Variations in Abundance, Genome Size,

Morphology, and Functional Role of

the Virioplankton in Lakes Annecy and
Bourget over a 1-Year Period

Xu Zhong, Angia Siram Pradeep Ram,

Jonathan Colombet & Stphan Jacquet

Microbial Ecology

ISSN 0095-3628
Volume 67
Number 1

Microb Ecol (2014) 67:66-82

DOI 10.1007/s00248-013-0320-2

1 23
Your article is protected by copyright and all
rights are held exclusively by Springer Science
+Business Media New York. This e-offprint is
for personal use only and shall not be self-
archived in electronic repositories. If you wish
to self-archive your article, please use the
accepted manuscript version for posting on
your own website. You may further deposit
the accepted manuscript version in any
repository, provided it is only made publicly
available 12 months after official publication
or later and provided acknowledgement is
given to the original source of publication
and a link is inserted to the published article
on Springer's website. The link must be
accompanied by the following text: "The final
publication is available at link.springer.com.

1 23
 Author's personal copy
Microb Ecol (2014) 67:6682
DOI 10.1007/s00248-013-0320-2
MICROBIOLOGY OF AQUATIC SYSTEMS
Variations in Abundance, Genome Size, Morphology,
and Functional Role of the Virioplankton in Lakes Annecy
and Bourget over a 1-Year Period
Xu Zhong & Angia Siram Pradeep Ram &
Jonathan Colombet & Stphan Jacquet
Received: 26 June 2013 / Accepted: 24 October 2013 / Published online: 20 November 2013
# Springer Science+Business Media New York 2013
Abstract We sampled the surface waters (250 m) of two
deep peri-alpine lakes over a 1-year period in order to examine
(1) the abundance, vertical distribution, genome size, and
morphology structures of the virioplankton; (2) the virus-
mediated bacterial mortality; and (3) the specific genome size
range of double-stranded DNA (dsDNA) phytoplankton vi-
ruses. Virus-like particle (VLP) concentrations varied between
4.16107 (January) and 2.08108 part mL1 (May) in Lake
Bourget and between 2.7107 (June) and 8.39107 part mL1
(November) in Lake Annecy. Our flow cytometry analysis
revealed at least three viral groups (referred to as virus-like
particles 1, 2, and 3) that exhibited distinctive dynamics
suggestive of different host types. Phage-induced bacterial
mortality varied between 6.1 % (June) and 33.2 % (October)
in Lake Bourget and between 7.4 % (June) and 52.6 %
(November) in Lake Annecy, suggesting that viral lysis may
be a key cause of mortality of the bacterioplankton.
Virioplankton genome size ranged from 27 to 486 kb in
Lake Bourget, while it reached 620 kb in Lake Annecy for
which larger genome sizes were recorded. Our analysis of
pulsed field gel electrophoresis bands using different PCR
primers targeting both cyanophages and algal viruses showed
that (1) dsDNA viruses infecting phytoplankton may range
from 65 to 486 kb, and (2) both cyanophage and algal diver-
sity were higher in Lake Annecy. Lakes Annecy and
Electronic supplementary material The online version of this article
(doi:10.1007/s00248-013-0320-2) contains supplementary material,
which is available to authorized users.
X. Zhong : S. Jacquet (*)
INRA, UMR 042 CARRTEL, 75 Avenue de Corzent,
74203 Thonon-les-Bains cx, France
e-mail: sjacquet@thonon.inra.fr
A. S. Pradeep Ram : J. Colombet
CNRS, UMR 6023, Lab. Microorganismes, Universit Blaise Pascal,
24 Avenue des Landais, 63171 Aubire cx, France
Bourget also differed regarding the proportions of both viral
families (with the dominance of myoviruses vs. podoviruses)
and infected bacterial morphotypes (short rods vs. elongated
rods), in each of these lakes, respectively. Overall, our results
reveal that (1) viruses displayed distinct temporal and vertical
distribution, dynamics, community structure in terms of ge-
nome size and morphology, and viral activity in the two lakes;
(2) the Myoviridae seemed to be the main cause of bacterial
mortality in both lakes and this group seemed to be related to
VLP2; and (3) phytoplankton viruses may have a broader
range of genome size than previously thought. This study
adds to growing evidence that viruses are diverse and play a
significant role in freshwater microbial dynamics and more
globally lake functioning. It highlights the importance of
further considering this biological compartment for a better
understanding of plankton ecology in peri-alpine lakes.
Introduction
Viruses (DNA or RNA, double- or single-stranded) are the
most abundant biological entities in aquatic environments, with
approximately 41030 viruses in the ocean which is 15 times
more than any cellular form [1]. Viruses have been found
everywhere where the life can extend (lakes, rivers, ocean, deep
sea, sediments, etc.), and they infect nearly all types of living
forms (bacteria, archaea, algae, zooplankton, etc.) [26].
Viruses are also very diverse both genetically and morpholog-
ically, and most of them are still unexplored [6, 7]. The genome
size of dsDNA viruses ranges from 10 to 670 kb [6, 8, 9] and
can even be greater than 1,000 kb in the case of giant viruses
like Mimi-, Mama-, Mega-, and Pandoraviruses [1013]. By
contrast, genome size ranges from 1 to 12 kb for ssDNA viruses
[14] and from 1 to 27 kb for RNA viruses [15]. There is
mounting evidence from metagenomic studies [1622] that
virioplankton (from either marine or freshwater environment)
 Author's personal copy
Diversity and Role of the Virioplankton in Peri-alpine Lakes
are dominated by those corresponding to viruses that infect
heterotrophic bacteria and phytoplankton (cyanobacteria and
eukaryotic microalgae) and are mainly DNA viruses (dsDNA
and/or ssDNA). However, RNA viruses (mainly infectious to
protists) have largely been neglected even though recent studies
have reported their quantitative importance [15, 23, 24].
A key issue when studying virioplankton remains to provide
accurate abundances for these particles. Free viruses have been
observed and counted using at least three techniques [6, 25, 26]:
transmission electron microscopy (TEM), epifluorescence mi-
croscopy (EFM), and flow cytometry (FCM). FCM and EFM,
both of which are based on nucleic acid-specific fluorescence
labeling, offer good detection sensitivity and accurate quantifi-
cation of viruses. FCM has shown to be more effective than
EFM for high-throughput analysis because it is rapid and
repetitive and can discriminate two to five viral groups [25,
2730]. On the other hand, TEM has the advantage of provid-
ing specific information about the morphology and size of virus
particles, but it is limited by the low throughput, precision, and
detection limit, and it is time consuming and costly [6, 25]. To
date, FCM and EFM have not provided a lot of data about RNA
and ssDNA viruses due to lack of sensitivity on these labeled
small genomes [14, 15, 25, 31, 32]. Typically, these studies
revealed that only the largest ssDNA or RNA viruses can be
detected, and that in most cases, the calculated abundances of
these viruses are underestimated. Whatever the technique used,
it is now commonly accepted that there are 104 to 109 virus-like
particles (mainly phages) per milliliter, with abundances vary-
ing between ecosystems and within the same ecosystem as a
function of depth and season [33, 34].
As efficient agents of cell mortality, viruses play an impor-
tant role in population succession and community structuring.
They contribute significantly to nutrient and energy fluxes,
typically through the viral shunt which diverts the organic
matter into the dissolved pool [30, 35]. TEM has been widely
used to estimate virus-induced bacterial mortality (VIBM)
through measuring the frequency of visibly infected bacterial
cells (FVIC) [6, 26, 36, 37]. Typically, viral lysis can account
for approximately 2040 % of daily loss of bacterial biomass
(heterotrophic bacteria and cyanobacteria) in surface waters of
the ocean [38, 39]. However, estimates range from 0 to 100 %,
especially for fresh waters (e.g., [34, 40]).
Because there is no universal marker gene for viruses,
assessing the occurrence and diversity of viruses requires the
use of a number of different molecular approaches (e.g.,
metagenomic, pulsed field gel electrophoresis (PFGE), PCR-
associated approach). PFGE allows for the fingerprinting of
virioplankton based on size fractionation of intact genomic
DNA, but it has limitation at recovering RNA and ssDNA
viruses [41]. This approach has been used to investigate the
genetic structure of dsDNA viruses living in the water column of
many lakes [4244], rivers [45], estuaries [43, 4547], seawaters
[27, 43, 45, 4853], and sediments [43, 54]. The results of these
67
studies can be summarized as follows: (1) virioplankton exhibits
a variety of genome size, ranging from 10 to 661 kb [8, 41]; (2)
most viruses have a genome size of 2080 kb [41]; and (3) the
composition of an ecosystem in terms of genome size varies
with depth and over time (even at the time scale of a day).
Phytoplankton populations (e.g., eukaryotic microalgae
and cyanobacteria) are crucial in aquatic ecosystems because
they are the primary producer and principle prey for higher
trophic levels. dsDNA viruses infecting eukaryotic algae (e.g.,
phycodnaviruses) and cyanobacteria (e.g., cyanophages be-
longing to Myoviridae, Podoviridae, and Siphoviridae tailed
phages) are now recognized as widespread and ubiquitous in
aquatic environments. Recently, PCR-based diversity studies
[42, 5557] have shown that they are prevalent in peri-alpine
lakes. Indeed, we could use selected primers that amplify the
g20 gene from cyanomyoviruses, g23 from T4-like
myoviruses (including cyanomyoviruses), psbA from psbA-
containing cyanophages (including cyanomyoviruses and -
podoviruses), and mcp and polB from phycodnaviruses. For
phytoplankton viruses, PCR-amplified signature genes from
excised PFGE bands can be used to determine the genome
size range. Three studies have used this method; they showed
that cyanophages vary between 31 and 380 kb in Norwegian
costal seawater [52, 58], and T4-like bacteriophages vary
between 23 and 242 kb in two North American estuaries
[46]. These genome size ranges are much greater than previ-
ously thought. As the virioplankton of peri-alpine lakes is still
poorly known, we conducted a year-long study in 2011 in the
upper lit layers of two peri-alpine lakes characterized by
different trophic states, Lakes Annecy (oligogrophic) and
Bourget (oligo-mesotrophic). This study constitutes the first
detailed descriptive and functional investigation of
virioplankton in these lakes. We examined (1) the abundance,
genome size, morphological composition, and functional role
of the virioplankton using a combination of different tech-
niques (FCM, PFGE, TEM); and (2) the occurrence of
dsDNA algal viruses (and cyanophages) and variation in
genome size range using PCR and a variety of specific primers
to examine the presence/absence of typical signature genes.
Methods
Sample Collection and Processing
Water samples were collected once or twice each month
between January and November 2011 at reference stations
of Lakes Annecy (lat N 45.8727, long E 6.1645333) and
Bourget (lat N 45.7469, long E 5.86015), situated at the
deepest part of each lake. We obtained 14 samples for Lake
Annecy and 18 for Lake Bourget. We collected a minimum of
21 L, integrating the water column from the surface to a depth
of 20 m using an electric pump and tubing, and samples were
 Author's personal copy
68
stored in a polycarbonate flask placed in the dark at 4 C until
filtration. A few hours following sampling, the 20-L samples
were first filtered through a 60-m mesh and then through
1 m pore-size filters (Millipore, Bedford, MA). The filtrate
(i.e., <1 m fraction) was concentrated to a volume of 200
250 mL using a spiral wound ultrafiltration cartridge with a
molecular weight cutoff of 30,000 Da (regenerated cellulose,
PLTK Prep/scale TFF, 1 ft2; Millipore). To ensure that all
remaining small free-living bacteria were removed, we filtered
the <1-m concentrated fraction through 0.45 m pore-size
filters twice (Millipore). The absence of cellular contamina-
tion was verified using flow cytometry (FCM not shown). To
obtain enough viral particles for PFGE, the <0.45-m viral
fractions were further concentrated using polyethylene glycol
(PEG) precipitation [59]. Briefly, 50 mL of <0.45 m viral
fraction with polyethylene glycol 8000 (10 %w/v final con-
centration) and NaCl (0.6 %w /v final concentration) were
incubated at 4 C for 24 h. Then, viral particles were precip-
itated and concentrated through centrifugation for 1 h at 14,
600g in a Beckman JA-30.50 rotor. The viral pellets were
suspended in 100150 L of sterile distilled water.
To better appreciate the vertical distribution of the different
viral groups, we also collected 50 mL water samples for FCM
analysis from the following depths in each lake: 2 or 3, 10, 15,
20, 30, 45, and 50 m.
Virus Enumeration Using Flow Cytometry
Virus-like particles (represented by at least three groups re-
ferred to as VLP1, VLP2, and VLP3; Fig. S1) were quantified
using a FACSCalibur flow cytometer (Becton Dickinson)
equipped with an air-cooled laser providing 15 mW at
488 nm. Viruses in the raw-water sample (untreated) were
fixed with glutaraldehyde (0.5 % final concentration, grade I,
Merck) for 30 min in the dark, then diluted in 0.02 m filtered
TE buffer (0.1 mM TrisHCl and 1 mM EDTA, pH 8), and
incubated with SYBR Green I (at a final 5105 dilution of
the commercial stock solution; Molecular Probes), for 5 min at
ambient temperature, followed by 10 min at 75 C, and then
another 5 min at room temperature, prior to FCM analysis [29,
60]. Each sample was analyzed only once (no duplicates are
provided) since a single analysis has been previously shown to
be sufficient [29]. The Listmode files obtained were then
transferred and analyzed on a PC using the custom-designed
freeware CYTOWIN [61]. More details about the FCM anal-
ysis and data treatment can be obtained elsewhere [62, 63].
Transmission Electron Microscopy Analysis
TEM was employed to observe and count the different
morphotypes of both viruses (Myoviridae , Siphoviridae ,
Podoviridae, and untailed viruses) and infected prokaryotes
(short rods, elongated rods, fat rods, cocci, and filamentous).
X. Zhong et al.
We also estimated burst size, percentage of infected bacterial
cells, and virus-inducted bacterial mortality as in previous studies
[64]. Briefly, 8 mL formalin-fixed samples kept at 4 C were
harvested by ultracentrifugation onto 400 mesh NI electron
microscope grids with carbon-coated Formvar film, using a
Centrikon TST 41.14 Swing-Out-Rotor run at 70,000g for
20 min at 4 C [65, 66]. Each grid was then stained for 30 s with
uranyl acetate (2 % w/w) and examined using a JEOL 1200EX
TEM operated at 80 kV and 40,000 magnification. The photo-
graphic negatives were scanned with Adobe Photoshop and
phage dimensions were determined using IMAGEJ software. A
bacterium was considered infected when at least five viruses,
identified by shape and size, were clearly visible inside the host
cell. At least 600800 bacterial cells were inspected per grid to
determine the frequency of visibly infected bacterial cells (FVIC)
and a minimum of 7080 different phages for each sample was
inspected to determine the different viral morphotypes. The mean
viral burst size (BS, viruses per bacterium) was estimated for
every sample by taking the mean number of viral particles per
infected cell (at least 15 infected cells were examined per sam-
ple). Because mature phages are visible only late in the infection
cycle, the estimated FVIC represents only for a small portion of
virus-infected bacteria. Therefore, in order to estimate virus-
mediated lysis for the whole bacterial community, the FVIC
counts were converted to the frequency of infected cells (FIC)
using the equation FIC=9.524FVIC 3.256 [67]. Assuming a
steady state of infected and uninfected bacteria and a latent
period that equals the bacterial generation time, we estimated
VIBM (as a percentage per generation) using the following
equation: VIBMk=(FIC+0.6FIC2) / (11.2FIC) [68].
Pulsed Field Gel Electrophoresis Analysis
The plug preparation was adapted from Wommack et al. [47].
Briefly, equal volumes of viral concentrate and molten (45 C) 1 %
low melting point (LMP, Eurobio) agarose (10 mM TrisHCl,
125 mM EDTA, 1 % LMP, pH 8.0) were homogenously mixed
and dispensed into plug molds (BioRad). The solidified plugs were
digested for 24 h at 37 C in a lysis buffer (10 mM TrisHCl,
500 mM EDTA, 1 % SDS v/v, 1 mg mL1 proteinase K (Eurobio),
pH 8.0) and then washed three times for 2 h at 37 C with wash
buffer (500 mM EDTA, pH 8.0). Finally, plugs containing approx-
imately 41010 viral particles were loaded into wells of the 1 %
agarose gel (Invitrogen) for the PFGE. The molecular weight
markers, a lambda ladder and/or a Mid-Range ladder (New
England BioLabs), were placed in the middle and on each side
of the gels. The electrophoresis was conducted using a CHEF-DR
II system (BioRad, Germany) under the following conditions:
14 C, 200 V, and 0.5 TBE buffer (90 mM Tris-borate and
1 mM EDTA, pH 8.0). For each sample, two runs of PFGE were
conducted with two different sets of pulse ramp conditions in
order to separate both large and small viral genomes: (1) 40
60 s switch time for 10 h following 1040 s switch time for 18 h
 Author's personal copy
Diversity and Role of the Virioplankton in Peri-alpine Lakes 69

(to separate genome size from 100 to 700 kb) and (2) 15 s
switch time for 24 h (to separate genome size of 0 to 100 kb).
Note that these conditions were optimized after various tests for
the switching time and many gels were therefore run before
finding the optimal conditions (i.e., a maximum number of
bands with sufficient intensity). The gels were stained with
ethidium bromide for 45 min and washed with distilled water.
The DNA bands were visualized using Geldoc (BioRad).
Genome Size Range of Phytoplankton Viruses Assessed
Using PCR
PCR was used to verify the presence or absence of phytoplankton
viruses for each PFGE band representative. The DNA obtained
from the PFGE bands used as templates was amplified using
different primer sets that target signature genes of phytoplankton
viruses (Table 1). The validity of these primer sets has been
examined elsewhere [55, 56]. To obtain DNA from the PFGE
bands, additional sample runs were carried out in 1 % LMP
(Eurobio) agarose gel under the same conditions as described
above. Gel slices of each visible PFGE band representative were
then excised, and the DNA recovered via the digestion of each
LMP gel slice using GELase (Epicentre, USA). As the DNA
concentration of the gel-digested solution was always <1 ng/L,
1 L of the gel-digested solution was further treated with the
GenomiPhi V2 Amplification Kit (GE Healthcare, UK) as per the
manufacturer's instruction, yielding 0.2 to 2 g of DNA.
PCRs were performed using the DNA Thermal Cycler T-
Professional (Biometra). For each primer set, 25 L of the
reaction mix contained 1 PCR buffer, 4 mM MgCl2, 200 M
of each dNTP, 0.4 M of each primer, 0.5 U of Platinium Taq
DNA polymerase (Invitrogen), and approximately 15 ng of
genomic DNA as templates. The typical program was a 5-min
enzyme activation at 95 C, followed by 34 cycles of denatur-
ation at 95 C for 30 s, annealing for 30 s, extension at 72 C for
45 s, and a final extension at 72 C for 5 min. The annealing
temperature for each primer set was optimized (Table S1).
Finally, 10 L of PCR products mixed with 3 L of 5 loading
buffer (12.5 % Ficoll, 25 mM tris, 5 mM EDTA [pH 8.0], 0.5 %
SDS, 0.1 % [w/v] xylene cyanol, and 0.1 % [w/v] bromophenol
blue) were loaded into wells with 1.5 % agarose gel containing
ethidium bromide. The electrophoresis was conducted for
40 min under 100 V and DNA bands were visualized using
Geldoc (BioRad). The presence of phytoplankton viruses was
determined through the detection of the correct amplicon size
related to the viral group-specific signature gene (Table 1).
PFGE Banding Pattern Analysis and Statistical Analysis
PFGE banding patterns were analyzed using GelCompare II
(Applied Maths, Kortrijk, Belgium) after digitalization of the
PFGE gels. Briefly, fingerprinting patterns were first standardized
with a reference pattern (the molecular weight markers) positioned
to the left and right sides and in the middle of the gel. The
dendrogram was constructed from a binary matrix of similarity
values. We used the Jaccard similarity index based on the absence/
presence of bands, which then was clustered by the unweighted
pair group method with arithmetic averages (UPGMA).
To compare the community composition dynamics of
virioplankton in Lakes Annecy Bourget, we ran a Mantel test using
the software package XLSTAT-ADA. We tested the null hypoth-
esis of no relationship between the matrices for the two lakes,
using Spearman's rank correlation coefficient as the test statistic and
999 permutations. To identify relationships between VIBM/FIC
and viral abundance (VLP1, VLP2, VLP3, Myovirus, Podovirus,
or Siphovirus), we also used Pearson's correlation coefficients.

Table 1 List of primers and optimized PCR conditions used in this study

Gene Tageted viruses Encoded proteins Primers (53) Annealing Reference

markers temperature
(C)

g20 Cyanomyovirus T4-like portal protein CPS 1.1: GTAGWATWTTYTAYATTGAYGTWGG 46 [69]

CPS 8.1: ARTAYTTDCCDAYRWAWGGWTC [56]

g23 T4-like myovirus Major capsid protein MZIA1bis: GATATTTGIGGIGTTCAGCCIATGA 50 [70]

MZIA6: CGCGGTTGATTTCCAGCATGATTTC

psbA Cyanophage Photosystem II protein D1 Pro-psbA-1F: AACATCATYTCWGGTGCWGT 50 [71]

Pro-psbA-1R: TCGTGCATTACTTCCATACC [56]

polB Phycodnavirus Family B DNA polymerase AVS 1: GARGGIGCIACIGTIYTIGAYGC 51 [72]

AVS 2: GCIGCRTAICKYTTYTTISWRTA [55]

mcp Phycodnavirus Major capsid protein mcp Fwd: GGYGGYCARCGYATT 45 [73]

mcp Rev: TGIARYTGYTCRAYIAGGTA [55]
 Author's personal copy
70 X. Zhong et al.

Results
Abundance and Vertical Distribution of the Virioplankton
VLP1 showed no marked temporal and vertical fluctuations in
abundance in Lake Annecy, while in Lake Bourget, VLP1
concentration increased 3- to 7-fold in the upper lit surface
water (020 m) in early summer and late autumn, and the
increase could extend down to a depth of 50 m (Fig. 1). VLP2
and VLP3 displayed more striking temporal and vertical var-
iations in each lake, particularly VLP2. In Lake Annecy,
VLP2 varied throughout the year with the highest concentra-
tions most often recorded at intermediate depths (between 15
and 35 m), from spring to autumn. By contrast, VLP2 were
more concentrated in the 020-m layer and large variations
extended to 30 m deep in Lake Bourget. VLP3 displayed
vertical distribution patterns relatively similar to that of
VLP2, except that VLP3 showed no clear heterogeneous

Fig. 1 Abundances and Annecy Bourget

0 0
distribution of virus-like particles
(part per milliliter), VLP 1 (upper
panels), VLP2 (middle panels),
and VLP3 (bottom panels) in 10 10
surface waters (050 m) of Lakes
Annecy (left) and Bourget (right)
Depth (m)

in 2011. Note that for the VLP1, 20 20

the scale was different between
Lakes Annecy and Bourget
30 4.0e+7 30
8.0e+7
1.2e+8
1.6e+8 5.0e+7
40 2.0e+8 40 1.5e+8
2.5e+8
3.5e+8
VLP1
50 50
0 0

10 10
Depth (m)

20 20

30 30

1e+6
40 40 3e+6
5e+6
7e+6
VLP2
50 50
0 0

10 10
Depth (m)

20 20

30 30
2.0e+5
6.0e+5
40 40 1.0e+6
1.4e+6
1.8e+6
VLP3
50 50
J F M A M J J A S O N D J F M A M J J A S O N D
2011 2011
 Author's personal copy
Diversity and Role of the Virioplankton in Peri-alpine Lakes 71

vertical variation in Lake Annecy in the winter, and concen-
trations of VLP3 greatly increased in the 010-m layer in Lake
Bourget in April.
As the PFGE and TEM were run on integrated 020 m
water samples, we also analyzed with FCM the abundance of
VLPs in this sample at each date for both lakes (Fig. 2). Total
abundance in Lake Bourget varied between 4.16107 part
mL1 (January) and 2.08108 part mL1 (May), which was
on average 1.6-fold higher than in Lake Annecy where con-
centrations varied between 2.7107 part mL1 (June) and
8.39107 part mL1 (November). VLP1 dominated the viral
community in both lakes, accounting, on average, for 94 % of
viral abundance. By contrast, VLP2 accounted for only 5 %,
and VLP3 for less than 1 %. VLP1, VLP2, and VLP3
displayed dynamic patterns in both lakes and they were dif-
ferent between the lakes. However, it should be noted that in
Lake Bourget, there was a significant and positive correlation
between the patterns of VLP1 and VLP2 (r =0.42, n =16,
p <0.01), VLP1 and VLP3 (r =0.32, n =16, p <0.05), and
VLP2 and VLP3 (r =0.39, n =16, p <0.01), while in Lake
Annecy we found only a strong relationship between
VLP2 and VLP3 (r =0.71, n =14, p <0.01).
Community Structure of the Virioplankton
Forty-seven and 50 different viral populations (PFGE bands)
were detected in Lake Bourget and Annecy, respectively, with
genome size varying between 27 and 486 kb for the former

Fig. 2 Dynamics of virus-like- a

particle groups (VLP1, VLP2, 1e+9
and VLP3) in Lake Bourget (a)
VLP1 Bourget
and Lake Annecy (b) from VLP2
integrated abundances (020 m) VLP3
VLP concentrations (part.mL )
-1

along 2011
1e+8

1e+7

1e+6

1e+5
Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec

b
1e+9
Annecy
VLP concentrations (part mL )
-1

1e+8

1e+7

1e+6

1e+5
Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec

2011
 Author's personal copy
72 X. Zhong et al.

and between 27 and 620 kb for the latter (Fig. 3, Table 2). In
Lake Annecy, the number of PFGE bands varied between 6
(June) and 20 (April), and no band persisted in all the samples
taken in 2011 (Fig. S2). In Lake Bourget, the number of bands
varied between 7 (August) and 25 (May), and again, no band
persisted in all the samples taken in 2011. We obtained a total
of 58 PFGE bands for the two lakes, of which 39 were
common to both lakes, and the number of bands varied over
time between lakes. Fifteen bands had a genome size of 27 to
100 kb, and 43 a genome size of 100 to 620 kb. The PFGE
banding pattern analysis with 44 % dissimilarity (Fig. 4)
revealed four different clusters for each lake, but no clear
seasonality could be detected and the abundance patterns for
the two lakes were not correlated between the two lakes
(Mantel test, r =0.008, p =0.822, =0.05). No correlation
was found between the number of PFGE bands (considered
as a whole or discriminated between small [15100 kb] and
large [>100 kb] size) and viral abundance (whatever the
group) in Lake Annecy. In Lake Bourget, however, a positive
relationship was found between VLP1 and the total number of
PFGE bands (n =13, r =0.81, p <0.01), the correlation being
due to the small genome size fraction. VLP3 abundance was
also found to correlate positively with the number of large size
PFGE bands (n =13, r =0.71, p <0.01).

Fig. 3 Schematic representations

of the genomic size distributions
of viral populations determined
by PFGE in Lakes Annecy (a)
and Bourget (b) along 2011 from
integrated samples (020 m).
Numbers indicate the bands that
have been sliced out and tested for
the presence of mcp, polB, g20,
psbA, and g23 genes
 Author's personal copy
Diversity and Role of the Virioplankton in Peri-alpine Lakes 73

Table 2 Size and gene-related

association for each PFGE band PFGE Date of sampling Lakes Genome mcp polB g20 g23 psbA
bands size (kb)

b24 24 May 2011 Lake Annecy 596

b23 14 November 2011 Lake Annecy 565
b22 28 April 2011 Lake Bourget 486 +
b21 27 June 2011 Lake Bourget 441
b19 14 November 2011 Lake Annecy 426 +
b20 27 June 2011 Lake Bourget 391 +
b18a 7 September 2011 Lake Bourget 374 +
b18b 7 September 2011 Lake Bourget 357 +
b17a 14 November 2011 Lake Annecy 341 +
b17b 14 November 2011 Lake Annecy 328 +
b16 17 August 2011 Lake Bourget 317 + + + +
b11 27 June 2011 Lake Bourget 263 + + + +
b7 28 June 2011 Lake Annecy 260
b15 10 May 2011 Lake Annecy 255 + + + + +
b14 14 November 2011 Lake Annecy 248 + + + +
b12 14 November 2011 Lake Annecy 232 + + + +
b13 10 May 2011 Lake Annecy 223 + + +
b35 28 April 2011 Lake Bourget 210
b9 10 May 2011 Lake Annecy 190 + + + +
b8 16 February 2011 Lake Annecy 173 + + +
b36 28 April 2011 Lake Bourget 169
b38 28 April 2011 Lake Bourget 142 +
b37 17 May 2011 Lake Bourget 122
b4 7 September 2011 Lake Bourget 89
b27 6 September 2011 Lake Annecy 81 + +
b3 14 November 2011 Lake Annecy 79 + +
b5 14 February 2011 Lake Bourget 77
b2 27 June 2011 Lake Bourget 75
b26 6 September 2011 Lake Annecy 74 + + +
b31 28 June 2011 Lake Annecy 67
b25 6 September 2011 Lake Annecy 65 + + +
b1 14 February 2011 Lake Bourget 61
b34 16 February 2011 Lake Annecy 52
b28 26 July 2011 Lake Annecy 48
b30 10 May 2011 Lake Annecy 46
b29 10 May 2011 Lake Annecy 44
b33 11 April 2011 Lake Annecy 41 +
b32 28 June 2011 Lake Annecy 27

The TEM revealed four main viral morphotypes: the tailed
myo-, podo-, and siphoviruses (likely to infect bacteria,
cyanobacteria, and archaea) and the untailed (likely to regroup
phycodna- and adenovirus, but also ssDNA and/or RNA
viruses that may infect eukaryotes and/or prokaryotes). The
observed proportion of these different morphotypes varied
over time and between lakes (Fig. 5). In Lake Annecy,
podoviruses accounted for 10 % (November) to 46 %
(April) of all viruses, while in Lake Bourget they made up
only 9 % (June and August) to 18 % (April). In Lake Annecy,
the proportion of myoviruses varied between 13 % (February)
and 54 % (November), the proportion of siphoviruses between
16 % (November) and 49 % (July), and the proportion of
untailed viruses between 5 % (May) and 20 % (November). In
Lake Bourget, the corresponding ranges were 22 % (June) to
50 % (July, October, and November), 20 % (October) to 55 %
(June), and 6 % (June) to 27 % (November). On average for
the year 2011, untailed and tailed viruses accounted for 13 and
 Author's personal copy
74 X. Zhong et al.

Fig. 4 Cluster analysis of PFGE

fingerprinting patterns of
virioplankton from Lake Annecy
and Bourget in 2011

87 % of total virus observations in both lakes. In Lake
Bourget, both myo- and siphoviruses dominated to an equal
extent (38 and 37 %), while in Lake Annecy it was podo- and
siphoviruses (32 and 31 %). In Lake Annecy, a positive
correlation was found between the proportion of the
myophages and the VLP2 (r =0.61, n =13, p <0.05). In Lake
Bourget, we found positive correlations between the
proportion of the podophages and the VLP1 (r =0.53, n =19,
p <0.05) and between the proportion of the myophages and
the VLP2 (r =0.68, n =19, p <0.01).
Variation in the Genome Size Range of Phytoplankton Viruses
Our examination of the 38 more visibly abundant PFGE band
types based on PCR and the five primer sets at our disposal
allowed us to propose a genome size range for several phyto-
plankton viral groups (Table 2). With mcp , the genome size of
phycodnavirus varied between 79 and 486 kb (17 bands),
whereas the range based on polB was much narrower: be-
tween 223 and 263 kb (five bands). The genome size range for
both cyanomyoviruses and psbA -containing cyanophages

Fig. 5 Proportion of the different

virus morphotypes (untailed
virus, myovirus, podovirus, and
siphovirus) observed for each
lake using TEM from integrated
samples along 2011
 Author's personal copy
Diversity and Role of the Virioplankton in Peri-alpine Lakes
was 65 to 317 kb, corresponding to 10 (for g20 ) and 5
(for psbA ) bands, respectively. With g23 , the genome
size varied between 41 and 317 kb (13 bands). It is
worthy to note here that both picocyanobacterial and
phytoplankton abundances were obtained in a parallel
study (e.g., [74]) so that we could compare these abun-
dances to the number of PFGE bands discriminated
based on the size range defined above. However, no
clear relationship could be found between the number
of bands and potential hosts.
Infected Cell Morphotypes and Estimated Virus-Induced
Mortality Rates
Five main cell morphotypes (short rods, elongated rods, fat
rods, cocci, and filament) were found to be infected by virus-
es. Most of the virus-infected bacteria were rod forms: short
rod bacteria (37 %) for Lake Annecy and elongated rod
bacteria (43 %) for Lake Bourget (Fig. S3). In total, less than
20 % of infected bacterial were cocci, with the proportion
being higher in Lake Annecy than in Lake Bourget. The
filamentous morphotypes accounted for only 8 and 3 % of
virus-infected bacteria in Lake Annecy and Bourget,
respectively.
The mean number of intracellular viruses observed in each
infected cell (mean burst size) was 42, ranging from 27
Fig. 6 Percentages of virus-
induced bacterial mortality
estimated from TEM data for
integrated samples along 2011 in
Lakes Annecy and Bourget
75
(January) to 52 (October) in Lake Annecy, and from 19
(June) to 102 (November) in Lake Bourget (Fig. S4). The
burst size also differed between cell morphotypes
(Fig. 3): 453 for short rods, 374 for elongated rods,
9322 for fat rods, 263 for cocci, and 1056 for filaments.
The frequency of infected cells (FIC) varied between 6.6 %
(June) and 29.1 % (November) in Lake Annecy (mean=
15.5 %) and between 5.5 % (June) and 21.7 % (October) in
Lake Bourget (mean=13.3 %) (Fig. S5). On average, viral
lysis was responsible for 22.7 and 17.9 % of bacterial mortal-
ity in Lake Annecy and Bourget, respectively. The estimated
proportion of virus-induced bacterial mortality (VIBM) showed
considerable temporal variation: 7.4 % (June) to 52.6 %
(November) in Lake Annecy and 6.1 % (June) to 33.2 %
(October) in Lake Bourget (Fig. 6). Theoretically, between
1.7105 and 1.1106 bacterial mL1 day1 would have to be
lysed in order to maintain the observed viral production in Lake
Bourget (mean=4.7105 cells mL1 day1) and between 9
104 and 1.6 106 cells mL1 day1 in Lake Annecy
(mean = 4.5 10 5 cells mL 1 day 1 ). Only for Lake
Annecy, a weak relationship was found between FIC and
bacterial cell abundance (r =0.61, n =13, p <0.05). Also, we
found a weak and strong positive correlation between the
proportion of infected cells and the VLP2 in Lake Annecy
(r =0.60, n =13, p <0.05) and in Lake Bourget (r =0.74,
n =19, p <0.01), respectively.
 Author's personal copy
76
Discussion
This study proposes, for the first time, a complete and com-
parative virioplankton analysis (including viral abundances,
distributions, morphology, genomic size, infected cells, and
induced bacterial mortality) for the two largest natural lakes in
France over a full 1-year period. Moreover, an effort was
made to assign genome size obtained from PFGE analysis to
either algal virus or cyanophage. Overall, our study shows the
quantitative importance of viruses in two neighboring lakes,
as well as the significant differences in virus diversity that
exist between these lakes. It also shows the potential role of
phages as agents of bacterial mortality.
Methodological Considerations
Virioplankton dynamics, structure (both in terms of morphol-
ogy and genomic size), and mortality rates were based on
water-integrated (020 m) samples. Due to the observed ver-
tical variability in viral abundance throughout the year, it is
possible that this sampling strategy could (1) only unveil
global patterns and obscure specific dynamics likely to occur
at each depth and (2) miss important hostvirus relationships
that occur below 20 m, where VLP2 and VLP3 could be in
fact more active. Moreover, with samples obtained only each
3 to 4 weeks, we are aware that we probably missed a large
part of the relationships between microbes and associated
viruses. It is well known indeed that virushost interactions
may occur at short time scales, i.e., within a few hours [75] as
well as at microscales [76]. Differently said, sampling at a
higher frequency would, of course, be better. However, we
wanted to use the data on biological variables (i.e., the phyto-
plankton) collected by the traditional lake survey carried out
on French peri-alpine lakes [77], so we decided to sample the
viruses using the same regime.
In our study, TFF ultrafiltration and PEG precipitation
could generate >65 % loss of viral particles. Such a significant
loss could (1) impact greatly rare groups and (2) affect differ-
ently distinct viral groups [78]. In 2013, Hurwitz et al. [79]
compared methods for concentrating and purifying ocean
virus communities, e.g., ultrafiltration vs. FeCl3 precipitation
with the use of DNase sucrose and/or CsCl gradients. They
confirmed that ultrafiltration leads indeed to the underestima-
tion of viral genotypes, typically among the Phycodnaviridae
and podoviruses, compared to FeCl3-precipitated viruses. As
we used the classical ultrafiltration method, we are aware that
it is thus possible that we missed an important part of the
information.
As we used PFGE to fingerprint dsDNA viruses, our study
could only reveal abundant/dominant groups and miss minor
groups [43, 80]. Moreover, one PFGE band, representing a
subpopulation of dsDNA viruses having the same genome
size (sensu Jamindar et al. [46]), could contain several
X. Zhong et al.
genetically and morphologically different viruses or viral
groups. Also, the composition of this subpopulation (band)
could vary with time and between lakes. Therefore, we have to
keep in mind that PFGE could only provide a minimum
estimate of virioplankton genomic size diversity in Lakes
Annecy and Bourget [50, 80] and that it therefore reflected
patterns at the community scale limited at a subpopulation
level.
The genome size ranges of several groups of phytoplank-
ton viruses were investigated examining the occurrence of
some marker genes targeted using PCR. In addition to the
usual problems associated with PCR, there is another one
specific to our type of analysis: the template DNAs were
isolated from one or two PFGE bands for different band types.
We could miss the viruses of a same band type but occurring at
other moments since virus composition of a single band type
could vary with time as described above. Also, we examined
only 38 out of the 58 different band types because the other 20
bands were either not visibly abundant or difficult to excise
from gels or amplify. Note that amplicons of the excised
PFGE bands were not sequenced in this study, yet we have
conducted parallel studies in which we used the same primers
for the same field samples and showed that the amplicons
were indeed of viral origin [55, 56]. Although preliminary,
these results do enable us to identify, for the first time,
the occurrence of dsDNA phytoplankton viruses in PFGE
bands, with the caveat that the primers used to target specific
groups could still miss a large portion of the existing diversity
[55, 56, 81].
At last, quantifying the viral-induced mortality of bacteria
remains difficult, and a robust method has yet to be developed
[30, 67]. The accepted TEM-based approach (based on whole
cell examination) allows for the in situ estimation of virus-
mediated bacterial mortality, but caveats exist when using
empirical models to convert FVIC to VIBM [67, 68]. We used
the empirical model of Weinbauer et al. [67] to convert FVIC
to FIC and of Binder [68] to convert FIC to VIBM. Note,
however, that these models have been established for marine
systems, and although they have been used for freshwater
systems, some researchers still question this application [82].
Using the dilution method, which is not perfect either (e.g.,
[83, 84]), we found no correlation between TEM data, so it is
still questionable which method for determining mortality rate
is most accurate.
Contrasting Virioplankton Abundance, Structure,
and Distribution in Lakes Annecy and Bourget
Viruses displayed both vertical and temporal variations in
Lakes Annecy and Bourget. The patterns observed for viral
abundances in the two ecosystems were, however, different
for the three examined viral groups (VLP1, VLP2, and
VLP3). Likewise, the community structure and the abundance
 Author's personal copy
Diversity and Role of the Virioplankton in Peri-alpine Lakes
were uncoupled. These results could be due to the different
trophic states of the two lakes and/or to differing patterns of
host diversity and/or to varying dynamics in response to
environmental variables (light availability, oxygen concentra-
tion, nutrients availability, etc.) as highlighted in a parallel
study [74]. A particular feature was the higher development of
VLP2 and VLP3 in deep waters of Lake Annecy. This may
be linked to the higher transparency in this lake compared to
Lake Bourget (8.7 vs. 7.4 m); the higher light availability at
lower depths would enable some microorganisms to develop
despite limited nutrient. Typically, in Lake Annecy,
picocyanobacterial abundance can be relatively high below
20 m, and also different groups (corresponding to different
phycoerythrin contents) have been observed in this lake with a
group which is absent in Lake Bourget (Jacquet, unpublished).
This could explain why VLP2 and picocyanobacteria were
correlated in Lake Annecy (compared to Lake Bourget) sug-
gesting possible relationship between the two groups. By
contrast, mean viral abundance was higher in Lake Bourget,
which supports the previous finding that both heterotrophic
bacteria and phytoplankton are more abundant in this
lake [29, 60].
Compared to viral abundance, there was not an important
difference between the total number of PFGE bands obtained
in Lake Annecy (50) and Lake Bourget (47), but the diversity
of the bands differed between the two ecosystems with ap-
proximately one third of the bands not detected in both lakes.
Moreover, the PFGE analysis did not reveal any clear seasonal
changes in either lake. No band persisted in all of the samples
throughout the year, suggesting that the 2005 seed-bank mod-
el of Breitbart and Rohwer [7] could apply to virioplankton in
Lakes Annecy and Bourget and perhaps even to alpine lakes
in general. Indeed, only a few types of viruses could be
detected at any given time suggesting that most of them were
rather rare and/or inactive. Viral activity was likely directly
influenced by the abundance and growth of viral hosts in the
lakes [52]. It is noteworthy that this hypothesis has been
corroborated by the results of a previous study of phytoplank-
ton viruses in the same lakes [74].
A main difference in virioplankton composition between
the two lakes is that Lake Annecy contained at least five viral
populations with a genome size >500 kb, ranging from 500 to
620 kb, and this was a major cause of the outnumbering PFGE
bands in this lake. These large genomes (e.g., 510, 538, 565,
596, and 620 kb) were present throughout the year. The
existence of large genome sizes has been previously reported
for Lake Klocktjarn, another oligotrophic lake, but also for
Lake Erken, a mesotrophic lake, by Lymer et al. [85]. The
detection of large viral genome sizes in oligotrophic condi-
tions is striking but it may reflect the existence of unique host
and/or viral features such as the presence of more auxiliary
metabolic genes in response to stress adaptation by virus. Of
the five viral populations with large genome size, two
77
relatively abundant bands (596 and 565 kb) were examined
using PCR, but we did not obtain a positive match with algal
virus or cyanophage primers. This result suggests that these
viruses were not viruses infecting phytoplankton, provided
that the primers could detect them unambiguously.
Occurrence and Genome Size Range of Phytoplankton
Viruses
Our PCR assay showed that viruses infecting phytoplankton
(including cyanobacteria) in Lakes Annecy and Bourget
ranged from 65 to 486 kb: the cyano(myo)phages ranged from
65 to 317 kb and the phycodnaviruses from 79 to 486 kb. To
the best of our knowledge, our investigation is the first for
freshwater, and other studies have not used as many primers
[46, 52, 58]. Our analysis is, of course, not complete as we did
not, for example, investigate either cyanopodoviruses or
cyanosiphoviruses due to a lack of primers, or a lack of
efficient primers, for these groups. Note that currently known
genomes of cyanopodovirus and cyanosiphovirus are 41
48 kb [8691] and 30108 kb [83, 92, 93], respectively. Our
PFGE analyses have also revealed such genome sizes, so it is
possible that they could be related to these cyanophage types,
whose presence we have, in fact, previously shown [56].
The genome size of phycodnaviruses was in the range of 79
to 486 kb based on mcp, whereas it was between 223 and
263 kb based on polB. Such a difference is not surprising
given the recent finding that these two primers probably target
distinct viral groups [55]. Indeed, primers can amplify mcp
from a large range of phycodnavirus groups, including
Prasinovirus , Chlorovirus , Prymnesiovirus , PoV group,
Raphidovirus , etc. Most of the mcp -positive PFGE- ands
were within the genome size range of 155 to 560 kb, which
is typically what has been observed for phycodnaviruses
[9496]. However, we also found two bands outside of this
range, at 142 and 79 kb. To the best of our knowledge, the
smallest phycodnavirus genome obtained so far is
Feldmannia sp. virus (FsV-158) at approximately 155 kb
[94]. Our result indicates therefore that, in peri-alpine lakes,
some phycodnaviruses may be as small as 79 kb. This hy-
pothesis warrants further investigation. AVS1/2 primers are
only able to amplify polB of phycodnaviruses infecting mem-
bers of Chlorophyta (Prasinovirus, Chlorovirus, etc.) [55,
97]. Based on currently known genomes of prasinoviruses
(180 to 200 kb) [98101] and chloroviruses (321 to 369 kb)
[9], the five polB -positive PFGE bands obtained (223 to
263 kb) were related to neither Prasinovirus nor
Chlorovirus. This finding is again consistent with a parallel
study we conducted on the same samples which revealed that
the majority of the polB sequences belonged neither to the
marine prasinovirus cluster (MpV, OtV, OlV, and BpV) or to
the freshwater chlorovirus group [55]. Here again, the ques-
tion is asked to know whether our study may suggest the
 Author's personal copy
78
existence of unknown phycodnaviruses infecting other mem-
bers of Chlorophyta with a genome size of around 250 kb. It
also highlights the lack of knowledge on viruses that infect
freshwater eukaryotic algae [102].
The two marker genes used to detect cyanophages (i.e.,
g20 and psbA) provided the same genome size range esti-
mates (65 to 317 kb), but only 5 out of the 10g20-positive
PFGE bands were also positive to psbA amplification. Such a
result makes sense because g20 targets cyanomyoviruses and
psbA can be found in cyanomyo- and in cyanopodoviruses
[56, 103, 104]. Our results, therefore, agree with the previous
finding that not all cyanomyoviruses possess host-derived
psbA gene in their genomes [104]. The cyanomyoviruses in
peri-alpine lakes seemed to be characterized by genome sizes
larger than what has been reported until now (i.e., from 161 to
253 kb) by several authors [91, 105110]. It is noteworthy,
however, that Sandaa and Larsen [52] and Sandaa et al. [58]
reported larger genome size for cyanophages in Norwegian
coastal waters (up to 380 kb). Taken together, these results
suggest that the genome of cyanomyoviruses may be both
larger and smaller than currently thought.
T4-like myoviruses can infect a wide range of hosts from
proteobacteria to cyanobacteria [111]. The maximum genome
size is currently thought to be 253 kb with the cyanophage P-
SSM2 [91], and the minimum 147 kb with HTVC008M, a
phage infecting SAR11 [112]. However, our study revealed
genome sizes ranging from 41 to 317 kb. Among the 13g23-
positive PFGE bands obtained, 10 (65 to 317 kb) could be
explained by the presence of cyanomyoviruses since they
were also positive to g20 . The other three (41, 79, and
223 kb) were negative to g20. Likewise, another study con-
ducted in two North American estuaries also using PFGE and
g23 to amplify DNA reported that T4-like myoviruses have a
broad genome size range of between 23 and 242 kb [46].
These results are consistent with ours and suggest the T4-like
myoviruses may be both larger and smaller than previously
suggested.
Contrasting Virioplankton Morphology in the Two
Ecosystems
The majority of the viruses observed using TEM were tailed
phages. Only 13 % were untailed. These results are consistent
with the finding that bacteria are the most abundant cellular
forms in these peri-alpine lakes [29], and thus, tailed phages
are also expected to be numerous. However, it is important to
note that TEM analysis probably missed a significant portion
of phage diversity as suggested by the metagenomic survey of
Lake Bourget conducted by Roux et al. [21] which revealed
that 92.3 % of identifiable virus-like sequences were related to
ssDNA virus (essentially the Microviridiae). We also have to
keep in mind that RNA viruses may also be important, as
suggested by recent studies [15, 23, 24].
X. Zhong et al.
Both of the lakes we studied sustained relatively high
proportions of siphoviruses, with podoviruses predominating
in Lake Annecy and myoviruses in Lake Bourget. This differ-
ence between the lakes may be due to their different trophic
states and/or host species diversity. Indeed, podoviruses are
known to have a narrower host range than myoviruses and
also are more likely to exhibit lysogeny processes than are
Siphoviridae. Their dominance in the oligotrophic Lake
Annecy could thus be a result of nutrient limitations affecting
very specific host species, thereby favoring the lysogeny life
cycle. In contrast, myoviruses are known to be lytic over a
broad host range. Our own results suggested indeed that the
myoviruses were the main cause of bacterial mortality in both
lakes and that most of them could be related to the VLP2
group (see below). However, we did not sort individual VLPs
from flow cytometry to identify them by TEM to confirm the
reality of such correlations.
Our study revealed that unicellular bacteria (rod- and cocci-
shaped) accounted for, on average, greater than 92 % of
infected cells in both lakes, and therefore, it could be these
bacteria that are responsible for the high bacterial mortality
rates. In Lake Annecy, a higher proportion of infected bacteria
were cocci and short rod forms, while in Lake Bourget the
dominant forms were elongated and fat rods. Again, this
reflects differences in host diversity and/or physiology be-
tween the lakes. Indeed, bacteria can adapt their morphology
in response to environment (e.g., nutrients uptake, mobility,
escaping predator) [113, 114]. Rod-shaped cells are favored in
nutrient-rich environments, whereas small coccal-shaped bac-
teria are often dominant in low nutrient waters [115]. In Lake
Bourget (oligomesotrophic), elongated rod shapes were rela-
tively important compared to other morphotypes. Pradeep
et al. [116] found a similar result for Lake Crteil, France.
Note at last that we could not observe infected
picocyanobacterial cells.
Contrasting Functional Role of Bacteriophages in the Two
Ecosystems
Our results showed that between 1.7105 and 1.1106 bac-
terial cells per milliliter and per day have to be lysed in order
to maintain the observed viral production in Lake Bourget
(mean=4.7105), while it was between 9104 and 1.6106
cells mL1 day1 in Lake Annecy (mean=4.5105). On aver-
age, higher fractions of infected bacteria and bacterial mortal-
ity rates were observed in Lake Annecy compared to Lake
Bourget, suggesting a more important viral control in the
oligotrophic lake. If so, this result could thus be important to
explain (1) viral control of the bacterial population size and (2)
nutrient's recycling through lysis. Note that such aspects have
been reported elsewhere in other oligotrophic lakes or marine
waters [117119]. It is thus possible that, in lakes with low
 Author's personal copy
Diversity and Role of the Virioplankton in Peri-alpine Lakes
productivity, a strong lytic activity would allow to support the
metabolic activity of prokaryotes.
There was no relationship between bacterial and viral
abundances and between VIBM and total VLP for Lake
Bourget when considering the whole viral abundance.
However, we did find a weak positive relationship between
VLP2 and VIBM (r =0.55, n =19, p <0.05). The correlation
was even stronger for Lake Annecy (r =0.74, n =13, p <0.01).
For both lakes, however, the relationship between lytic activ-
ity and VLP1 was not significant. This result is original since,
to the best of your knowledge, it is the first time that such a
relationship is provided by discriminating the importance of
VLP1 vs. VLP2. In most cases, absences of positive relation-
ships have been reported between viral abundances and their
lytic activity [6, 120]. A significant positive relationship is
interpreted as meaning the viral group is a cause of bacterial
mortality. Our results suggest that VLP2, rather than VLP1,
may be responsible for the lytic activity exhibited by the viral
community. It would be interesting to test experimentally
whether, and under what conditions, VLP2 is the dominant
cause of bacterial mortality, both in these peri-alpine lakes and
elsewhere.
Of the three morphologically different bacteriophages
types, the myovirus abundance was positively and significant-
ly correlated to VIBM whatever the lake (r =0.89, p <0.001).
By contrast, negative and significant correlations were found
between VIBM and podoviruses in Lake Annecy (r =0.87,
n =13, p =0) and between VIBM and siphoviruses in Lake
Bourget (r =0.88, n =19, p <0.001). Moreover, most of the
viruses observed in visibly infected cells were myoviruses.
These results could thus suggest that the myoviruses were the
main cause of bacterial mortality in these lakes. The negative
relationship between VIBM and the podoviruses in Lake
Annecy and between VIBM and the siphoviruses in Lake
Bourget suggested that viral lysis may cause enrichment in
the form of increased dissolved organic matter, which is
then made available for the noninfected fraction of the
bacterioplankton [121]. Collectively, the fact that both the
FCM-observed VLP2 and TEM-observed myoviruses could
explain bacterial mortality suggested that these two viral
groups were related. Indeed, positive and significant corre-
lations were detected between VLP2 and myoviruses in
Lake Bourget (r =0.73, n =17, p <0.01) and Lake Annecy
(r =0.67, n =13, p <0.05). What we now need is more
research on these relationships and on the potential hosts
of these viral groups.
Conclusion
This 1-year investigation of virioplankton in two peri-alpine
lakes revealed a temporal, vertical, and geographical variabil-
ity in viral abundance, structure, morphology, and lytic
79
activity. The observed differences between the two ecosys-
tems in virioplankton and cell morphotypes of infected bacte-
ria may be due to differences in trophic states and/or to
differences in host diversity or physiology linked to environ-
mental pressures. We observed links among virus-induced
bacterial mortality, FCM-observed VLP2, and TEM-
observed Myovirus, suggesting that myoviruses were the
main cause of bacterial mortality, with the active fraction
being detected in the VLP2 FCM signature. Finally, we were
able to detect phytoplankton viruses, and these viruses appear
to have a larger genome size range than previously reported.
This study provides important new evidence of the quantita-
tive, qualitative, and functional importance of viruses in lakes.
Acknowledgments We would like to thank Jean-Christophe Hustache,
Grard Paolini, and Pascal Perney for sampling and Franois Keck for
figure support. This work was supported by a fellowship from the region
of Rhne-Alpes (France) awarded to XZ. Susan Lempriere is acknowl-
edged for language editing.
References
1. Suttle CA (2005) Viruses in the sea. Nature 437:356361
2. Brussaard CPD (2004) Viral control of phytoplankton popula-
tionsa review. J Eukaryot Microbiol 51:125138
3. Dunlap DS, Fei Fan Ng T, Rosario K, Barbosa JG, Greco AM,
Breitbart M, Hewson I (2013) Molecular and microscopic evidence
of viruses in marine copepods. Proc Natl Acad Sci U S A 110:1375
1380
4. Jiang S, Steward G, Jellison R, Chu W, Choi S (2004) Abundance,
distribution, and diversity of viruses in alkaline, hypersaline Mono
Lake, California. Microb Ecol 47:917
5. Prangishvili D, Forterre P, Garrett RA (2006) Viruses of the
Archaea: a unifying view. Nat Rev Microbiol 4(11):837848
6. Weinbauer MG (2004) Ecology of prokaryotic viruses. FEMS
Microbiol Rev 28:127181
7. Breitbart M, Rohwer F (2005) Here a virus, there a virus, every-
where the same virus? Trends Microbiol 13:278284
8. Sime-Ngando T, Colombet J (2009) Virus and prophages in aquatic
ecosystems. Can J Microbiol 55:95109
9. Van Etten JL, Lane LC, Dunigan DD (2010) DNA viruses: the really
big ones (giruses). Annu Rev Microbiol 64:8399
10. Arslan D, Legendre M, Seltzer V, Abergel C, Claverie JM (2011)
Distant Mimivirus relative with a larger genome highlights the
fundamental features of Megaviridae. Proc Natl Acad Sci U S A
108(42):1748617491
11. La Scola B, Campocasso A, N'Dong R, Fournous G, Barrassi L,
Flaudrops C, Raoult D (2010) Tentative characterization of new
environmental giant viruses by MALDI-TOF mass spectrometry.
Intervirology 53:344353
12. Philippe N, Legendre M, Douytre G, Cout Y, Poirot O, Lescot M,
Arslan D, Seltzer V, Bertaux L, Bruley C, Garin J, Claverie JM,
Abergel C (2013) Pandoraviruses: amoeba viruses with genomes up
to 2.5 Mb reaching that of parasitic eukaryotes. Science 341(6143):
281286
13. Raoult D, Audic S, Robert C, Abergel C, Renesto P, Ogata H, La
Scola B, Suzan M, Claverie JM (2004) The 1.2-megabase genome
sequence of Mimivirus. Science 306:13441350
14. Tucker KP, Parsons R, Symonds EM, Breitbart M (2011) Diversity
and distribution of single-stranded DNA phages in the North
Atlantic Ocean. ISME J 5:822830
 Author's personal copy
80
15. Lang AS, Rise ML, Culley AI, Steward GF (2009) RNA viruses in
the sea. FEMS Microbiol Rev 33:295323
16. Bench SR, Hanson TE, Williamson KE, Ghosh D, Radosovich M,
Wang K, Wommack KE (2007) Metagenomic characterization of
Chesapeake Bay virioplankton. Appl Environ Microbiol 73:7629
7641
17. Fancello L, Trape S, Robert C, Boyer M, Popgeorgiev N, Raoult D,
Desnues C (2013) Viruses in the desert: a metagenomic survey of
viral communities in four perennial ponds of the Mauritanian
Sahara. ISME J 7:359369
18. Lauro FM, DeMaere MZ, Yau S, Brown MV, Ng C, Wilkins D,
Raftery MJ, Gibson JA, Andrews-Pfannkoch C, Lewis M, Hoffman
JM, Thomas T, Cavicchioli R (2011) An integrative study of a
meromictic lake ecosystem in Antarctica. ISME J 5:879895
19. Lpez-Bueno A, Tamames J, Velzquez D, Moya A, Quesada A,
Alcam A (2009) High diversity of the viral community from an
Antarctic lake. Science 326:858861
20. Rodriguez-Brito B, Li L, Wegley L, Furlan M, Angly F, Breitbart
M, Buchanan J, Desnues C, Dinsdale E, Edwards R, Felts B,
Willner D, Haynes M, Liu H, Lipson D, Mahaffy J, Martin-
Cuadrado A, Mira A, Nulton J, Paic L, Rayhawk S, Rodriguez-
Mueller J, Rodriguez-Valera F, Salamon P, Srinagesh S, Thingstad
TF, Tran T, Thurber RV, Willner D, Youle M, Rohwer F (2010) Viral
and microbial community dynamics in four aquatic environments.
ISME J 4:739751
21. Roux S, Enault F, Robin A, Ravet V, Personnic S, Theil S,
Colombet J, Sime-Ngando T, Debroas D (2012) Assessing the
diversity and specificity of two freshwater viral communities
through metagenomics. PLoS ONE 7:e33641
22. Williamson SJ, Rusch DB, Yooseph S, Halpern AL, Heidelberg
KB, Glass JI, Andrews-Pfannkoch C, Fadrosh D, Miller SC, Sutton
G, Frazier M, Venter JC (2008) The Sorcerer II Global Ocean
Sampling Expedition: metagenomic characterization of viruses
within aquatic microbial samples. Plos One 3:e1456
23. Culley AI, Lang AS, Suttle CA (2006) Metagenomic analysis of
coastal RNA virus communities. Science 312:17951798
24. Steward GF, Culley AI, Mueller JA, Wood-Charlson EM, Belcaid
M, Poisson G (2013) Are we missing half of the viruses in the
ocean? ISME J 7:672679
25. Brussaard CPD, Payet JP, Winter C, Weinbauer MG (2010)
Quantification of aquatic viruses by flow cytometry. In: Wilhelm
SW, Weinbauer MG, Suttle CA (eds) Manual of aquatic viral
ecology. Chapter 11. ASLO, Waco, pp 102109
26. Wommack KE, Colwell RR (2000) Virioplankton: viruses in aquat-
ic ecosystems. Microbiol Mol Biol Rev 64:69114
27. Larsen A, Castberg T, Sandaa RA, Brussaard CPD, Egge J, Heldal
M, Paulino A, Thyrhaug R, van Hannen EJ, Bratbak G (2001)
Population dynamics and diversity of phytoplankton, bacteria and
viruses in a seawater enclosure. Mar Ecol Prog Ser 221:4757
28. Larsen A, Fonnes-Flaten GA, Sandaa RA, Castberg T, Thyrhaug R,
Erga SR, Jacquet S, Bratbak G (2004) Spring phytoplankton bloom
dynamics in Norwegian coastal waters: microbial community suc-
cession and diversity. Limnol Oceanogr 49:180190
29. Personnic S, Domaizon I, Dorigo U, Berdjeb L, Jacquet S (2009)
Seasonal and spatial variability of virio, bacterio- and
picophytoplanktonic abundances in three peri-alpine lakes.
Hydrobiology 627:99111
30. Suttle CA (2007) Marine virusesmajor players in the global
ecosystem. Nat Rev Microbiol 5:801812
31. Holmfeldt K, Odi D, Sullivan M, Middelboe M, Riemann L (2012)
Cultivated single stranded DNA phages that infect marine
Bacteroidetes prove difficult to detect with DNA binding stains.
Appl Environ Microbiol 78:892894
32. Tomaru Y, Nagasaki K (2007) Flow cytometric detection and enu-
meration of DNA and RNA viruses infecting marine eucaryotic
microalgae. J Oceanogr 63:215221
X. Zhong et al.
33. Jacquet S, Miki T, Noble R, Peduzzi P, Wilhelm S (2010) Viruses in
aquatic ecosystems: important advancements of the last 20 years
and prospects for the future in microbial oceanography and limnol-
ogy. Adv Oceanogr Limnol 1:71101
34. Wilhelm SW, Matteson AR (2008) Freshwater and marine
virioplankton: a brief overview of commonalities and differences.
Fresh Biol 53:10761089
35. Wilhelm SW, Suttle CA (1999) Viruses and nutrient cycles in the
sea. Bioscience 49:781788
36. Proctor LM, Fuhrman JA (1990) Viral mortality of marine bacteria
and cyanobacteria. Nature 343:6062
37. Proctor LM, Okubo A, Fuhrman JA (1993) Calibrating estimates of
phage-induced mortality in marine bacteria: ultrastructural studies
of marine bacteriophage development from one-step growth exper-
iments. Microb Ecol 25:161182
38. Suttle CA (1994) The significance of viruses to mortality in aquatic
microbial communities. Microb Ecol 28:237243
39. Suttle CA (2000) Ecological, evolutionary, and geochemical conse-
quences of viral infection of cyanobacteria and eukaryotic algae. In:
Hurst C (ed) Viral Ecology. Academic, San Diego, pp 247296
40. Jacquet S, Domaizon I, Personnic S, Duhamel S, Pradeep Ram AS,
Heldal M, Sime-Ngando T (2005) Estimates of protozoan and virus-
mediated mortality of bacterioplankton in Lake Bourget (France).
Fresh Biol 50:627645
41. Sandaa RA (2008) Burden or benefit? Virushost interactions in the
marine environment. Res Microbiol 159:374381
42. Ammini P, Zhong X, Jacquet S (2012) Dynamics of various viral
groups infecting autotrophic picoplankton. Adv Oceanogr Limnol
3:171191
43. Filippini M, Middelboe M (2007) Viral abundance and genome size
distribution in the sediment and water column of marine and fresh-
water ecosystems. FEMS Microbiol Ecol 60:397410
44. Tijdens M, Hoogveld HL, Kamst-van Agterveld MP, Simis SGH,
Baudoux A-C, Laanbroek HJ, Gons HJ (2008) Population dynam-
ics and diversity of viruses, bacteria and phytoplankton in a shallow
eutrophic lake. Microb Ecol 56:2942
45. Auguet JC, Montani H, Lebaron P (2006) Structure of
virioplankton in the Charente Estuary (France): transmission elec-
tron microscopy versus pulsed field gel electrophoresis. Microb
Ecol 51:197208
46. Jamindar S, Polson SW, Srinivasiah S, Waidner L, Wommack KE
(2012) Evaluation of two approaches for assessing the genetic
similarity of virioplankton populations as defined by genome size.
Appl Environ Microbiol 78:87738783
47. Wommack KE, Ravel J, Hill RT, Chun J, Colwell RR (1999)
Population dynamics of Chesapeake Bay virioplankton: total-
community analysis by pulsed-field gel electrophoresis. Appl
Environ Microbiol 65:231240
48. Boujelben I, Yarza P, Almansa C, Villamor J, Maalej S, Antn J,
Santos F (2012) Virioplankton community structure in Tunisian
solar salterns. Appl Environ Microbiol 78:74297437
49. Ory P, Palesse S, Delmas D, Montani H (2011) In situ structuring
of virioplankton through bacterial exoenzymatic activity: interaction
with phytoplankton. Aquat Microb Ecol 64:233252
50. Parada V, Baudoux AC, Sintes E (2008) Dynamics and diversity of
newly produced virioplankton in the North Sea. ISME J 2:924936
51. Riemann L, Middelboe M (2002) Stability of bacterial and viral
community compositions in Danish coastal waters as depicted by
DNA fingerprinting techniques. Aquat Microb Ecol 27:219232
52. Sandaa R-A, Larsen A (2006) Seasonal variations in virus-host
populations in Norwegian coastal waters: focusing on the
cyanophage community infecting marine Synechococcus spp.
Appl Environ Microbiol 72:46104618
53. Steward GF, Montiel JL, Azam F (2000) Genome size distributions
indicate variability and similarities among marine viral assemblages
from diverse environments. Limnol Ocean 45:16971706
 Author's personal copy
Diversity and Role of the Virioplankton in Peri-alpine Lakes
54. Leroy M, Prigent M, Dutertre M, Confalonieri F, DuBow M (2008)
Bacteriophage morphotype and genome diversity in Seine River
sediment. Freshw Biol 53:11761185
55. Zhong X, Jacquet S (2013) Contrasting diversity of phycodnavirus
signature genes in two large and deep western European lakes.
Environ Microbiol. doi:10.1111/1462-2920.12201
56. Zhong X, Jacquet S (2013) Prevalence of viral photosynthetic and
capsid protein genes from cyanophages in two large and deep peri-
alpine lakes. Appl Environ Microbiol. doi:10.1128/AEM.01914-13
57. Zhong X, Berdjeb L, Jacquet S (2013) Temporal dynamics and
structure of picocyanobacteria and cyanomyoviruses in two large
and deep peri-alpine lakes. FEMS Microbiol Ecol 86:312326
58. Sandaa R-A, Clokie M, Mann NH (2008) Photosynthetic genes in
viral populations with a large genomic size range from Norwegian
coastal waters. FEMS Microbiol Ecol 63:211
59. Colombet J, Robin A, Lavie L, Bettarel Y, Cauchie HM, Sime-
Ngando T (2007) Virioplankton pegylation: use of PEG (polyeth-
ylene glycol) to concentrate and purify viruses in pelagic ecosys-
tems. J Microbiol Methods 71:212219
60. Personnic S, Domaizon I, Sime-Ngando T, Jacquet S (2009)
Seasonal variations of microbial abundances and virus- vs
flagellate-induced mortality of picoplankton in three peri-alpine
lakes. J Plankton Res 31:11611177
61. Vaulot D (1989) CYTOPC: processing software for flow cytometric
data. Signal Noise 2:8
62. Marie D, Brussaard CPD, Thyrhaug R, Bratbak G, Vaulot D (1999)
Enumeration of marine viruses in culture and natural samples by
flow cytometry. Appl Environ Microbiol 65:4552
63. Marie D, Partensky F, Simon N, Guillou L, Vaulot D (2000) Flow
cytometry analysis of marine picoplankton. In: Diamond RA,
DeMaggio S (eds) In living colors: Protocols in flow cytometry
and cell sorting. Springer, New York
64. Pradeep Ram AS, Rasconi S, Jobard M, Palesse S, Colombet J,
Sime-Ngando T (2011) High lytic infection rates but low abun-
dances of prokaryote viruses in a humic lake (Vassivire, Massif
Central, France). Appl Environ Microbiol 77:56105618
65. Sime-Ngando T, Mignot JP, Amblard C, Bourdier G, Devilettes C,
Quilblier-Lloberas C (1996) Characterization of planktonic virus-
like particles in a French mountain lake: methodological aspects and
preliminary results. Ann Limnol-Int J Lim 32:15
66. Weinbauer MG, Peduzzi P (1994) Frequency, size and distribution
of bacteriophages in different marine bacterial morphotypes. Mar
Ecol Prog Ser 108:1120
67. Weinbauer MG, Winter C, Hfle MG (2002) Reconsidering trans-
mission electron microscopy based estimates of viral infection of
bacterioplankton using conversion factors derived from natural
communities. Aquat Microb Ecol 27:103110
68. Binder B (1999) Reconsidering the relationship between virally
induced bacterial mortality and frequency of infected cells. Aquat
Microb Ecol 18:207215
69. Sullivan MB, Coleman ML, Quinlivan V, Rosenkrantz JE,
Defrancesco AS, Tan G, Fu R, Lee JA, Waterbury JB, Bielawski
JP, Chisholm SW (2008) Portal protein diversity and phage ecolo-
gy. Environ Microbiol 10:28102823
70. File J, Ttart F, Suttle CA, Krisch HM (2005) Marine T4-type
bacteriophages, a ubiquitous component of the dark matter of the
biosphere. Proc Natl Acad Sci U S A 102:1247112476
71. Sullivan MB, Lindell D, Lee JA, Thompson LR, Bielawski JP,
Chisholm SW (2006) Prevalence and evolution of core photosystem
II genes in marine cyanobacterial viruses and their hosts. PLoS Biol
4:e234
72. Chen F, Suttle CA (1995) Amplification of DNA polymerase gene
fragments from viruses infecting microalgae. Appl Environ
Microbiol 61:12741278
73. Larsen JB, Larsen A, Bratbak G, Sandaa R (2008) Phylogenetic
analysis of members of the Phycodnaviridae virus family, using
81
amplified fragments of the major capsid protein gene. Appl
Environ Microbiol 74:30483057
74. Zhong X, Rimet F, Jacquet S (in revision) Seasonal variations in
PCR-DGGE fingerprinted viruses infecting phytoplankton in large
and deep peri-alpine lakes
75. Heldal M, Bratbak G (1991) Production and decay of viruses in
marine waters. Mar Ecol Prog Ser 72:205212
76. Seymour JR, Seuront L, Doubell PM, Waters RL, Mitchell JG
(2006) Microscale patchiness of virioplankton. J Mar Biol Assoc
U K 86:551561
77. Jacquet S, Jacquet S, S. Cachera C, Colon M, Espinat L, GirelC,
Guillard J, Hamelet V, Hustache JC, Kerrien F, Lacroix D, Laine L,
Laplace-Treyture C, Lazzarotto J, Paolini G, Perga M, Perney P,
Rimet F, Verneaux V (2012) Suivi environnemental des eaux du lac
du Bourget pour lanne 2011. Rapport INRA-CISALB, 220 pp
78. Wommack KE, Sime-Ngando T, Winget DM, Jamindar S, Helton
RR (2010) Filtration-based methods for the collection of viral
concentrates from large water samples. In: Wilhelm SW,
Weinbauer MG, Suttle CA (eds) Manual of aquatic viral ecology.
Chapter 12. ASLO, Waco, pp 110117
79. Hurwitz BL, Deng L, Polos BT, Sullivan MB (2013) Evaluation of
methods to concentrate and purify ocean virus communities through
comparative, replicated metagenomics. Environ Microbiol 15:
14281440
80. Sandaa RA, Short SM, Schroeder DC (2010) Fingerprinting aquatic
virus communities. Methods Aquat Viral Ecol 2:918
81. Short SM, Chen F, Wilhelm SW (2010) The construction and analysis
of marker gene libraries. Methods Aquat Viral Ecol 9:8291
82. Pradeep RAS, Sime-Ngando T (2010) Resources drive trade-off
between viral lifestyles in the plankton: evidence from freshwater
microbial microcosms. Environ Microbiol 12:467479
83. Huang S, Wang K, Jiao N, Chen F (2012) Genome sequences of
siphoviruses infecting marine Synechococcus unveil a diverse
cyanophage group and extensive phagehost genetic exchanges.
Environ Microbiol 14:540558
84. Thomas R, Berdjeb L, Sime-Ngando T, Jacquet S (2011) Viral
abundance, production, decay rates and life strategies (lysogeny
versus lysis) in Lake Bourget (France). Environ Microbiol 13:
616630
85. Lymer D, Logue JB, Brussaard CPD, Baudoux A-C, Vrede K,
Lindstrm ES (2008) Temporal variation in freshwater viral and
bacterial community composition. Freshw Biol 53:11631175
86. Chen F, Lu J (2002) Genomic sequence and evolution of marine
cyanophage P60: a new insight on lytic and lysogenic phages. Appl
Environ Microbiol 68:25892594
87. Labrie SJ, Frois-Moniz K, Osburne MS, Kelly L, Roggensack SE,
Sullivan MB, Gearin G, Zeng Q, Fitzgerald M, Henn MR,
Chisholm SW (2013) Genomes of marine cyanopodoviruses reveal
multiple origins of diversity. Environ Microbiol 15:13561376
88. Liu X, Shi M, Kong S, Gao Y, An C (2007) Cyanophage Pf-WMP4,
a T7-like phage infecting the freshwater cyanobacterium
Phormidium foveolarum: complete genome sequence and DNA
translocation. Virology 366:2839
89. Liu X, Kong S, Shi M, Fu L, Gao Y, An C (2008) Genomic analysis
of freshwater cyanophage Pf-WMP3 infecting cyanobacterium
Phormidium foveolarum : the conserved elements for a phage.
Microb Ecol 56:671680
90. Pope WH, Weigele PR, Chang J, Pedulla ML, Ford ME, Houtz JM
et al (2007) Genome sequence, structural proteins, and capsid
organization of the cyanophage Syn5: a horned bacteriophage
of marine Synechococcus. J Mol Biol 368:966981
91. Sullivan MB, Coleman ML, Weigele P, Rohwer F, Chisholm SW
(2005) Three Prochlorococcus cyanophage genomes: signature
features and ecological interpretations. Plos Biol 3:e144
92. Mizuno CM, Rodriguez-Valera F, Garcia-Heredia I, Martin-
Cuadrado A-B, Ghai R (2013) Reconstruction of novel
 Author's personal copy
82
cyanobacterial Siphovirus genomes from Mediterranean
metagenomic fosmids. Appl Environ Microbiol 79:688695
93. Sullivan MB, Krastins B, Hughes JL, Kelly L, Chase M, Sarracino
D, Chisholm SW (2009) The genome and structural proteome of an
ocean siphovirus: a new window into the cyanobacterial
mobilome . Environ Microbiol 11:29352951
94. Schroeder DC, Park Y, Yoon H-M, Lee YS, Kang SW, Meints RH,
Ivey RG, Choi TJ (2009) Genomic analysis of the smallest giant
virusFeldmannia sp. virus 158. Virology 384:223232
95. Van Etten JL, Graves MV, Mller DG, Boland W, Delaroque N
(2002) Phycodnaviridaelarge DNA algal viruses. Arch Virol 147:
14791516
96. Wilson WH, Van Etten JL, Allen MJ (2009) The Phycodnaviridae:
the story of how tiny giants rule the world. Curr Top Microbiol
Immunol 328:142
97. Short CM, Rusanova O, Short SM (2011) Quantification of virus
genes provides evidence for seed-bank populations of
phycodnaviruses in Lake Ontario, Canada. ISME J 5:810821
98. Dherelle E, Ferraz C, Escande M-L, Eycheni S, Cooke R, Piganeau
G, Desdevises Y, Bellec L, Moreau H, Grimsley N (2008) Life-
cycle and genome of OtV5, a large DNA virus of the pelagic marine
unicellular green alga Ostreococcus tauri. Plos One 3:e2250
99. Moreau H, Piganeau G, Desdevises Y, Cooke R, Dherelle E,
Grimsley N (2010) Marine prasinovirus genomes show low evolu-
tionary divergence and acquisition of protein metabolism genes by
horizontal gene transfer. J Virol 84:1255512563
100. Weynberg KD, Allen MJ, Ashelford K, Scanlan DJ, Wilson WH
(2009) From small hosts come big viruses: the complete genome of
a second Ostreococcus tauri virus, OtV-1. Environ Microbiol 11:
28212839
101. Weynberg KD, Allen MJ, Gilg IC, Scanlan DJ, Wilson WH (2011)
Genome sequence of Ostreococcus tauri virus OtV-2 throws light
on the role of picoeukaryote niche separation in the ocean. J Virol
85:45204529
102. Short SM (2012) The ecology of viruses that infect eukaryotic algae.
Environ Microbiol 14:22532271
103. Dekel-Bird NP, Avrani S, Sabehi G, Pekarsky I, Marston MF,
Kirzner S, Lindell D (2013) Diversity and evolutionary relation-
ships of T7-like podoviruses infecting marine cyanobacteria.
Environ Microbiol 15:14761491
104. Wang K, Chen F (2008) Prevalence of highly hostspecific
cyanophages in the estuarine environment. Environ Microbiol 10:
300312
105. Dreher TW, Brown N, Bozarth CS, Schwartz AD, Riscoe E, Thrash
C, Bennett SE, Tzeng SC, Maier CS (2011) A freshwater cyanophage
whose genome indicates close relationships to photosynthetic marine
cyanomyophages. Environ Microbiol 13:18581874
106. Mann NH, Clokie MRJ, Millard A, Cook A, Wilson WH, Wheatley
PJ, Letarov A, Krisch HM (2005) The genome of S-PM2, a
photosynthetic T4-type bacteriophage that infects marine
Synechococcus strains. J Bacteriol 187:31883200
X. Zhong et al.
107. Millard AD, Zwirglmaier K, Downey MJ, Mann NH, Scanlan DJ
(2009) Comparative genomics of marine cyanomyoviruses reveals
the widespread occurrence of Synechococcus host genes localized
to a hyperplastic region: implications for mechanisms of
cyanophage evolution. Environ Microbiol 11:23702387
108. Sabehi G, Shaulov L, Silver DH, Yanai I, Harel A, Lindell D (2012)
A novel lineage of myoviruses infecting cyanobacteria is wide-
spread in the oceans. Proc Natl Acad Sci U S A 109:20372042
109. Sullivan MB, Huang KH, Ignacio-Espinoza JC, Berlin AM, Kelly
L, Weigele PR (2010) Genomic analysis of oceanic cyanobacterial
myoviruses compared with T4-like myoviruses from diverse hosts
and environments. Environ Microbiol 12:30353056
110. Weigele PR, Pope WH, Pedulla ML, Houtz JM, Smith AL, Conway
JF, King J, Hatfull GF, Lawrence JG, Hendrix RW (2007) Genomic
and structural analysis of Syn9, a cyanophage infecting marine
Prochlorococcus and Synechococcus. Environ Microbiol 9:1675
1695
111. Petrov VM, Ratnayaka S, Nolan JM, Miller ES, Karam JD (2010)
Genomes of the T4-related bacteriophages as windows on microbial
genome evolution. Virol J 7:292
112. Zhao Y, Temperton B, Thrash JC, Schwalbach MS, Vergin KL,
Landry ZC et al (2013) Abundant SAR11 viruses in the ocean.
Nature 494:357360
113. Pernthaler J (2005) Predation on prokaryotes in the water column
and its ecological implications. Nat Rev Microbiol 3:537546
114. Young KD (2007) Bacterial morphology: why have different
shapes? Curr Opin Microbiol 10:596600
115. La Ferla R, Leonardi M (2005) Ecological implications of biomass
and morphotype variations of bacterioplankton: an example in a
coastal zone of the Northern Adriatic Sea (Mediterranean). Mar Ecol
26:8288
116. Pradeep Ram AS, Arnous B, Danger M, Carrias J-F, Lacroix
G, Sime-Ngando T (2010) High and differential viral infection
rates within bacterial morphopopulations in a shallow sand
pit lake (Lac de Crteil, France). FEMS Microbiol Ecol 74:83
92
117. Bettarel Y, Sime-Ngando T, Amblard C, Dolan J (2004) Viral
activity in two contrasting lake ecosystems. Appl. Appl Environ
Microbiol 70:29412951
118. Choi DH, Chung YH, Cho BC (2003) Comparison of virus- and
bacterivory-induced bacterial mortality in the eutrophic Masan Bay,
Korea. Aquat Microb Ecol 30:117125
119. Vrede K, Stensdotter U, Lindstrom ES (2003) Viral and
bacterioplankton dynamics in two lakes with different humic con-
tents. Microb Ecol 46:406415
120. Steward GF, Smith DC, Azam F (1996) Abundance and production
of bacteria and viruses in the Bering and Chukchi Seas. Mar Ecol
Prog Ser 131:287300
121. Bettarel Y, Sime-Ngando T, Amblard C, Dolan J (2004) Viral activity
in two contrasting lake ecosystems. Appl Environ Microbiol 70:
29412951