DNA COMPUTING

INTRODUCTION

1.1 Brief History

DNA Computer can store billions of times more information then your PC
hard drive and solve complex problems in a less time. We know that computer
chip manufacturers are racing to make the next microprocessor that will be faster.
Microprocessors made of silicon will eventually reach their limits of speeds.
The concept of DNA computing was born in 1993, when Professor
Leonard Adleman, a mathematician specializing in computer science and
cryptography accidentally found similarities between conventional computers and
DNA while reading a book by James Watson. In 1994, Leonard M. Adleman, a
professor at the University of Southern California, solved the famous
“Hamiltonian path” problem using DNA and it took seven days.
Three year after Adleman experiment, researchers at the University of
Rochester developed logic gates made of DNA. In electronic computation, logic
gates are essential to convert binary data into meaningful signals for performing
operations. The DNA logic gates detect specific fragments of genetic blueprint as
input and join these to form output.
Israeli scientists have built a DNA computer so tiny that a trillion of them
could fit in a test tube and perform a billion operations per second with 99.8%
accuracy.
Researchers from the Weizmann Institute of Science in Israel made a
programmable molecular computing machine composed of enzymes and DNA
molecules. The design is considered a giant step in this field.
The Guinness World Records recognized the computer as “the smallest
biological computing device” ever constructed. DNA computer is in its infancy
(childhood), and its implications are only beginning to be examined. But it could
transform the future of computers, especially in pharmaceutical and biomedical
applications.

1
 DNA COMPUTING

1.2 What is DNA computer?

A computer which has DNA molecule as the model of its construction is

known as DNA computer or we can say that DNA computer is collection of DNA
strands that have been specially selected to aid in the search of solutions for some
problems.
DNA base pairs can be translated into 0s and 1s and Boolean algebra can
be done with molecules. For example, “and” is done by separating DNA strands by
their sequence while “or” is performed by mixing two DNA solutions together.
Israeli scientists have devised a computer that can perform 330 trillion
operations per sec., more than 100,000 times of the fastest PC. In a different
perspective, more than 10 trillion DNA molecules can fit into an area no larger
than 1 cubic / cm. With this, a DNA computer could hold 10 terabytes of data and
perform 10 trillion of calculations at a time.

1.3 Why DNA computers?

A DNA computer would need just a few hours to analyze a flood of

information that would take today’s conventional computers hundreds of years to
solve.
The importance of DNA computer can be understood by knowing the
problems with the current semiconductor based technologies which are as follows:
• Higher power dissipation
• Don’t allow parallel processing
• Volatile memory
• Lower chip density
• Large in size
• Manufacturing difficulties
• Expensive

1.4 Can DNA compute everything?

2
 DNA COMPUTING

There are two fundamental questions, posed in Adleman’s article:

(1) What kind of problems can be solved by DNA computing?
(2) Is it possible, at least in principle, to design a programmable DNA
computer?
More precisely, one can reformulate the problems above as:
(1)Is the DNA model of computation computationally complete in the
sense that the action of any computable function (or equivalently, the computation
of any Turing machine) can be carried out by DNA manipulation?
(2) Does there exist a universal DNA system, i.e., a system that, given the
encoding of a computable function as an input, can simulate the action of that
function for any argument. (Here, the notion of function corresponds to the notion
of a program in which an argument w is the input of the program and the value f
(w) is the output of the program. The existence of a universal DNA system
amounts thus to the existence of a DNA computer capable of running programs.
Opinions differ as to whether the answer to these questions has practical
relevance. One can argue that from a practical point of view it maybe not that
important to simulate a Turing machine by a DNA computing device. Indeed, one
should not aim to fit the DNA model into the Procrustean bed of classical models
of computation, but try to completely rethink the notion of computation. On the
other hand, finding out whether the class of DNA algorithms is computationally
complete has many important implications. If the answer to it were unknown, then
the practical efforts for solving a particular problem might be proven futile at any
time. The same holds for the theoretical proof of the existence of a DNA computer.
As long as it is not proved that such a thing theoretically exists, the danger that the
practical efforts will be in vain is always lurking in the shadow. One more
indication of the relevance of the questions concerning computational
completeness and universality of DNA-based devices is that they have been
addressed for most models of DNA computation that have so far been proposed.
The existing models of DNA computation are based on various combinations of a
few primitive biological operations.

3
 DNA COMPUTING

ARCHITECHTURE OF DNA COMPUTER

2.1 What is DNA?
Every living thing such as person has DNA, and this DNA is the blueprint
used to build each and every living organisms. It determines everything from what
color of eyes the person will have to whether they will be predisposed to a certain
disease or not.
A DNA (Deoxyribose Nucleic Acid) molecule is a pair of interwined
parallel strands known as double helix. Each strand has a phosphate then a sugar
and then a base. The 4 bases (Adenine, Thymine, Guanine and Cytosine) are called
nucleotides; they are the key components for computing. They are known as
complementary molecules because every where that there is an A, there is a T
linked to it, as well as, everywhere there is a G, there is a C attached. Due to its
typical structure DNA can be used for computing.
The following is the picture of DNA and how it is bonded (Fig.1). There
are two chains linked together by weaker bonds. These chains are called strands. It
is sort of a ladder, but it is also twisted in a double helix pattern. It also illustrates
the weaker bonds containing complementary molecules by linking all of the C’s to
G’s and all of the A’s to T’s.

Fig.1 Structure of DNA.

4
 DNA COMPUTING

2.2 DNA Chip Technology

As is often the case with breakthrough technologies, a great deal of hyperbole has
surrounded the development of micro and nano array diagnostic technologies,
popularly known as DNA or genetic chips. Yet much of the optimism expressed in
such statements is almost certainly justified. Industry analysts agree that when their
promise begins to fulfilled probably sometime early in the next decade, DNA chips
will usher in a new era in medical care.
Although the DNA-chip marketplace is in its infancy, with considerable
challenges remaining to be overcome, the speed with which manufacturers are
progressing towards commercialization will soon make DNA chips viable
alternatives to traditional chemical assays. Indeed, if analysts are correct, within a
decade they will usher in a era in diagnosis and treatment for diseases and
conditions that have genetic origins.
Basic Principles
A variety of recent technological breakthroughs have made possible the
development of DNA chips. Fundamentally, however, genetic chips are the result
of achievements in two fields:
1) Molecular biology.
2) Micro fabrication technology.
Molecular Biology

• Especially as it has been catalyzed by the work of the Human Genome

Project (HGP), research in molecular biology has laid the groundwork for the
development of clinical laboratory tests and therapies involving genetic probes.
• Fundamental advances include the use of polymerase chain reaction
(PCR) or other amplification techniques to make copies of a nucleic acid sample,
which can then be tested using a genetic probe that is, a known gene and its
molecular structure.
• Also essential to the development of DNA chips has been the creation of
gene sequencers, machines that have automated the biochemical tests necessary to
identify genetic sequences using gene probes.

5
 DNA COMPUTING

• In 1950 Watson and Crick determined that the DNA molecules found in
living organisms are composed of a structure of two twisted strands (the
famous double helix) latticed together with pairs of nitrogenous
bases(A,T,C,G).
• They also discovered that these bases always recur in the same two pairs:
Adenine with Thymine, and Cytosine with Guanine. Thus, by knowing
part of the molecular structure of a specific genetic segment, one can
determine the other part.
• Moreover, these uniquely complementary strands of DNA can be sought
out by using one of the strands to test for its biochemical mate; this is the
basis of a gene probe.
• The process of one strand of DNA matching up with its counterpart strand
is called hybridization. It is this technique that is used to determine a
base-pair sequence in a DNA sample, also called genetic sequencing.
• Hybridization can be performed either in solution or on a solid support.
• In traditional gene sequencing, the most common format for hybridization
is the Southern blot, which uses a nitrocellulose sheet. However, some
companies use solution-based processes, and there is considerable
experimentation in the field to develop new hybridization formats.
• DNA-chip manufacturers are also exploring variations of both solid-phase
and solution-based hybridization for use in their microassays. At present,
however, most DNA-chip companies use a solid-phase technique.
• DNA chips are designed to identify hybridization products in the same
fashion as with traditional sequencers. Once hybridization has been
completed, phosphorescent chemicals that bind to the hybridized
sequences are scanned with a light source, making it easy to detect their
presence with automated colorimetric or fluorimetric equipment.

6
 DNA COMPUTING

How Genetic Sequencing Works?

Sequencing, the process of finding the molecular structure of a DNA fragment,

employs the Watson-Crick rules of hybridization, whereby each strand of DNA
can bond only to a chemical mirror image via two sets of four bases: adenine (A),
cytosine (C), guanine (G), and thymine (T).

Step 1: Determine chemical structure of fragment.

Representing all or part of a DNA strand of interest, short fragments of

DNA (typically involving 5–25 base pairs) are identified.

Step 2: Separate strands.

DNA is denatured (separated) and placed in solution or on a

solid substrate, forming a reference segment for the DNA
fragment of interest.

Step 3: Introduce sample.

Unknown DNA sample is introduced to the reference segment. If

present, the complement of the reference segment will hybridize (bond)
to it.

7
 DNA COMPUTING

Step 4: Identify result.

Chemicals that bond to successful hybridization help researchers

identify results. Such chemicals are typically photosensitive
(fluorescent or chemiluminescent), which helps researchers confirm
results.

Micro fabrication Technologies

• The second technological trend that is making DNA-chip products possible

encompasses the steady improvements in nano- and microscale fabrication
techniques.
• Developed initially for use in computer chip manufacturing, these
techniques are now being exploited in a variety of other disciplines,
including DNA-chip manufacturing.
• These achievements have made possible the application of organic
structures (e.g., segments of DNA and reagents) onto a substrate of
inorganic materials. Unlike computer chips, which use silicon-based
wafers, DNA microassays are fabricated onto glass or plastic wafers or are
placed in tiny glass tubes and reservoirs.
• Although the fundamental principles of molecular biology apply to the
design of all DNA chips currently under development or commercially
available, approaches to the fabrication of substrates for such products
vary considerably.
• While some developers use manufacturing techniques very similar to those
used in computer chip fabrication, others are exploring techniques very
different from semiconductor manufacturing.
• At the computer chip end of that continuum is the approach taken by such
companies as Affymetrix (Santa Clara, CA).

8
 DNA COMPUTING

• To produce its Genechip line of products, Affymetrix bonds hundreds of

genetic sequences onto the surface of a microchip using photolithographic
processes such as

1) photosensitive masks,

2) chemical doping layers,

3) and other techniques used in computer chip fabrication.

2.3 How DNA Chips Are Made?

Step 1: Make gene probes.

Using conventional
techniques such as
polymerase chain reaction
and biochemical synthesis,
strands of identified DNA
are made and purified. A
variety of probes are
available from commercial
sources, many of which also
offer custom production
services.

Step 2: Manufacture substrate wafer.

Companies use photolithography and other nanomanufacturing

techniques to turn glass and plastic wafers into receptacles for
the DNA probes.

Step 3: Deposit genetic sequences.

Manufacturers use a variety of processes ranging from

electrophoretic bonding to robotic deposition to adhere
genetic material to the substrate. Cleanroom conditions and
standards must be observed to attain the degree of
contamination control needed during the deposition process.

9
 DNA COMPUTING

Step 4: Customer use.

Completed chips are checked for quality, packaged, labeled, and sent to clients. In
use, chips enable researchers to identify the components of probes deposited on the
chips, usually with the help of phosphorescent tags.

• Using a series of photolithographic masks to define chip exposure sites,

followed by specific chemical synthesis steps, the process constructs high-
density arrays of oligonucleotides, with each probe occupying a predefined
position in the array. Multiple probe arrays are synthesized simultaneously
on a large glass wafer. This parallel process enhances reproducibility and
helps achieve economies of scale.
• The wafers are then diced, and individual probe arrays are packaged in
injection-molded plastic cartridges, which protect them from the
environment and serve as chambers for hybridization.
• Another manufacturing approach involves the deposition of gene probes
onto the chip substrate using a tiny droplet sprayer that resembles an ink-
jet printer.
• This approach is being used by Combion (Redwood City, CA), Rosetta
(Seattle), ProtoGene Laboratories (Palo Alto, CA), and Affymetrix. (Two
of these firms illustrate the heavy involvement of higher education in this
emerging field; Combion was created from research conducted at the
California Institute of Technology, while Rosetta uses techniques
developed at the University of Washington.) Manufacturers spray a
chemical solution containing the gene probes in a pattern onto the chip
substrate, in the same fashion as in other clinical lab tests.
• Some companies, such as Nanogen (San Diego), use robots to deposit the
gene probes onto the substrate. Nanogen uses electrophoresis to speed up
hybridization.

10
 DNA COMPUTING

• Yet another approach is the use of gels in a solution-based process.

Scientists at the Argonne National Laboratory (Argonne, IL) hope to find
commercial backing for this approach within the next two years.
• Thus, the concept behind DNA chips is simply that of miniaturizing the
gene sequencing technologies already being developed, so that many assays
and their related procedures can be performed together.
• DNA chips will give researchers the ability to analyze thousands of genes
at once, and may also make it possible to conduct very elaborate diagnostic
procedures in such small settings as a physician's office or even with
mobile equipment used at the point of care.

2.4 Storage Structure and Memory Organization

• Nucleic Acids are used because of density, efficiency and speed.

DNA molecules can store more information than existing silicon
chips. DNA computing is a far denser packing of molecular
information compared with silicon-based computers.
• The data density of DNA is impressive. Just like a string of binary
data is encoded with 0’s and 1’s, a strand of DNA is encoded with
four bases represented by the letters A, T, C & G.
• The bases (or nucleotides) are spaced every 0.35 nanometers along
the DNA molecule, giving DNA a remarkable data density of nearly
18 Mbits per inch.
• A single bacterium cell measures just a micron square – about the
same size as a single silicon transistor – but holds more than a
megabyte of DNA memory and has all the computational structures
to sense and respond to its environment.

• In two dimensions, if you assume one base per square nanometer,

the data density is over one million Gbits per square inch. Compare

11
 DNA COMPUTING

this to the data density of a typical high performance hard drive

which is about 7 Gbits per square inch – a factor of over 100,000
smaller.
• A gram of DNA can hold as much information as a trillion CDs.
• DNA molecules would be like mega-memory.
• In a biochemical reaction hundreds o DNA molecules can operate in
parallel. DNA computers could store a bit, 0 or 1, of data in one
cubic nanometer, one trillionth the size of the conventional
computer’s electronic storage.
• A square centimeter of silicon can currently support around a
million of transistors, whereas current manipulation techniques can
handle to the order of 10^20 strands of DNA.
• Thus a DNA computer could store massive quantities of
information in the space a standard computer would use to store
much less.
• One day the limit comes when, silicon chips can’t be scaled down
much further, the DNA molecule found in the nucleus of all cells
can hold more information in a cubic centimeter then a trillion
music CDs.

12
 DNA COMPUTING

OPERATIONS ON DNA

A single strand of DNA can be likened to a string consisting of a

combination of four different symbols: A, G, C, T. Mathematically, this means we
have at our disposal a 4 letter alphabet ∑ = {A, G, C, T} to encode information,
which is more than enough, considering that an electronic computer needs only
two digits, 0 and 1, for the same purpose.
As concerning the operations that can be performed on DNA strands, the
proposed models of DNA computation are based on various combinations of the
following primitive bio-operations. The bio-operations listed below, and possibly
others, will then be used to write “programs”. A “program” will receive a tube
containing DNA strands encoding information as input, and return as output either
“yes” or “no” or a set of tubes. A bio-computation will consist of a sequence of
bio-operations performed on tubes containing DNA strands.

1. Merge - This is the simple operation of combining the contents of 2 test tubes in
a third test tube.

2. Anneal - This is the process by which 2 strands are paired to form the famous
double-helix structure of Watson and Crick. Annealing is achieved by cooling a
DNA solution, which encourages pairing. Adleman uses this in step 1 to generate
all legal paths through the graph.

3. Melt - Melting is inverse operation of annealing. By heating the contents of a

tube, double-stranded sequences are denatured, or separated into its 2 single-
stranded parts.

4. Seperation by length - Content of the test tube can be separated by increasing

the length. This is achieved by electrophoresis, whereby longer strands travel more
slowly through the gel. This operation was used by Adleman in step 3 of his
solution to H.P.

13
 DNA COMPUTING

5. Seperation by sequence - This operation allows one to remove from solution all
the DNA strands that contain a desired sequence. This newly generated strand is
attached to the magnetic substance, which is used to extract the sequences after
annealing. This operation is crux of Adleman’s step 4.
6. Copying / Amplification - Copies are made of DNA strands in a test tube. The
strands to be copied must have known sequences at both the beginning and end in
order for this operation to be performed.

7. Append - This operation makes the DNA strand longer by adding a character or
strand to the end of each sequence.

8. Detect - It is also possible to analyze test tube in order to determine whether or

not it contains at least one strand of DNA.

This operation, for example, is the last in Adleman’s algorithm where we

attempt to find a DNA sequence that has survived the previous steps.

14
 DNA COMPUTING

HOW DNA COMPUTER WILL WORK?

DNA is the major information storage molecule in living cells, and billions
of years of evolution have tested and refined both this wonderful informational
molecule and highly specific enzymes that can duplicate information in DNA
molecules or transmit this information to other DNA molecules.
Instead of using electrical impulses to represent bits of information, the
DNA computer uses chemical properties of these molecules by examining the
patterns of combination or growth of the molecules or strings. DNA can do this
through the manufacture of the enzymes, which are biological catalysts that could
be called the ‘software’ used to execute the desired calculation.
A DNA computer uses the 4 deoxyribonucleic acids:
A (adenine)
C (cytosine)
G (guanine)
T (thymine)
as the memory units and recombinant DNA techniques already in
existence carry out the fundamental operations.
• In a DNA computer, computation takes place in test tubes or on a
glass slide coated in 24k gold.
• The input and output both are strands of DNA, whose genetic
sequences encode certain information.
• A program on a DNA is executed as a series of biochemical
operations, which have the effect of synthesizing, extracting,
modifying and cloning the DNA strands.
• Their potential power underscores how nature could be capable of
crunching number better and faster than the most advanced silicon
chips.

15
 DNA COMPUTING

• The study of bacteria has shown that restriction enzymes can be

employed to cut DNA at a specific word (W). Many restriction
enzymes cut the 2 strands of double-stranded DNA at different
positions leaving overhangs of single-stranded DNA. Two pieces of
DNA may be rejoined if their terminal overhangs are
complementary. Complements are referred to as ‘sticky ends’.
Using these operations, fragments of DNA may be inserted or
deleted from the DNA.
• As stated earlier DNA represent information as a pattern of
molecules on a strand. Each strand represents one possible answer.
• In each experiment, the DNA is tailored so that all conceivable
answers to a particular problem are included. Researchers then
subject all the molecules to precise chemical reactions that imitate
the computational abilities of a traditional computer. Because
molecules that make up DNA bind together in predictable ways, it
gives a powerful “search” function.
• If the experiment works, the DNA computer weeds out all the
answers, leaving one molecule or more with the right answer.
• All these molecules can work together at once, so you could
theoretically have 10 trillion calculations going on at the same time
in very little space.
• DNA computing is a field that holds the promise of ultra-dense
systems that pack megabytes of information into devices the size of
a silicon transistor. Each molecule of DNA is roughly equivalent to
little computer chip.

16
 DNA COMPUTING

FEATURES OF DNA COMPUTER

• Size and Storage Density

The data density of DNA is impressive The information density could go
up to 1 bit/nm^3.
• Speed
Although the elementary operations (electrophoretic separation, ligation,
PCR-amplification) would be slow compared to electronic computers, their
parallelism would strongly prevail, so that in certain models the number of
operations per second could be of the order of 10^18, which is at least 1,00,000
times faster than the fastest supercomputer existing today.
• Energy Efficiency
DNA computers can perform 10^19 operations per Joule. This is about a
billion times more energy-efficient than today’s electronic device.
The enzyme Foci breaks bonds in the DNA double helix, causing the
release of enough energy for the system to be self-sufficient.
• Pharmaceutical and Biomedical field
Perhaps more importantly, DNA computing devices could revolutionize the
Pharmaceutical and Biomedical fields. Some scientists predict a future where our
bodies are patrolled by tiny DNA computers that monitor our well-being and
release the right drugs to repair damaged or unhealthy tissue.
“Autonomous Biological computers may be able to work as ‘Doctors in a
Cell’, operating inside living cells and sensing anomalies in the host.
• High Parallelism
The advantage of the DNA approach is that it works in “Massive
Parallelism,” processing all possible answers simultaneously. Transistor-based
computers typically handle operations in sequential manner. An electronic
computer can analyze only one potential answer at a time. Problems that have
many possible answers can take a long time to solve, even for supercomputers that
contain hundreds of electronic processors operating in parallel. Specifically, on the
order of 10^9 calculations per ml of DNA per second!

17
 DNA COMPUTING

ADLEMAN’S HAMILTONIAN PATH

PROBLEM

In 1994, Leonard M. Adleman solved an unremarkable computational

problem with a remarkable technique using DNA. It was a landmark demonstration
of computing on the molecular level.
The Adleman experiment
Suppose that I live in LA, and need to visit four cities: Houston, Chicago, Miami,
and NY, with NY being my final destination. The airline I’m taking has a specific
set of connecting flights that restrict which routes I can take (i.e. there is a flight
from L.A. to Chicago, but no flight from Miami to Chicago). What should my
itinerary be if I want to visit each city only once?

It should take you only a moment to see that there is only one route.
Starting from L.A. you need to fly to Chicago, Dallas, Miami and then to N.Y.
Any other choice of cities will force you to miss a destination, visit a city twice, or

Los Angeles GCTACG

Chicago CTAGTA
Dallas TCGTAC
18
Miami CTACGG
New York ATGCCG
 DNA COMPUTING

not make it to N.Y. For six, seven, or even eight cities, the problem is still
manageable. However, as the number of cities increases, the problem quickly gets
out of hand. Assuming a random distribution of connecting routes, the number of
itineraries you need to check increases exponentially.
Adleman accomplished this task with standard molecular biology
techniques as follows:
Part I: Generate all possible routes
Strategy: Encode city names in short DNA sequences. Encode itineraries
by connecting the city sequences for which routes exist.
DNA can simply be treated as a string of data. For example, each city can
be represented by a "word" of six bases.
The entire itinerary can be encoded by simply stringing together these
DNA sequences that represent specific cities. For example, the route from L.A ->
Chicago -> Dallas -> Miami -> New York would simply be
GCTACGCTAGTATCGTACCTACGGATGCCG, or equivalently it could be
represented in double stranded form with its complement sequence.
So how do we generate this? Synthesizing short single stranded DNA is
now a routine process, so encoding the city names is straightforward. The
molecules can be made by a machine called a DNA synthesizer or even custom
ordered from a third party. Itineraries can then be produced from the city
encodings by linking them together in proper order. To accomplish this you can
take advantage of the fact that DNA hybridizes with its complimentary sequence.
For example, you can encode the routes between cities by encoding the
compliment of the second half (last three letters) of the departure city and the first
half (first three letters) of the arrival city. For example City Encoding = Miami
(CTACGG) and NY (ATGCCG)
Route Encoding = CGG + ATG = CGGATG
Taking Complement we get route from Miami to NY = GCCTAC
This will connect the DNA representing Miami and NY by hybridizing itself to
Miami (...CGG) and NY (ATG...) as shown below:

19
 DNA COMPUTING

Random itineraries can be made by mixing city encodings with the route
encodings. Finally, the DNA strands can be connected together by an enzyme
called ligase. What we are left with are strands of DNA representing itineraries
with a random number of cities and random set of routes. For example:

We can be confident that we have all possible combinations including the

correct one by using an excess of DNA encodings, say 10^13 copies of each city
and each route between cities. Remember DNA is a highly compact data format, so
numbers are on our side.

Part II: Select itineraries that start and end with the correct cities
Strategy: Selectively copy and amplify only the section of the DNA that
starts with LA and ends with NY by using the Polymerase Chain Reaction.
After Part I, we now have a test tube full of various lengths of DNA that
encode possible routes between cities. What we want are routes that start with LA
and end with NY. To accomplish this we can use a technique called Polymerase
Chain Reaction (PCR), which allows you to produce many copies of a specific
sequence of DNA. We can amplify exponentially the number of DNA strands in
the test tube that start with LA and stop with NY using this technique.

Part III: Select itineraries that contain the correct number of cities.

20
 DNA COMPUTING

Strategy: Sort the DNA by length and select the DNA whose length
corresponds to 5 cities.
Our test tube is now filled with DNA encoded itineraries that start with LA
and end with NY, where the number of cities in between LA and NY varies. We
now want to select those itineraries that are five cities long. To accomplish this we
can use a technique called Gel Electrophoresis, which is a common procedure used
to resolve the size of DNA. The basic principle behind Gel Electrophoresis is to
force DNA through a gel matrix by using an electric field. DNA is a negatively
charged molecule under most conditions, so if placed in an electric field it will be
attracted to the positive potential. However since the charge density of DNA is
constant (charge per length) long pieces of DNA move as fast as short pieces when
suspended in a fluid.

Part IV: Select itineraries that have a complete set of cities

Strategy: Successively filter the DNA molecules by city, one city at a time.
Since the DNA we start with contains five cities, we will be left with strands that
encode each city once.
DNA containing a specific sequence can be purified from a sample of
mixed DNA by a technique called affinity purification. This is accomplished by
attaching the compliment of the sequence in question to a substrate like a magnetic
bead.

21
 DNA COMPUTING

The beads are then mixed with the DNA. DNA, which contains the
sequence you're after then hybridizes with the complement sequence on the beads.
These beads can then be retrieved and the DNA isolated.

So we now affinity purify fives times, using a different city complement for
each run. For example, for the first run we use L.A.'-beads (where the ' indicates
compliment strand) to fish out DNA sequences which contain the encoding for
L.A. (which should be all the DNA because of step 3), the next run we use Dallas'-
beads, and then Chicago'-beads, Miami'-beads, and finally NY'-beads. The order
isn’t important. If an itinerary is missing a city, then it will not be "fished out"
during one of the runs and will be removed from the candidate pool. What we are
left with are the are itineraries that start in LA, visit each city once, and end in NY.
This is exactly what we are looking for. If the answer exists we would retrieve it at
this step

22

COMPARISON
DNA Computer
A computer, which has DNA molecule
as the model of its construction is called
DNA computer.
It allows Parallel processing.
Permanent Memory.
Higher Chip density, so it can handle
to the order of 10^20 strands of DNA
per square centimeter.
Speed, Because of parallelism, the
number of operations per second could
be of the order 10^18.
Lower Power dissipation, DNA
computers can perform 10^19
operations per joule. This is about a
billion times more energy-efficient than
today’s device.
Cost, It would be cheaper &
Manufacturing could be easier
compared to the computers existing
today.
DNA COMPUTING
Traditional Computer
A computer, which has Silicon
molecule as the model of its
construction is called Traditional
computer.
Don’t allow Parallel processing.
Volatile Memory.
Lower chip density, means square
centimeter of Silicon can currently
support around a million transistors.
Lower Speed compared to DNA
computer, which is at least 1, 00,000
times slower than DNA computer.
Higher power dissipation.
Expensing & Manufacturing difficulties
are there in producing certain kind of
computers, compared to the DNA
computer.
23
 DNA COMPUTING

ADVANTAGES & DISADVANTAGES

Advantages
• Parallelism – The speed of any computer, biological or not, is
determined by 2 factors: 1) number of parallel processes. 2) How
many steps each one can perform per unit time. A small amount of
water contains about 10^22 molecules. Thus, biological
computations could potentially have vastly more parallelism than
conventional ones.
• Gigantic Memory Capacity – The bases of DNA molecules are
spaced every 0.34 nanometers along the DNA molecule (Fig.1)
giving DNA a remarkable data density of nearly 18 Mbits per inch.
• Low Power Dissipation – “Biochemical operations dissipate so
little energy”. DNA can perform 2 x 1019 ligation operations per
joule.
• Suitable for Combinatorial Problems – After Adleman, Lipton
used DNA computer to break Data Encryption Standard(DES). N-
Queens problem is also solved.
• Generate a complete set of complete solutions.
• As long as there are cellular organisms, there will always be a
supply of DNA.
• Unlike the toxic materials used to make traditional microprocessors,
DNA biochips can be made cleanly.
• DNA computers are many times smaller than today’s computers.
Disadvantages
• Occasionally slow- When people use DNA to solve complex problems
more and more laborious separation and detection steps are required. But
these problems may be overcome by using autonomous methods of DNA
computation which executes multiple steps of computation without outside
intervention.

24
 DNA COMPUTING

• Hydrolysis-DNA molecules can break or fracture by time (dissolve into

water), and can deteriorate resulting in error prone DNA manipulations.
And recovering DNA and utilizing it again is not an easy task.
• Information Untransmittable-There is problem in information
transmission from one molecule to another. Current DNA algorithms
compute successfully without passing any information, but this limits their
flexibility.
• Reliability problems-There are variety of errors that can come along
experimentation. Typical errors are annealing errors, errors in PCR, errors
during affinity separation (Purification).

25
 DNA COMPUTING

APPLICATIONS

• Massively Parallel Processing-Basically any problem that can be turned

into a Hamiltonian problem and other complex problems can be solved.
• Storage and Associative Memory-A truly content addressable memory
occurs when a data entry can be directly retrieved from storage by entering
an input that most closely resembles it over other entries in memory. This
contrasts with a conventional computer memory, where the specific address
of a word must be known to retrieve it.
• DNA computers could fight cancer-New computers made of biological
molecules that react to DNA hold the promise to diagnose and treat
diseases such as cancer by operating like doctors inside the body, Israeli
scientists said.
• DNA2DNA Applications-Another area of DNA computation exists where
conventional computers clearly have no current capacity to compete. This
is the concept of DNA2DNA computations such as DNA sequencing; DNA
fingerprinting; DNA mutation detection or population screening; and Other
fundamental operations on DNA.
• Implications to Biology, Chemistry, and Medicine-A particular area
within the natural and applied sciences that may benefit from advances in
DNA computation is combinatorial chemistry.
• DNA's Role in Computer Science- DNA based computers may postpone
certain expected thermodynamic obstacles to computation as well as
exploring the limitations of Turing machines and questioning theories of
computation based on electronic and mechanical models.
• This can be quite useful in figuring out how to route telephone calls, plane
trips.
• It is also been claimed that DNA can be used to solve optimization
problems involving business management.

26
 DNA COMPUTING

• It is even said that DNA can be used in devising the wiring schematics for
circuits. Another application being mentioned nowadays at the review
session is that DNA computing can do cryptography.
• DNA computers can be used to control chemical and biological systems in
a way that’s analogous to the way we use electronic computers to control
electrical and mechanical systems.

27
 DNA COMPUTING

CURRENT RESEARCH IN DNA

COMPUTING

Organization Focus

Fabricating DNA motors for assembling electronic

Bell Labs
components

Duke
University/Cal Working on massively parallel addition using DNA tiles
tech

New York
Assembling complex nanostructures out of DNA
University

University of Automating a self-contained lab system for DNA computing;

Southern proved, in theory, that DNA can crack DES data encryption
California standard

University of Adapting DNA-chip technology to do DNA computation on a

Wisconsin solid surface

28
 DNA COMPUTING

FUTURE SCOPE

It’s different way of thinking about computing. It’s different way of thinking about
chemistry,” says Dr. Corn, a chemistry professor at the University of Wisconsin at
Madison who is collaborating on a DNA-computer project with three other
Madison faculty members: Lloyd M. Smith, a chemistry professor, Max G.
Lagally, a materials-science professor, and Anne E. Condon, a computer science
professor.
The Wisconsin approach would use the gold-plated square of glass as
something akin (related blood) to a conventional memory chip. As many as a
trillion individual strands of DNA would be anchored (fixed firmly) to the glass,
each strand containing information being stored in the DNA computer.
A rival approach, pioneered by Leonard M. Adleman allows the bits of
DNA to float freely in a test-tube. Dr. Adleman, in 1994 solved the traveling
salesman problem using his test-tube approach. The TSP on a large scale is
effectively unsolvable by conventional computer systems (it’s theoretically
possible, but would take an extremely long time).
His work was picked up by Dr. Donald Beaver, among others, who
analyzed the approach and organized it into a highly accessible web page which
includes concise annotated bibliography. One major contributor to this page is the
research group of Dr. Richard Lipton, Dan Bonech and Christopher Dunworth-a
professor of computer science and two graduate students at Princeton University.
They are currently using a DNA computer to break the government’s DES.
In Lipton’s article speeding up computation via molecular biology he
shows how DNA can be used to construct a Turing machine, a universal computer
capable of performing any calculation. While it currently exists only in theory, it’s
possible that in years to come computers based on work of Adleman, Lipton, and
others will come to replace traditional silicon-based machines.
In other words of Dr. Goodman “it’s clearly theoretically possible,” “the
question is whether the chemical operations can actually be done with a low-
enough error frequency. In my opinion this can be achieved.”

29
 DNA COMPUTING

5.1 Goals
5.1.1 Short-term goals
Some of the short term goals of the DNA computing research are:
1) Test the bio-operations used in Adleman’s experiment for usability under other
conditions and for other computational problems.
2) Test other molecular procedures potentially useful for DNA computing ligation,
restriction enzyme digestion, and nuclease digestion on immobilized substrates, for
applicability, implementability, scalability, error robustness, cost and possibility of
automatisation.
3) Search for other types of problems that can potentially be solved by DNA
computing Preference will be given to problems that have practical applications,
for example scheduling problems, DNA memories and robotics or weather
prediction.
5.1.2: Long-term goals
Some of the longer term goals of DNA computing research are:
1) Evaluate existing models of DNA computing from the point of view of their in-
vitro implementability.
2) Design a viable DNA computability model based on operations specific to DNA
processing.
3) Study the computational aspects of the designed model. In particular, compare
the model with existing models of computability especially Turing machines and
Chomsky grammars.
4) Define and study computational complexity, biological complexity and
implementability measures for DNA computing.
5) Search for primitive bio-operations necessary for describing a molecular high-
level language. A population of DNA sequences is a set of strings; therefore these
operations should include basic set operations, string operations and some control
operations. The operations should be easily implementable and easy to automatize
and it should be possible to combine them in order to form instructions for solving
a large class of problems.

30
 DNA COMPUTING

5) Optimize “molecular procedures” that accomplish the bio-operations above. For

example, it is conceivable that one would need basic set operations like generate
all the subsets with k elements of a given set and language theoretic operations like
concatenate two strings or generate all the strings of a given length over a given
alphabet
7) Automate as far as practical the procedures above.
8) Develop new problem-solving tools and programming techniques suited for
computation with bio-molecules.

5.2 Will DNA computing replace electronic computing?

One of the most debated theoretical issues is whether a DNA computer will
outperform and finally replace the electronic computer in all practical applications,
or whether there will be only special classes of applications for which DNA
computers will be preferred. DNA is an attractive medium for computation
because of its potential parallelism resulting from the possibility of having up to
1018 bytes represented in a single test tube of DNA solution. Also attractive is its
high information storage density of 1023 bytes per kilogram, which dwarfs the
human genome, 109 bytes. These features make it tempting to conjecture that a
DNA computer will be faster and more efficient than an electronic one, no matter
what the application. While this might be the case, the following suggests that
perhaps we should not expect it to be so, even in theory.
To draw a parallel, in many realms of life, where the processing of large
amounts of data quickly, efficiently and in parallel is involved, humans outshine
the fanciest computers. Example of such situations are our daily social encounters
of persons, when the computers inside our skulls evaluate, in a split-second, data
fed by our sense organs about their shape, size, color, sound, smell, posture,
movement and expression. The information is then processed at lightning speed
and out comes the answer, friend or stranger, to smile or not to smile, to touch or
not to touch.

31
 DNA COMPUTING

The most modern electromechanical robots pale in comparison, having

difficulties even in processing the parallel sensory input necessary for moving in a
less-than-clumsy fashion, let alone in socializing. On the other hand, when faced
with the task of adding up 1000000 fifty-digit
Numbers, an electronic computer will outperform the human brain anytime.
The comparison suggests that perhaps we should not expect the DNA
computer to completely replace an electronic computer. Those problems, whose
algorithms can be highly parallelized, could possibly become the domain of DNA
computers, while the ones whose algorithms are inherently sequential might
remain the specialty of electronic computers. Indeed, the search of a “killer”
application, that is, an application for which the DNA based solution has obvious
advantages over the electronic one, is one of the main directions of research in the
area. Along with it, substantial effort is being invested in testing the bio-operations
for implementability, and in finally choosing a set of “primitives” that will form
the basics of a molecular high level programming language. Last, but not least, it is
expected that the experimental work of probing the limits of biomolecular
computation will lead to insights into the information handling capacities of
cellular organisms.
5.3 Applications to Biology, Chemistry and Medicine
Recently, Bartel and Szostak used the methods of combinatorial chemistry
to make a pseudo-enzyme. The goal of their experiment was to find a molecule of
RNA which would ligate two substrate molecules of RNA. They used a pool of
approximately 4^25 random sequences of RNA to ligate the two substrate
molecules, and after isolating the product of the reaction, they were able to
sequence the pseudo-enzyme.
The applications of combinatorial chemistry go far beyond this one
example. In the above example, the pseudo-enzyme remained bound to the
product, making it easy to isolate, but combinatorial chemistry can also be used
when anchoring is not physically possible.
Protocols have been proposed to find an RNA molecule that truly catalyzes
(as an enzyme) the ligation of two DNA molecules.

32
 DNA COMPUTING

This sort of detection can also be used to isolate an endonuclease, or to find a drug
which crosses a cell membrane and then binds a particular host membrane, and
therefore cannot be anchored.

5.4 An Example of DNA Computing to solve a common problem

A computer built from DNA can be used to solve the typical N-Queen
problem. List all the possible arrangements of N number of queens on an N * N
chessboard so that no queen is threatening another.
Let us start with a sixteen-square board, for which there are 1820 possible
arrangements.
To represent these arrangements, let us consider a DNA molecule with 16
unique 15-nucleotide sequences, separated by short spacers. Each sequence
encodes the state-"queen on" or "queen off"--for one of the sixteen squares, along
with information specifying which square it refers to.
1 2 3 4

5 6 7 8

9 10 11 12

13 14 15 16

This means that the 15-nucleotide representing a queen in position 1, for

example, is different from the sequence for a knight in position 2. Having unique
sequences for each position is the key to the computer.
To operate the computer, start with DNAs representing all 1820 possible
arrangements of queens. Then pool these DNAs and divide the pool into two
samples.
In one, destroy all the molecules in which position 1 was "on" by adding a
complementary 15-nucleotide DNA strand, which sticks to the targeted DNA
sequence. Then they add an enzyme which chews up DNA hybrids but leaves
normal DNA alone.

33
 DNA COMPUTING

In the other, also destroy all the molecules in which either position 2, 3, 4,
5, 9, 13, 6, 11 or position 16 was on--the positions from which a queen can attack
square 1. The remixed pool represents chessboards in which space 1 is empty
whenever a queen is present in either space 2, 3, 4, 5, 9, 13, 6, 11 or 16.
After repeating the same operation with every other pair of mutually
exclusive board positions, analyze what is left. The molecules if chosen at random
will include possible solutions.
Although such devices are unlikely to out compete silicon in computations
such as the N-Queens problem, a more likely application, would be in game theory
algorithms, which involve selecting optimum strategies from a vast range of
possibilities.

34
 DNA COMPUTING

CONCLUSION

DNA computers are the best alternatives of the conventional semiconductor

based computers. They will have large capacity of storage and very low power
consumption. Also they will be very cheaper, easier to manufacture and always
available. And the most important thing is that they will be massively parallel
computers capable of solving complex problems.

35
 DNA COMPUTING

BIBLIOGRAPHY

• http://www.arstechnica.com/reviews/2q00/dna/

• http://computer.howstuffworks.com/dna-computer.html

• http://www.cs.princeton.edu/~dabo/biocomp.html

• http://www.sciencemail@upi.com/

• http://hagi.is.s.u-tokyo.ac.jp/MCP/

• http://www.devicelink.com/ivdt/archive/98/09/009.html

• http://www.wired.com/news/news

36