously
reported in other bacteria. In the putative promoter region of the groE
operon of G. morbillorum, no putative CIRCE element and only a CtsR
binding site were found (Fig. 1A). This structure was also seen in

other Gemella species and all tested clinical isolates (Fig. 2), suggesting evolutionary or physiological signicance. In most low G + C content Gram-positive bacteria, expression regulation of the groEL
operon is governed by the widespread HrcA-CIRCE system, with the
exception of O. oeni, which lacks the hrcA gene in the whole genome
(Grandvalet et al., 2005). However, analysis of the upstream regulon
of the dnaK operon in G. morbillorum revealed that both the CIRCE element and CtsR binding site were found (Fig. 1B), which is a similar
structure to that of S. aureus (Chastanet et al., 2003). Compared
with the sequence information of known regulatory elements in the
groE and dnaK operons, G. morbillorum shows a novel genetic structure for the regulation of class I HSP genes.
The order of groES-groEL is highly conserved among eubacteria,
and most of the known groEL in other genera were not followed by
other ORFs (Segal and Ron, 1996). However, in Gemella species we
found an unusual genetic organization of groES-groEL-trxA, which
has not been reported before. No signicant transcriptional terminator structures could be identied in the noncoding region (82-bp) between groEL and trxA. Northern blot and the RT-PCR analysis using
primers spanning the intergenic regions between groEL and trxA
both indicated the presence of groES-groEL-trxA transcripts (Fig. 3).
From Southern blot analysis and genome analysis, the results support
that there is only one copy of the trxA gene in the genome of G. morbillorum. The trxA is transcribed alone in E. coli, B. subtilis, S. aureus
and Rhodobacter sphaeroides (Lim et al., 1985; Pasternak et al., 1996;
Scharf et al., 1998; Uziel et al., 2004). It is co-organized with trxB (encodes thioredoxin reductase) as an operon in Clostridium litorale, S.
coelicolor, Mycobacterium leprae and Mycobacterium tuberculosis
(Gal-Mor et al., 1998; Kreimer et al., 1997). Therefore, this is the
rst report that the trxA gene is part of the groE operon and can be

312

W.-C. Hung et al. / Gene 497 (2012) 307313

groEL
0

5 10

trxA
15

5 10

15

2.4 kb
Heat

0.4 kb

23S
16S
0

10

0 10

15

15

2.4 kb

Diamide

0.4 kb

23S
16S

600 bp

600 bp

Fig. 3. Transcriptional analysis of groEL and trxA in G. morbillorum by: (A) Northern blot analysis where cells were grown to log phase without stress or transferred to 48 C, 1 mM
H2O2, and 2 mM diamide for different times as indicated in the gure. (B) RT-PCR analysis where cells were grown to log phase and transferred to 48 C heat-shock for 10 min. After
reverse transcription, products were amplied with primers spanning the intergenic regions between groEL and trxA and separated on 1.5% agarose gel stained with ethidium bromide. Lane 1: RNA sample with RT reaction. Lane 2: No RT control. Lane 3: Genomic DNA sample. Lane M: DNA sizes marker (100-bp ladder, Invitrogen).

transcribed together. The same organization of the groE locus was

also found in two other Gemella species, G. haemolysans and G. sanguinis. Therefore, the organization of groES-groEL-trxA is not restricted to
a particular strain or the species of G. morbillorum but is conserved in
several Gemella species.
A temperature upshift and thiol stress had signicant effect on the
RNA level of the groES-groEL-trxA transcript, whereas no pronounced
difference was seen on the trxA transcript (Fig. 3). In aerobic organisms, several systems regulate the expression of trxA to cope with
the challenge of various stresses. For example, the trxA gene of B. subtilis or S. aureus was not only under the control of the vegetative
sigma factor, A, but was also transcribed by the general stress
sigma factor, B (Scharf et al., 1998; Uziel et al., 2004). A global regulatory protein Spx can activate trxA and trxB by interacting with CTD
of the RNA polymerase in response to thiol stress (Nakano et al., 2002,
2003a, 2003b; Zuber, 2004). In the case of G. morbillorum, since the
trxA transcript would not respond to stresses we tested, the major
contributor of the induction of trxA RNA level was from the groESgroEL-trxA transcript. As a result, the CtsR regulation systems
would play an important role in control of trxA expression.
It is known that CtsR can efciently respond to various stresses,
such as heat chock and thiol-specic oxidative stress (Elsholz et
al., 2010, 2011). In a study of disulde stress in B. subtilis, induction

by diamide showed that transcription of the class III heat shock protein genes (controlled by CtsR) were > 10-fold up-regulated
(Leichert et al., 2003). The class I heat shock protein genes, groES
and groEL, only controlled by HrcA, were slightly induced by b3
fold (Leichert et al., 2003). It implies that CtsR could efciently
respond to both heat chock and thiol stress comparable to HrcA.
Co-localization of trxA and groE in an operon and under the same
control of CtsR may help G. morbillorum to respond more quickly
to thiol stress.
In E. coli, the function of the thioredoxinthioredoxin reductase
system could be replaced by a glutaredoxinglutathione system
(Gallardo-Madueno et al., 1998; Miranda-Vizuete et al., 1994). In
some other bacteria, however, thioredoxin is considered an essential
gene reported at least in B. subtilis (Scharf et al., 1998), Bacteroides
fragilis (Reott et al., 2009) and S. aureus (Uziel et al., 2004). It was
also reported that thioredoxin is essential for R. sphaeroides growth
by aerobic and anaerobic respiration (Pasternak et al., 1997). The
physiological function of thioredoxin is no less important than the
chaperone GroESL, because they can both respond to heat or oxidative stress. In summary, the unique organization of groES-groEL-trxA
in Gemella species is novel. However, since lack of genetic tools in
Gemella species for functional analysis, the regulation of CtsR on the
transcript of groES-groEL-trxA is still hypothetical. Further studies

W.-C. Hung et al. / Gene 497 (2012) 307313

are needed to better understand regulatory mechanisms and their

physiological signicance.
Acknowledgment
We thank Professor Gwo-Chyuan Shaw (National Yang-Ming University, Taiwan) for useful discussion and suggestions. This work was
supported by grant NSC 97-2320-B-002-023-MY3 from the National
Science Council of Taiwan.
References
Ausubel, F.M., et al., 1987. Current Protocols in Molecular Biology, second ed. John
Wiley, New York.
Brouqui, P., Raoult, D., 2001. Endocarditis due to rare and fastidious bacteria. Clin.
Microbiol. Rev. 14, 177207.
Bukau, B., 1993. Regulation of the Escherichia coli heat-shock response. Mol. Microbiol.
17, 671680.
Chastanet, A., Fert, J., Msadek, T., 2003. Comparative genomics reveal novel heat shock
regulatory mechanisms in Staphylococcus aureus and other Gram-positive bacteria.
Mol. Microbiol. 47, 10611073.
Derre, I., Rapoport, G., Msadek, T., 1999. CtsR, a novel regulator of stress and heat shock
response, controls clp and molecular chaperone gene expression in Gram-positive
bacteria. Mol. Microbiol. 31, 117131.
Elsholz, A.K., Michalik, S., Zuhlke, D., Hecker, M., Gerth, U., 2010. CtsR, the Gram-positive
master regulator of protein quality control, feels the heat. EMBO J. 29, 36213629.
Elsholz, A.K., Hempel, K., Pother, D.C., Becher, D., Hecker, M., Gerth, U., 2011. CtsR inactivation
during thiol-specic stress in low GC, Gram+ bacteria. Mol. Microbiol. 79, 772785.
Gallardo-Madueno, R., Leal, J.F., Dorado, G., Holmgren, A., Lopez-Barea, J., Pueyo, C.,
1998. In vivo transcription of nrdAB operon and of grxA and fpg genes is triggered
in Escherichia coli lacking both thioredoxin and glutaredoxin 1 or thioredoxin and
glutathione, respectively. J. Biol. Chem. 273, 1838218388.
Gal-Mor, O., Borovok, I., Av-Gay, Y., Cohen, G., Aharonowitz, Y., 1998. Gene organization
in the trxA/B-oriC region of the Streptomyces coelicolor chromosome and comparison with other eubacteria. Gene 217, 8390.
Grandvalet, C., Coucheney, F., Beltramo, C., Guzzo, J., 2005. CtsR is the master regulator
of stress response gene expression in Oenococcus oeni. J. Bacteriol. 187, 56145623.
Hecker, M., Schumann, W., Volker, U., 1996. Heat-shock and general stress response in
Bacillus subtilis. Mol. Microbiol. 19, 417428.
Holmgren, A., 1985. Thioredoxin. Annu. Rev. Biochem. 54, 237271.
Hung, W.C., et al., 2010. Use of groESL as a target for identication of Abiotrophia, Granulicatella, and Gemella species. J. Clin. Microbiol. 48, 35323538.
Kilpper-Balz, R., Schleifer, K.H., 1988. Transfer of Streptococcus morbillorum to the Genus
Gemella as Gemella morbillorum comb. nov. Int. J. Syst. Bacteriol. 38, 442443.
Kreimer, S., Sohling, B., Andreesen, J.R., 1997. Two closely linked genes encoding thioredoxin and thioredoxin reductase in Clostridium litorale. Arch. Microbiol. 168, 328337.
Kruger, E., Hecker, M., 1998. The rst gene of the Bacillus subtilis clpC operon, ctsR,
encodes a negative regulator of its own operon and other class III heat shock
genes. J. Bacteriol. 180, 66816688.
La Scola, B., Raoult, D., 1998. Molecular identication of Gemella species from three patients with endocarditis. J. Clin. Microbiol. 36, 866871.

313

Leichert, L.I., Scharf, C., Hecker, M., 2003. Global characterization of disulde stress in
Bacillus subtilis. J. Bacteriol. 185, 19671975.
Lim, C.J., Geraghty, D., Fuchs, J.A., 1985. Cloning and nucleotide sequence of the trxA
gene of Escherichia coli K-12. J. Bacteriol. 163, 311316.
Masters, M., Blakely, G., Coulson, A., McLennan, N., Yerko, V., Acord, J., 2009. Protein
folding in Escherichia coli: the chaperonin GroE and its substrates. Res. Microbiol.
160, 267277.
Miranda-Vizuete, A., Martinez-Galisteo, E., Aslund, F., Lopez-Barea, J., Pueyo, C.,
Holmgren, A., 1994. Null thioredoxin and glutaredoxin Escherichia coli K-12 mutants have no enhanced sensitivity to mutagens due to a new GSH-dependent hydrogen donor and high increases in ribonucleotide reductase activity. J. Biol. Chem.
269, 1663116637.
Nakano, M.M., Nakano, S., Zuber, P., 2002. Spx (YjbD), a negative effector of competence in Bacillus subtilis, enhances ClpC-MecA-ComK interaction. Mol. Microbiol.
44, 13411349.
Nakano, S., Kuster-Schock, E., Grossman, A.D., Zuber, P., 2003a. Spx-dependent global
transcriptional control is induced by thiol-specic oxidative stress in Bacillus subtilis. Proc. Natl. Acad. Sci. U. S. A. 100, 1360313608.
Nakano, S., Nakano, M.M., Zhang, Y., Leelakriangsak, M., Zuber, P., 2003b. A regulatory
protein that interferes with activator-stimulated transcription in bacteria. Proc.
Natl. Acad. Sci. U. S. A. 100, 42334238.
Nakano, S., Erwin, K.N., Ralle, M., Zuber, P., 2005. Redox-sensitive transcriptional control by a thiol/disulphide switch in the global regular, Spx. Mol. Microbiol. 55,
498510.
Pasternak, C., Assemat, K., Breton, A.M., Clement-Metral, J.D., Klug, G., 1996. Expression
of the thioredoxin gene (trxA) in Rhodobacter sphaeroides Y is regulated by oxygen.
Mol. Gen. Genet. 250, 189196.
Pasternak, C., Assemat, K., Clement-Metral, J.D., Klug, G., 1997. Thioredoxin is essential
for Rhodobacter sphaeroides growth by aerobic and anaerobic respiration. Microbiology 143 (Pt 1), 8391.
Reott, M.A., Parker, A.C., Rocha, E.R., Smith, C.J., 2009. Thioredoxins in redox maintenance and survival during oxidative stress of Bacteroides fragilis. J. Bacteriol. 191,
33843391.
Scharf, C., Riethdorf, S., Ernst, H., Engelmann, S., Volker, U., Hecker, M., 1998. Thioredoxin is an essential protein induced by multiple stresses in Bacillus subtilis. J. Bacteriol. 180, 18691877.
Schulz, A., Schumann, W., 1996. hrcA, the rst gene of the Bacillus subtilis dnaK operon
encodes a negative regulator of class I heat shock genes. J. Bacteriol. 178,
10881093.
Schumann, W., 2003. The Bacillus subtilis heat shock stimulon. Cell Stress Chaperones 8,
207217.
Segal, R., Ron, E.Z., 1996. Regulation and organization of the groE and dnaK operons in
Eubacteria. FEMS Microbiol. Lett. 138, 110.
Uziel, O., Borovok, I., Schreiber, R., Cohen, G., Aharonowitz, Y., 2004. Transcriptional
regulation of the Staphylococcus aureus thioredoxin and thioredoxin reductase
genes in response to oxygen and disulde stress. J. Bacteriol. 186, 326334.
Yuan, G., Wong, S.L., 1995. Regulation of groE expression in Bacillus subtilis: the involvement of the sigma A-like promoter and the roles of the inverted repeat sequence (CIRCE). J. Bacteriol. 177, 54275433.
Zeller, T., Klug, G., 2006. Thioredoxins in bacteria: functions in oxidative stress response and regulation of thioredoxin genes. Naturwissenschaften 93, 259266.
Zuber, P., 2004. Spx-RNA polymerase interaction and global transcriptional control
during oxidative stress. J. Bacteriol. 186, 19111918.
Zuber, U., Schumann, W., 1994. CIRCE, a novel heat shock element involved in regulation of heat shock operon dnaK of Bacillus subtilis. J. Bacteriol. 176, 13591363.