JOURNAL OF BACTERIOLOGY, Nov. 2007, p. 7709–7719 Vol. 189, No.

21
0021-9193/07/$08.00⫹0 doi:10.1128/JB.00864-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Corynebacterium diphtheriae: Identification and Characterization of a

Channel-Forming Protein in the Cell Wall䌤
Bettina Schiffler,1† Enrico Barth,1† Mamadou Daffé,2 and Roland Benz1*
Lehrstuhl für Biotechnologie, Biozentrum der Universität Würzburg, D-97074 Würzburg, Germany,1 and Institut de Pharmacologie et
Biologie de Structurale, Centre National de la Recherche, Scientifique/Université Paul Sabatier (UMR 5089),
F-31077 Toulouse Cedex 04, France2
Received 4 June 2007/Accepted 10 August 2007

The cell wall fraction of the gram-positive, nontoxic Corynebacterium diphtheriae strain C8r(ⴚ) Toxⴚ (ⴝ
ATCC 11913) contained a channel-forming protein, as judged from reconstitution experiments with artificial
lipid bilayer experiments. The channel-forming protein was present in detergent-treated cell walls and in

Downloaded from http://jb.asm.org/ on January 2, 2018 by guest

extracts of whole cells obtained using organic solvents. The protein had an apparent molecular mass of about
66 kDa as determined on Tricine-containing sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels
and consisted of subunits having a molecular mass of about 5 kDa. Single-channel experiments with the
purified protein suggested that the protein formed channels with a single-channel conductance of 2.25 nS in
1 M KCl. Further single-channel analysis suggested that the cell wall channel is wide and water filled because
it has only slight selectivity for cations over anions and its conductance followed the mobility sequence of
cations and anions in the aqueous phase. Antibodies raised against PorA, the subunit of the cell wall channel
of Corynebacterium glutamicum, detected both monomers and oligomers of the isolated protein, suggesting that
there are highly conserved epitopes in the cell wall channels of C. diphtheriae and PorA. Localization of the
protein on the cell surface was confirmed by an enzyme-linked immunosorbent assay. The prospective homol-
ogy of PorA with the cell wall channel of C. diphtheriae was used to identify the cell wall channel gene, cdporA,
in the known genome of C. diphtheriae. The gene and its flanking regions were cloned and sequenced. CdporA
is a protein that is 43 amino acids long and does not have a leader sequence. cdporA was expressed in a C.
glutamicum strain that lacked the major outer membrane channels PorA and PorH. Organic solvent extracts
of the transformed cells formed in lipid bilayer membranes the same channels as the purified CdporA protein
of C. diphtheriae formed, suggesting that the expressed protein is able to complement the PorA and PorH
deficiency of the C. glutamicum strain. The study is the first report of a cell wall channel in a pathogenic
Corynebacterium strain.

The suborder Corynebacterineae belongs to a distinctive
suprageneric actinomycete taxon, the mycolata, which also in-
cludes the mycobacteria, nocardiae, rhodococci, and closely
related genera. These bacteria share with corynebacteria the
property of having an unusual cell envelope composition and
architecture (19). They have a thick peptidoglycan layer, which
is covered by lipids in form of mycolic acids and other lipids (5,
26, 54). The mycolic acids are covalently linked through ester
bonds to the arabinogalactan attached to the murein of the cell
wall (45). The chain lengths of these 2-branched, 3-hydroxy-
lated fatty acids vary considerably within the mycolic acid-
containing taxa. Long mycolic acids have been found in myco-
bacteria, but the mycolic acids are short in corynebacteria (22
to 38 carbon atoms) (13, 20, 29, 45, 46, 76). The cell walls of
corynebacteria and closely related genera are very similar to
those of mycobacteria, especially in terms of ultrastructure and
cell wall chemical composition (4, 44, 69). This means that the
cell wall of a member of the mycolata forms a permeability
barrier and probably has the same function as the outer mem-
brane of gram-negative bacteria, which contains channel-form-
* Corresponding author. Mailing address: Lehrstuhl für Biotech-
nologie, Biozentrum der Universität Würzburg, Am Hubland, D-97074
Würzburg, Germany. Phone: 49-(0)931-888-4501. Fax: 49-(0)931-888-
4509. E-mail: roland.benz@mail.uni-wuerzburg.de.
† B.S. and E.B. contributed equally to this paper.
䌤
Published ahead of print on 24 August 2007.
ing proteins, the porins, for the passage of hydrophilic solutes
(8, 9, 31, 50, 51, 52, 53). Analogous to the situation in the outer
membrane of gram-negative bacteria, channels for the passage
of hydrophilic compounds are present in the mycolic acid layer
of the mycobacterial cell wall and the cell wall of Corynebac-
terium glutamicum (17, 18, 30, 38, 41, 70, 72). The assumption
that the mycolic acids represent a permeability barrier on the
surface of members of the mycolata has been confirmed in
recent years by the investigation of porins in different members
of the Corynebacterineae (38, 39, 40, 62, 63, 64, 72).
Members of the genus Corynebacterium are of considerable
interest because some of them are potent producers of gluta-
mate, lysine, and other amino acids through fermentation pro-
cesses on an industrial scale. Two prominent examples of
amino acid producers are C. glutamicum and Corynebacterium
callunae (22, 32, 35, 37, 65, 73). On the other hand, the genus
Corynebacterium contains a few pathogens. The main pathogen
is Corynebacterium diphtheriae (43), well known as the cause of
diphtheria, which is an acute, communicable respiratory dis-
ease. Other possible pathogens are Corynebacterium urealyti-
cum and Corynebacterium jeikeium (56). Diphtheria disease is
caused by exotoxin-producing C. diphtheriae cells that infect
the throat or nose and sometimes the eyes or skin, inducing the
formation of an inflammatory pseudomembrane. The exceed-
ingly potent toxin is absorbed into the circulation and damages
remote organs, potentially resulting in death (21, 28). In 1990

7709
7710 SCHIFFLER ET AL.
TABLE 1. Oligonucleotides used in this studya
Oligonucleotide Position
Cdiph_XbaI_for 2073825–2073796
Cdiph_KpnI_rev 2073038–2073067
FP KO 1 2862508–2862538
RP KO 2 2861687–2861717
FP KO 3 2861216–2861246
RP KO 4 2860356–2860385
a
The sequences of the primers were derived from the prospective gene of the cell wall channel and its flanking regions from the genome of C. diphtheriae NCTC
13129 (11). The accession number for the genome of C. diphtheriae NCTC 13129 is NC_002935.
the World Health Organization observed a reemergence of the
pathogen, which led to a worldwide launch of immunization
programs. A total of 1,214 declared cases of diphtheria origi-
nated an epidemic which spread through Russia, Ukraine, and
neighboring countries and even reached a few subjects in Eu-
rope and North America (12, 14). Especially disturbing is the
fact that nontoxigenic C. diphtheriae strains are associated with
invasive diseases (27) and nontoxigenic strains can change to
toxigenic strains by lysogenic conversion (2, 57). Furthermore,
it is known that the epidemiological pattern of the disease has
changed (25, 59). The current situation clearly demonstrates
that the risk of a diphtheria epidemic still exists, even in West-
ern countries. These results emphasize the importance of fur-
ther studies of this microorganism in order to understand the
metabolic pathways and to find new mechanisms of prevention
and treatment.
In this study, we extended the search for cell wall channels to
C. diphtheriae strain C8r(⫺) Tox⫺ (⫽ ATCC 11913), which is
another member of the genus Corynebacterium. It is known
that the cell wall of this strain contains a channel-forming
protein, but this protein has not been investigated in detail
(60). Using lipid bilayer experiments, we demonstrated that
extracts of cell walls and whole C. diphtheriae cells contain a
protein that forms wide and water-filled channels similar to the
porins found in gram-negative bacteria (7, 8, 9). The gene
encoding the channel-forming protein, designated CdporA,
was identified in the accessible genome of C. diphtheriae NCTC
13129 (16) by using the homology of CdporA to PorA of C.
glutamicum. CdporA was expressed in a PorA/PorH-deficient
strain of C. glutamicum (30, 41). In this study we describe
characterization of the first channel-forming protein of a
pathogenic strain in the genus Corynebacterium.
MATERIALS AND METHODS
Bacterial strain and growth conditions. C. diphtheriae strain C8r(⫺) Tox⫺ (⫽
ATCC 11913) (3) was used in all experiments. This strain was routinely grown in
500-ml Erlenmeyer flasks containing 250 ml brain heart infusion medium (Difco
Laboratories) broth at 36 ⫾ 1°C using a New Brunswick shaker at 120 rpm for
24 h. C. glutamicum ATCC 13032 cells were routinely grown in brain heart
infusion medium as described previously in detail (30). PorA- and PorH-deficient
C. glutamicum strain ATCC 13032⌬porA⌬porH (see below) was used to com-
plement for PorA deficiency. Growth rates were determined in triplicate by
measuring the optical density at 600 nm.
Construction of C. glutamicum ATCC 13032⌬porH⌬porA. The up- and down-
stream regions of target genes were amplified by PCR with primers FP KO1 and
RP KO2 (containing EcoRI and ApaI restriction sites) and primers FP KO3 and
RP KO4 (carrying ApaI and BamHI restriction sites) (Table 1). The FailSafe
PCR system (Biozym Scientific, Oldendorf, Germany) and buffer G were used
according to the manufacturer’s instructions. The PCR products were separately
digested using ApaI (Fermentas, St. Leon-Rot, Germany) and ligated over-
J. BACTERIOL.
Sequence (5⬘–3⬘)
GCTTTTGCTATTTCTAGAGGAGGTATTGAC
CCTAGCCAGCTAGGTACCAAGCCAACAAAC
GACGAGGCAACCGGAATTCGCATCGTCCGCG
GTTGCCAGTTTGCTGGGGCCCTCAGGACGTC
AACTTCGCCCACGGGCCCAGTTTTCAAAAAC
ATTCGACTTGATGGGGATCCACGGGGACTC
night with T4 DNA ligase. The ligation product served as a template for
another PCR with primers FP KO1 and RP KO4. After double digestion with
EcoRI and BamHI the knockout fragment was inserted into the multiple
cloning site of BamHI-EcoRI-cleaved pk18mobsacB, resulting in plasmid
Downloaded from http://jb.asm.org/ on January 2, 2018 by guest
pK18mobsacB⌬porH⌬porA. This plasmid was transformed by electroporation
into competent C. glutamicum ATCC 13032 cells.
Integration of the plasmid into the chromosome, indicating that the first
single-crossover event occurred, was tested by plating the cells on BHIS (brain
heart infusion medium with 9.1% D-sorbitol) plates supplemented with 25 ␮g/ml
kanamycin. For deletion of the target genes one of the colonies on a plate was
grown overnight in liquid LB and spread on BHIS plates containing 10% sucrose.
Cells growing on this plate were tested for kanamycin sensitivity by parallel
picking on BHIS plates containing either kanamycin or sucrose. Sucrose-resis-
tant and kanamycin-sensitive cells indicated that the second crossover occurred.
The deletion was verified by PCR and by DNA sequencing (data not shown).
Preparation of the cell wall, plasma membrane, and cytosol fractions. The cell
fractions were produced as previously described for mycobacteria (20, 61). Wet
cells (5 g) were suspended in 20 ml phosphate buffer (50 mM, pH 7.5), and the
resulting bacterial suspension was passed through a cell disrupter and then
centrifuged at 4,000 rpm for 15 min to eliminate unbroken cells; cell walls were
recovered from the supernatant by centrifugation at 10,000 rpm (8,300 ⫻ g) for
60 min. The 10,000-rpm supernatant was centrifuged at 50,000 rpm (170,000 ⫻
g) for 60 min at 4°C in an ultracentrifuge (Beckmann Omega 90 XL with a 70.1
Ti rotor) to obtain the membrane fraction in the pellet; the supernatant was
considered the cytosol fraction (61). The pellets were washed and lyophilized
(20) or were used directly for experiments. All fractions were analyzed to deter-
mine their protein contents by sodium dodecyl sulfate (SDS)-polyacrylamide gel
electrophoresis (PAGE) and to determine their pore-forming activities by re-
constitution experiments with the black lipid bilayer assay following detergent
treatment of the different fractions. Correct separation of the different fractions
was determined by their diverse levels of NADH oxidase activity. This activity
was measured by detecting the decrease in absorbance at 340 nm (55). The
reaction followed first-order kinetics. The specific activity was calculated by
dividing the appropriate rate constant (k1) by the relative protein concentration
of the sample.
Isolation and purification of the channel-forming protein from the cell wall
fraction. Whole cells of C. diphtheriae were extracted with a 1:2 mixture of
chloroform and methanol by using 1 part cells and 5 to 8 parts organic solvent
(38). The protein extracted with the chloroform-methanol mixture was precipi-
tated with ice-cold diethyl ether at ⫺20°C for 24 h and dissolved in 1% Genapol
X-80. Further purification was achieved by excising bands at different molecular
masses from preparative SDS-PAGE gels and extracting them with 1% Genapol
X-80. Possible oligomers of the channel-forming protein were obtained by add-
ing to the protein solution a volume of ethanol that was 2.5-fold greater than the
volume of the solution. The protein was then precipitated by incubation at 4°C
for 24 h. After centrifugation at 4°C, the resulting pellet was dried under a
vacuum to completely remove the remaining ethanol.
Digestion of the polypeptide. The purified polypeptide with a molecular mass
of about 5 kDa was treated for 5 min with 50 U/ml proteinase K (EC 3.4.21.64;
Sigma, St. Louis, MO) in a buffer containing 1% Genapol X-80.
SDS-PAGE. Analytical and preparative SDS-PAGE was performed as de-
scribed by Laemmli (36) or, because of the low resolution of this gel system at
low molecular mass, as described by Schägger and von Jagow (66) with Tricine-
containing gels. The gels were stained with Coomassie brilliant blue or with
colloidal Coomassie blue (48). Utilizing the colloidal properties of Coomassie
brilliant blue G-250, the latter resulted in improved staining of proteins with
sensitivity similar to that of silver stain.
VOL. 189, 2007 CELL WALL PORIN OF C. DIPHTHERIAE 7711

Immunological techniques. In Western blot (immunoblot) experiments, the

proteins separated by 10% Tricine-SDS-PAGE were transferred onto nitrocel-
lulose sheets (Protran; BA83; 0.2 ␮m; Schl̈eicher & Schuell) in a semidry blotting
apparatus as described by Schägger and von Jagow (67). This method is a
modification of the procedure described by Keilhauer et al. (33), taking into
account the higher ionic strength of Tricine-containing SDS gels. The reactive
sites were blocked with 5% skim milk in TBS-T (20 mM Tris-HCl [pH 7.5], 0.01
M NaCl, 0.1% Tween) for 1 h and briefly washed three times with TBS-T. The
blots were incubated for 1 h (or overnight) at room temperature with rabbit
polyclonal antibodies against C. glutamicum PorA at a dilution of 1:100 (38).
After incubation each membrane was washed three times with TBS-T. Bound
antibodies were detected by using horseradish peroxidase-coupled rabbit immu-
noglobulins (DAKO, Denmark) at a dilution of 1:1,000. A color reaction was
obtained by using a mixture containing 94% Tris-buffered saline, 6% chlo-
ronaphthol (0.3%), and 0.075% hydrogen peroxide. After 10 min of incubation
bands appeared. For detection of the monomer we used the ECL Western blot
detection system (GE Healthcare, United Kingdom) because chemiluminescent
detection provides an extremely sensitive system for detecting small amounts of
proteins with extremely low molecular masses. We followed the instructions in FIG. 1. Tricine (10%)-SDS-PAGE performed as described by

Downloaded from http://jb.asm.org/ on January 2, 2018 by guest

the manual supplied by the manufacturer. Signal detection was achieved by
incubating the membrane in the detection mixture for 1 min, draining off the
mixture, and wrapping the blot in Saran Wrap. Next, we placed the blot into a
film cassette and placed a piece of autoradiography film (HyperfilmMP; GE
Healthcare, United Kingdom) on top for 15 s to 5 min, as required by the sample.
The exposed film was immediately developed by use of X-omat M35 (Kodak).
Enzyme-linked immunosorbent assay (ELISA) experiments were carried out
as described previously (15). The method used allowed us to perform a rapid,
simple, and sensitive ELISA suitable for detection of bacterial surface proteins.
Briefly, different amounts of cells were coupled in each well (MaxiSorp immu-
noplates; Nunc, Roskilde, Denmark). Cells of C. glutamicum ATCC 13032 were
used as a positive control, and the corresponding preimmune serum and wells
containing either only cells of C. glutamicum or C. diphtheriae ATCC 11913
without any primary antibody were used as negative controls. Absorption at 405
nm was measured with a microplate reader (Thermomax; Molecular Devices).
PCR and construction of the expression plasmid. Primers Cdiph_XbaI_for
and Cdiph_KpnI_rev (Table 1) were used for PCR amplification of the region
which contained the gene coding for the PorA homolog of C. diphtheriae. Chro-
mosomal DNA of strain C8r(⫺) Tox⫺ (⫽ ATCC 11913) was used as a template
for PCR amplification. The program consisted of 30 cycles of 1 min of denatur-
ation at 95°C, 1 min of annealing at 45°C, and 2 min of extension at 72°C, using
FailSafe polymerase (Epicenter Biotechnologies) with buffer E. Fifty microliters
of the reaction mixture was loaded on a 0.8% agarose gel and compared to 1-kb
ladder (Gibco-BRL Life Technologies Ltd., Paisley, Scotland, United Kingdom).
The PCR product was cut out of the gel, ligated in a TOPO 2.1 vector, and
transformed in One Shot Top10 F⬘ cells. Plasmid miniprep of Escherichia coli
cells was used for sequencing the PCR product with primers M13 forward and
reverse. The gene coding for the prospective cell wall channel and its flanking
regions were cut out of the TOPO 2.1 vector using restriction enzymes EcoRI
and XbaI. The DNA piece was ligated into the shuttle vector pXMJ19. C.
glutamicum ATCC 13032⌬porA⌬porH cells were transformed with the vector by
using a slightly modified standard electrotransformation method (74). The trans-
fected cells were grown until the optical density at 600 nm was 3. Then protein
expression was induced with 1 mM isopropyl-␤-D-thiogalactopyranoside (IPTG),
and the culture was grown for another 16 h. Cells were harvested by centrifu-
gation. Subsequently, the cells were extracted with a 1:2 mixture of chloroform
and methanol by using 1 part cells and 5 to 8 parts organic solvent. The protein
was precipitated with ether in the cold.
Lipid bilayer experiments. The methods used for the lipid bilayer experiments
have been described previously in detail (10). The instrument consisted of a
Teflon chamber with two aqueous compartments connected by a small circular
hole. The hole had a surface area of about 0.3 mm2. Black lipid bilayer mem-
branes were obtained by painting a 1% (wt/vol) solution of diphytanoyl phos-
phatidylcholine (PC) or phosphatidylserine (PS) (Avanti Polar Lipids, Alabaster,
AL) in n-decane onto the hole. Membranes were also formed from PC-mycolic
acid (Sigma) or PC-PS-mycolic acid mixtures to study the effect of mycolic acids
on channel formation. The temperature was maintained at 20°C during all
experiments, and the current recordings were filtered at 300 Hz. All salts were
analytical grade and were obtained from Merck (Darmstadt, Germany). Zero-
current membrane potential measurements were obtained by establishing a salt
gradient across membranes containing 100 to 1,000 cell wall porins as described
previously (11).
Nucleotide sequence accession numbers. The sequences of CdporA from
NCTC 13129 and ATCC 11913 have been deposited in the DDBJ/EMBL/
Schägger and von Jagow (66) of the cell wall fraction, the cytoplasmic
membrane, and the cytosol of C. diphtheriae ATCC 11913. Lanes 1 to
3 were stained with Coomassie blue, and lane 4 was stained with
colloidal Coomassie blue. Lane 1, molecular mass markers (97, 66, 45,
30, 20.1, and 14.4 kDa); lane 2, 15 ␮l of the cell wall fraction (8,300-⫻-g
pellet) solubilized at 40°C for 30 min in 1% Genapol X-80 and 5 ␮l
sample buffer; lane 3, 15 ␮l of the 8,300-⫻-g supernatant containing
the cytoplasmic membrane and cytosol solubilized at 40°C for 30 min
in 5 ␮l sample buffer; lane 4, 3 ␮g of the pure cell wall channel protein
of C. diphtheriae ATCC 11913 incubated at 100°C for 30 min in 5 ␮l
sample buffer.
GenBank databases under accession numbers AM689937 and AM690207, re-
spectively.
RESULTS AND DISCUSSION
Isolation and purification of the channel-forming protein.
An homogenate of C. diphtheriae ATCC 11913 cells was cen-
trifuged at two different speeds. The pellet from the first cen-
trifugation should have contained the cell walls, and the pellet
from the second centrifugation should have contained the cy-
toplasmic membrane. The supernatant from the second cen-
trifugation was the cytosol of the cells. The pellets and super-
natant were inspected to determine their protein contents,
NADH oxidase activities, and channel-forming abilities. The
greatest channel-forming ability was observed for Genapol
X-80 extracts of the cell wall fraction. This fraction was essen-
tially free of cytoplasmic membrane, as assessed by NADH
oxidase activity. The NADH oxidase specific activity of the
proteins of the cell wall fraction relative to the protein con-
centration was 0.10. The corresponding specific activities of the
proteins of the cytosol and the fraction containing the cyto-
plasmic membrane relative to the protein concentrations were
0.03 and 0.87, respectively (the total activity of NADH oxidase
was defined as 1.0). The proteins of the cytosol and the cyto-
plasmic membrane showed only very weak single-channel
activity, indicating that the cell wall contained most of the
channel-forming protein.
The detergent-solubilized material from the cell wall frac-
tion produced so many bands in Tricine-SDS-PAGE gels that
it was impossible to relate a single band to the channel-forming
activity, although there was a strong band in the low-molecu-
lar-mass region (Fig. 1). As a further step, whole cells were
treated with organic solvents. In the case of the cell wall chan-
nel of C. glutamicum this method provided a simple purifica-
7712 SCHIFFLER ET AL. J. BACTERIOL.

tion procedure for the channel-forming protein (38). Tricine-

SDS-PAGE of the ether precipitate following chloroform-
methanol extraction showed that a protein with a molecular
mass of about 5 kDa was enriched in this fraction (data not
shown). Further purification of the channel-forming protein
was achieved by excising this band from a preparative SDS-
PAGE gel and extracting it with 1% Genapol X-80 (Fig. 1).
Addition of the 5-kDa band to planar lipid bilayers resulted in
very fast reconstitution of channels. When regions at different
molecular masses were excised from the same SDS-PAGE gel,
the highest channel-forming activity was always observed with
the 5-kDa band. However, we also noticed that low channel-
forming activity was smeared across the molecular mass region
between about 5 and 70 kDa of the SDS-PAGE gel. This result
indicated that the 5-kDa band may represent a channel-form-
ing monomer, as is the case for PorA of C. glutamicum (41).

Downloaded from http://jb.asm.org/ on January 2, 2018 by guest

This was confirmed by Tricine-SDS-PAGE of the ethanol pre-
cipitate of the 5-kDa protein eluted from the preparative SDS-
PAGE gel. The corresponding gel showed that the oligomer of
the channel-forming protein has an apparent molecular mass
of about 66 kDa (data not shown; see below). This is consistent
with the situation in C. glutamicum, where PorA or PorH also
forms oligomers (30, 41). In this respect it is interesting that
the 20-kDa protein MspA of Mycobacterium smegmatis forms
an octamer in the cell wall with a molecular mass of 160 kDa
(23). The smaller size of the CdPorA oligomer than of the
MspA octamer may be explained by the thinner cell wall of
corynebacteria. This presumably has to do with the length of
the corynomycolic acids, which are considerably shorter (22 to
38 carbon atoms) than the mycolic acids of other members of
the mycolata. Forty-three amino acids are presumably suffi-
cient to cross the mycolic acid layer of bacteria belonging to the
genus Corynebacterium, whereas longer polypeptides are nec-
essary to cross the cell wall of other members of the taxon
mycolata.
The mycolic acid layer of a member of the suprageneric
actinomycete taxon mycolata acts as a permeability barrier to
hydrophilic compounds (31, 52, 53). Our results indicate that
the cell wall fraction of C. diphtheriae also contains a channel-
forming protein, similar to the mycolic acid layer of different
members of the taxon Corynebacterineae (13, 38, 49, 62, 71, 72).
The channel-forming activity of the cell wall was rather high
with respect to the protein concentration. In addition, the
NADH oxidase activity of this fraction, which is a marker of
the cytoplasmic membrane, was rather low. This result ruled
out the possibility that we were dealing with a contaminant
protein responsible for channel formation. Furthermore, it is
clear that the channels can be present only in the cell wall of C.
diphtheriae and not in the cytoplasmic membrane. Otherwise,
the presence of these high-conducting channels would result in
cell death.
Interaction of the cell wall protein with lipid bilayer mem-
branes. Conductance measurement experiments were per-
formed with lipid bilayer membranes to study the interaction
of the cell wall protein with artificial membranes. Membranes
were formed from 1% PC or PC-PS mixtures (molar ratio, 4:1)
dissolved in n-decane. Addition of the 5-kDa cell wall protein
at a low concentration (100 ng/ml) to one or both sides of the
lipid membranes resulted in a strong increase in the conduc-
tance. The increase in conductance was not sudden; it was a
FIG. 2. Single-channel recording for a PC–n-decane membrane in
the presence of the channel-forming 5-kDa protein from the cell wall
of C. diphtheriae ATCC 11913 (trace I). The aqueous phase contained
1 M KCl and 10 mM Tris-HCl (pH 7), and 10 ng/ml cell wall protein
was added 2 min before the start of the recording. The applied mem-
brane potential was 20 mV, and the temperature was 20°C. Trace II
shows the results for a control without the 5-kDa protein.
function of time after addition of the protein to membranes in
the black state. Within about 20 to 30 min the membrane
conductance increased by several orders of magnitude above
that of membranes without the protein (from about 0.05 to 150
␮S/cm2). Only a small further increase (compared with the
initial increase) occurred after that time. Similar results were
obtained when the membranes were formed from PC-PS-my-
colic acid mixtures to study the effect of mycolic acids on
channel formation, suggesting that the mycolic acid did not
influence channel formation. Control experiments with
Genapol X-80 alone at the same concentration as that in the
experiments with protein demonstrated that the membrane
activity was caused by the presence of the cell wall protein and
not by the detergent. Similarly, proteolytic degradation of the
purified 5-kDa protein using proteinase K for 5 min completely
destroyed its channel-forming ability.
Single-channel analysis. Addition of lower concentrations
of the cell wall porin (10 ng/ml) to PC–n-decane membranes
allowed resolution of stepwise increases in conductance. Fig-
ure 2 shows a single-channel recording obtained in the pres-
ence of the 5-kDa protein, which was added 5 min after the
membrane was in the black state. A few minutes after the
addition of the protein, the current increased in step-like fash-
ion because of reconstitution of long-lasting channels, which
led to superposition of the steps. The current steps had a long
lifetime (mean lifetime, more than 5 min). Figure 3 shows a
VOL. 189, 2007
FIG. 3. Histogram of the probability of the occurrence of a given
conductivity observed with membranes formed with PC–n-decane
in the presence of the cell wall protein of C. diphtheriae ATCC 11913.
The aqueous phase contained 1 M KCl and 10 mM Tris-HCl (pH 7).
The applied membrane potential was 20 mV, and the temperature was
20°C. The average single-channel conductance was 2.25 nS for 148
single-channel events.
histogram of the conductance fluctuations observed under the
conditions used to obtain Fig. 2 (membrane potential, 20 mV;
1 M KCl, 10 mM Tris-HCl [pH 7]). Besides a major conduc-
tance step of about 2.25 nS (more than 30% of all conductance
fluctuations) we observed channels with higher single-channel
conductance, in particular channels with single-channel con-
ductance of about 4.5 nS. The latter channels are presumably
dimers of the 2.25-nS channel that could not be separated with
the time resolution of our experimental setup. Under the low-
voltage conditions used to obtain Fig. 2, all the steps were
directed upwards, which indicated that the channels were al-
ways in the open state. Changing the PC membranes to mem-
branes consisting of other lipid mixtures, such as PC-PS (molar
ratio, 4:1), PC-mycolic acid (molar ratio, 4:1), or PC-mycolic
acid-PS (molar ratio, 4:4:1) membranes, did not influence the
single-channel conductance of the porin.
Single-channel experiments were also performed with salts
containing ions other than K⫹ and Cl⫺. These experiments
were done to obtain some insight into the biophysical proper-
ties of the cell wall porin of C. diphtheriae. The results sum-
marized in Table 2 show that the channel is only moderately
selective. This conclusion was derived from experiments in
which KCl was replaced by LiCl or KCH3COO. Replacement
of the mobile ions K⫹ and Cl⫺ by the less mobile ions Li⫹ and
acetate⫺ showed that cations and anions have a certain per-
meability through the channels of C. diphtheriae. The perme-
ability of the cations through the channels followed approxi-
mately their mobility in the aqueous phase. This probably
means that the cell wall porin is a wide channel, which has only
a low field strength inside and no small-molecule selectivity
filter (i.e., no binding site), as suggested by the fact that the
large organic Tris⫹ cation could also penetrate the channel.
Table 2 also shows the average single-channel conductance
as a function of the KCl concentration in the aqueous phase.
The values for single-channel conductance always corre-
sponded to the maximum on the left in the histograms (i.e., to
the 2.25-nS peak in the case of 1 M KCl). Measurements were
obtained down to 0.03 M KCl. In contrast to other cell wall
CELL WALL PORIN OF C. DIPHTHERIAE 7713
channels of members of the mycolata (38, 40, 64, 70), we
observed a linear relationship between single-channel conduc-
tance and KCl concentration, which would be expected for
wide water-filled channels that do not contain point charges
similar to those formed by gram-negative bacterial porins (7, 8,
9, 75). The CdPorA channel sorts mainly according to the
molecular mass of the solutes, similar to the function of gen-
eral diffusion pores in gram-negative bacteria (8, 9). This chan-
nel definitely represents the major permeability pathway of the
cell wall, similar to the situation in C. glutamicum (18). This
result is very surprising because to date only cell wall channels
in members of the taxon mycolata that contain charges in or
near the channel opening have been identified (Table 3). The
channel described in this study is the first channel in the
Corynebacterineae that does not contain point charges. This
also means that the single-channel analysis does not allow
Downloaded from http://jb.asm.org/ on January 2, 2018 by guest
estimation of the channel size, as was the case for other cell
wall channels investigated to date (38, 40, 62, 63, 64). On the
other hand, the size of the CdporA channel could be very
similar to the size of the channel formed by PorA of C. glu-
tamicum because of the sequence homology between CdPorA
and PorA (see below). PorA and PorH have diameters of
about 2.2 nm, and it is possible that the size of the CdPorA
channel is similar (Table 3).
Selectivity of the cell wall channel of C. diphtheriae. Zero-
current membrane potential measurements were determined
to obtain further information on the molecular structure of the
C. diphtheriae cell wall channel. The experiments were per-
formed in the following way. After incorporation of 100 to
1,000 channels into the PC membranes, the salt concentration
on one side of the membranes was raised fivefold beginning
with 100 mM, and the zero-current potential was measured 5
min after every increase in the salt gradient across the mem-
brane. For KCl and KCH3COO the more diluted side of the
membrane (100 mM) always became positive, whereas nega-
tive membrane potentials were observed for LiCl (Table 4).
This result indicates that the channel functions as a general
diffusion pore, which simply filters the solutes, as already de-
TABLE 2. Average single-channel conductance of the cell wall
channel of C. diphtheriae ATCC 11913 in different
salt solutionsa
Salt Concn (M) Conductance (nS)
LiCl 1.0 1.25
NaCl 1.0 1.60
KCl 0.03 0.06
0.1 0.40
0.3 0.60
0.6 1.25
1.0 2.25
3.0 6.00
KCH3COO (pH 6) 1.0 1.25
CsCl 1.0 2.50
NH4Cl 1.0 2.25
N(CH3)4Cl 1.0 0.80
Tris-Cl (pH 6) 1.0 0.90
a
The membranes were formed with 1% PC dissolved in n-decane. The aque-
ous solutions were buffered with 10 mM Tris-HCl, and the pH was 7 unless
otherwise indicated. The applied voltage was 20 mV, and the temperature was
20°C. The average single-channel conductance was calculated from at least 80
single events derived from measurements of at least four individual membranes.
7714 SCHIFFLER ET AL. J. BACTERIOL.

TABLE 3. Comparison of the cell wall channel properties of C. diphtheriae, C. glutamicum, Mycobacterium chelonae, and Nocardia farcinica
Channel diam (nm) estimated bya:
Cation/anion Point charge
Conductance (nS) Effect of Reference(s)
Cell wall porin permeability at the channel Liposome Single-channel
in 1 M KCl negative point or source
ratio in KCl mouth swelling conductance
charges

C. diphtheriae ATCC 2.25 1.26 None This study

11913

C. glutamicum ATCC
13032
PorA 5.5 8.1 ⫺2.0 2.2 2.2 38
PorH 2.5 5.1 ⫺2.0 2.2 2.2 30
PorB 0.70 0.12 1.5 1.4 18

Rhodococcus erythropolis 6.0 11.8 2.7 2 2 62

Rhodococcus equi

Downloaded from http://jb.asm.org/ on January 2, 2018 by guest

ReqPorA 4.0 9.0 ⫺1.5 1.8 2.0 62
ReqPorB 0.30 0.16 1.5 1.4 1.4

Mycobacterium chelonae 2.7 14 2.5 2.2 2.0 70, 72

Nocardia farcinica 3.0 8.2 1.3 1.4 1.6 62

Streptomyces griseus 0.85 1.3 None 30

a
The channel diameters were estimated by using the liposome swelling assay, from the single-channel conductance as a function of the hydrated ion radii, or from
the effect of negative point charges on single-channel conductance.

termined for general diffusion pores of gram-negative bacteria
(9). Analysis of the membrane potential using the Goldman-
Hodgkin-Katz equation (11) confirmed the assumption that
anions and cations are permeable through the channel. The
cation/anion permeability ratios were 0.72 (LiCl), 1.26 (KCl),
and 3.26 (potassium acetate). This means that the selectivity of
the CdPorA channel was dependent on the mobility of the ions
in the aqueous phase.
Cell wall channel of C. diphtheriae is voltage dependent. In
single-channel recordings the cell wall porin exhibited some
flickering at higher voltages; i.e., it showed rapid transitions
between open and closed configurations. This could have been
caused by voltage-dependent closing of the cell wall porin. This
was studied in separate experiments. The channel-forming pro-
tein was added at a concentration of 100 ng/ml to one side of
a black PC–n-decane membrane (the cis side). After 30 min
the conductance had increased considerably. At this point dif-
ferent positive and negative potentials were applied to the cis
TABLE 4. Zero-current membrane potentials of PC–n-decane
membranes in the presence of the cell wall channel of
C. diphtheriae ATCC 11913 measured for a fivefold
gradient of different saltsa
Cation/anion permeability Membrane potential
Salt
ratio (mV)
KCl 1.26 5.4
LiCl 0.72 ⫺1.2
KCH3COO 3.26 17.5
a
The zero-current membrane potential is defined as the difference between
the potential on the dilute side and the potential on the concentrated side. The
aqueous salt solutions were buffered with 10 mM Tris-HCl (pH 7), and the
temperature was 20°C. The cation/anion permeability ratio was calculated using
the Goldman-Hodgkin-Katz equation (11) and the results of at least three
individual experiments.
side of the membrane. For negative and positive potentials at
the cis side of the membrane the current decreased in an
exponential fashion (data not shown). This result indicated
that the voltage dependence of the cell wall channel is sym-
metrical. Addition of the protein to the trans side of the mem-
brane or to both sides of the membrane also resulted in a
symmetric response to the applied voltage (data not shown).
The data obtained in the experiments were analyzed in the
following way. The membrane conductance (G) as a function
of voltage (Vm) was measured when the opening and closing of
channels reached an equilibrium (i.e., after exponential decay
of the membrane current following the voltage step). G was
divided by the initial value for the conductance (G0) (which
was a linear function of the voltage) obtained immediately
after the onset of the voltage. The data in Fig. 4 indicate the
symmetrical voltage dependence of the cell wall porin (mean
of four membranes) when the protein was added to the cis side.
To study the voltage dependence in more detail, the data in
Fig. 4 were analyzed assuming a Boltzmann distribution be-
tween the number of open and closed channels (No and Nc,
respectively) (42):
No/Nc ⫽ exp关nF共Vm ⫺ Vo兲/RT兴 (1)
where F, R, and T are the Faraday constant, gas constant, and
absolute temperature, respectively, n is the number of charges
moving through the entire transmembrane potential gradient
for channel gating, and Vm equals Vo, which is the potential at
which 50% of the total number of channels is in the closed
configuration. The ratio of open channels to closed channels
(No/Nc) may be calculated from the data in Fig. 4 using the
following equation:
No/Nc ⫽ 共G ⫺ Gmin兲/共Go ⫺ G兲 (2)
VOL. 189, 2007 CELL WALL PORIN OF C. DIPHTHERIAE 7715

FIG. 4. Conductance (G) at a given membrane potential (Vm) di-

Downloaded from http://jb.asm.org/ on January 2, 2018 by guest

vided by the conductance at 10 mV (G0) expressed as a function of the
membrane potential. The symbols represent the means of four mea-
surements, in which the 5-kDa protein from C. diphtheriae ATCC
11913 was added to the cis side of membranes. The solid line repre-
sents the fit of the experimental data using equations 1 and 2 and the
following parameters: n ⫽ 1; and Vo ⫽ ⫺48 mV (left side of the curve)
and Vo ⫽ 46 mV (right side of the curve). The aqueous phase con-
tained 1 M KCl, 10 mM Tris-HCl (pH 7.0), and 100 ng/ml porin. The
membranes were formed from PC dissolved in n-decane. The temper-
ature was 20°C.
FIG. 5. Western blot analysis of CdporA of C. diphtheriae ATCC
11913. An SDS-PAGE gel containing CdPorA oligomers and CdporA
where G is the conductance at a given membrane potential monomers was blotted onto a nitrocellulose membrane, which was
probed with anti-PorA polyclonal antibodies. Bands were detected
(Vm) and Go and Gmin are the conductance at 10 mV (con- using horseradish peroxidase-conjugated antibodies and chloronaph-
ductance of the open state) and the conductance at very high thol-hydrogen peroxide as the substrate. Lane 1, C. diphtheriae porin
potentials, respectively. The data in Fig. 4 could be fitted to oligomers; lane 2, CdporA monomers. Note that monomers and oligo-
combination of equations 1 and 2. The fit (Fig. 4) allowed mers cannot be shown in one slot because of the very different blotting
calculation of the number of gating charges (n) (number of times of monomers and oligomers due to their different molecular
masses.
charges involved in the gating process) and the midpoint po-
tential (Vo) (potential at which the numbers of open and closed
channels are identical). The midpoint potential for the addi-
tion of the protein to the cis side was for an applied positive antibody (Fig. 6). The anti-PorA antibody detected immobi-
voltage of 46 mV and for an applied negative voltage of ⫺48 lized cells of both C. glutamicum and C. diphtheriae. The results
mV. The gating charge in both cases was close to 1. of the ELISA experiments (Fig. 6) demonstrated that the an-
Immunological detection of the channel-forming protein of tigenic structures of PorA and the 5-kDa protein are localized
C. diphtheriae. A channel-forming low-molecular-mass peptide on the surface of the cells, which is in agreement with their
is present in the cell wall of C. glutamicum (38, 41). To check
the possible relationship between this peptide and the 5-kDa
channel-forming protein of C. diphtheriae, a Western blot anal-
ysis was performed using a polyclonal antibody directed against
the porin of C. glutamicum. The channel-forming protein of C.
glutamicum was purified as described previously (38) and used
as a control. We observed strong cross-reactivity of the anti-
bodies with the 5-kDa channel-forming protein of C. diphthe-
riae and its oligomer (Fig. 5, lanes 1 and 2), indicating the
presence of highly conserved immunodominant epitopes. It
has to be noted, however, that it was not possible to show
monomers and oligomers in one slot of the Western blot be-
cause of the very different blotting times of monomers and
oligomers. In the next step an ELISA was performed with
whole cells to confirm the localization of the 5-kDa protein on FIG. 6. Detection of CdporA of C. diphtheriae on the cell wall
the surface of C. diphtheriae cells. Different amounts of cells surface using an ELISA. Intact cells of C. diphtheriae ATCC 11913 and
were coupled in the wells. Experiments with immobilized cells C. glutamicum ATCC 13032 were immobilized and incubated with
anti-PorA (dilution, 1:100), preimmune serum (dilution, 1:1,000), and
of C. glutamicum and C. diphtheriae resulted in very low signals buffer. The maximum binding was defined as 100%, and the number of
using the preimmune serum, similar to the signals that were cells per well is indicated. The bars show the results of at least eight
detected using immobilized cells treated without any primary experiments; the error bars indicate standard deviations.
7716 SCHIFFLER ET AL.
FIG. 7. Amino acid sequence of CdporA of C. diphtheriae NCTC 13129 and comparison with the amino acid sequences of CdporA of C.
diphtheriae ATCC 11913, PorA of C. glutamicum ATCC 13032, and hypothetical PorA protein of C. efficiens AJ12310 using Pole Bioinformatique
Lyonnaise network protein sequence analysis (http://npsa-pbil.ibcp.fr). The charged residues of the proteins are indicated at the top. Conserved
residues in the four homolog proteins are indicated by bold type.
function as cell wall channels. This result suggests that CdPorA
is accessible from the surface by anti-PorA antibodies, which
means that it could be used as an antigenic structure also in
vaccination. Approximately the same concentration of protein
on the surface was observed on C. glutamicum and C. diphthe-
riae cells, indicating that the cell walls of the two species con-
tain the same number of channels. Control experiments with
preimmune serum demonstrated that the antibodies were
highly specific for both cell surfaces (Fig. 6). In addition, the
antibodies did not react with cell wall proteins of members of
the mycolata other than C. diphtheriae, C. glutamicum, Coryne-
bacterium efficiens, and C. callunae (data not shown). In par-
ticular, they did not react with cell wall extracts of Coryne-
bacterium xerosis and Corynebacterium amycolatum (60),
suggesting that the immune reaction described here was not a
nonspecific interaction. This finding also suggested that these
corynebacteria do not contain PorA-like proteins.
Identification of the gene coding for the cell wall channel of
C. diphtheriae ATCC 11913. The immunological cross-reactivity
between PorA and the cell wall channel of C. diphtheriae
ATCC 11913 suggested an interesting homology between the
two proteins. Similarly, we previously observed Southern hy-
bridization of the porA gene with DNA from C. diphtheriae
(41), suggesting that this organism contains a porA-like gene.
An NCBI BLAST translation tool search (1, 77) using porA of
C. glutamicum with the known genome of C. diphtheriae NCTC
13129 (16) suggested that this genome contained an open
reading frame (ORF) between the genes coding for GroEL2
(DIP2020) (6) and a putative secreted protein (DIP2017) that
could code for a low-molecular-mass cell wall protein similar to
PorA (Fig. 7). This means that the ORF is localized in a region
homologous to the region in the C. glutamicum genome con-
taining porA. Primers were designed to clone the whole region
between the DIP2020 (GroEL2) and DIP2017 genes using
DNA of C. diphtheriae ATCC 11913 as a template (Table 1).
The PCR product was cloned into the TOPO 2.1 vector and
was sequenced. It contained the ORF (132 bp) coding for a
PorA-like protein that showed only some minor amino acid
changes (11 residues) compared with the corresponding pro-
tein of C. diphtheriae NCTC 13129 (Fig. 7). The protein was
designated CdPorA (for C. diphtheriae pore-forming protein
A). CdPorA is 43 amino acids long (with the inducer methio-
nine) and has a (calculated) molecular mass of 4,640 Da. The
J. BACTERIOL.
Downloaded from http://jb.asm.org/ on January 2, 2018 by guest
CdporA studied here has one more negatively charged amino
acid than the strain NCTC 13129 protein (a total of five glu-
tamic and aspartic acids, compared to four lysines), which
agrees with its small cation selectivity. This is in contrast to the
highly cation-selective PorA channel of C. glutamicum (five
negatively charged amino acids, compared with a single lysine)
and possibly also to the hypothetical PorA protein of C. effi-
ciens (four negatively charged amino acids, compared with two
lysines [Fig. 7]). Positive and negative amino acids are
balanced for CdporA of strain NCTC 13129.
A 5⬘-AAAGG-3⬘ sequence was found eight nucleotides up-
stream of the start codon of cdporA, which could act as a ribo-
some binding site. Comparative analysis with the accessible ge-
nome of C. diphtheriae NCTC 13129 revealed the same result. A
stem-loop structure suitable to be a putative termination signal of
mRNA transcription could be identified downstream from the
stop codon (TAG) with the tool TransTermHP (http://transterm
.cbcb.umd.edu). TransTermHP is an algorithm to find rho-inde-
pendent terminators in bacterial genomes (34). The palindromic
sequences of C. diphtheriae ATCC 11913 (5⬘-AAAAGGGCCC
GCATCTAAAAGCGGGTCCTTTT-3⬘) and C. diphtheriae
NCTC 13129 (5⬘-ATAAGGGCCCGCATCTAAAAGCGG
GCCCTTTT-3⬘) have free energy levels of ⫺15.5 and ⫺17.8
kcal/mol, respectively (http://www.genebee.msu.su).
CdporA of both strains also does not contain any C-terminal
sorting signal for targeting to the cell wall similar to that of
PorA and PorH of C. glutamicum (30, 41). On the other hand,
as demonstrated here, CdporA is clearly a protein localized in
the cell wall of C. diphtheriae. The absence of any obvious
signal peptide suggests that its translocation through the cyto-
plasmic membrane requires an export system different from
the Sec system normally responsible for protein sorting and
export in gram-positive bacteria (24, 47, 58, 68).
Expression of cdporA in C. glutamicum ATCC 13032⌬porA⌬
porH and study of its channel-forming ability. The results of the
search for a gene encoding a channel-forming protein in the
genome of C. diphtheriae NCTC 13129 suggested that CdporA
could be the channel-forming protein in the cell wall. cdporA
was expressed in C. glutamicum ATCC 13032⌬porA⌬porH, and
whole cells were extracted with organic solvents. Proteins were
precipitated with ether in the cold. The precipitate was dis-
solved in 1% Genapol X-80, and channel formation was inves-
VOL. 189, 2007
FIG. 8. (A) Single-channel recording for a PC–n-decane mem-
brane in the presence of organic solvent extracts of C. glutamicum
ATCC 13032⌬porA⌬porH cells transfected with shuttle vector
pXMJ19 dissolved in Genapol X-80. Expression of CdporA was in-
duced with 1 mM IPTG. The aqueous phase contained 1 M KCl and
10 mM Tris-HCl (pH 7), and 20 ng/ml of the organic solvent extract
was added about 2 min before the start of the recording. The applied
membrane potential was 20 mV, and the temperature was 20°C. Trace
II shows the results for a control performed with 20 ng/ml organic
solvent extract of C. glutamicum ATCC 13032⌬porA⌬porH cells added
about 2 min before the start of the recording. (B) Histogram of the
probability of the occurrence of a given conductivity observed with
membranes formed with PC–n-decane in the presence of 20 ng/ml of
the organic solvent extract of C. glutamicum ATCC 13032⌬porA⌬porH
cells transfected with shuttle vector pXMJ19 dissolved in Genapol
X-80. The aqueous phase contained 1 M KCl and 10 mM Tris-HCl
(pH 7). The applied membrane potential was 20 mV, and the temper-
ature was 20°C. The average single-channel conductance was 2.25 nS
for 101 single-channel events.
tigated with the lipid bilayer assay using membranes prepared
from PC–n-decane. The precipitate had high channel-forming
activity with a single-channel conductance of 2.25 nS, the same
as that of purified CdporA under the same conditions (Fig.
8A). Control experiments with extracts from PorA/PorH-defi-
cient C. glutamicum cells showed only a limited number of
small channels that were presumably caused by PorB/PorC
(Fig. 8A), which forms small channels with a conductance of
CELL WALL PORIN OF C. DIPHTHERIAE 7717
700 pS in 1 M KCl (17, 18). This result revealed the close
structural and functional relationship between PorA and
CdporA. It is noteworthy that the cell wall porin of C. diph-
theriae had no properties similar to those of the porins found in
the cell walls of other distantly related actinomycetes, which
have molecular masses of about 20 kDa (49, 63) (see Table 3
for a comparison of cell wall channels from a variety of differ-
ent actinomycetes).
ACKNOWLEDGMENTS
We thank Franziska G. Rieß for her contribution in the early stages
of this study and Christian Andersen for helpful discussions.
This investigation was supported by grants from the Deutsche
Forschungsgemeinschaft (grant BE865-12/1) and the Fonds der
Chemischen Industrie.
Downloaded from http://jb.asm.org/ on January 2, 2018 by guest
REFERENCES
1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990.
Basic local alignment search tool. J. Mol. Biol. 215:403–410.
2. Anderson, G. S., and J. B. Penfold. 1973. An outbreak of diphtheria in a
hospital for the mentally subnormal. J. Clin. Pathol. 26:606–615.
3. Barksdale, L. 1959. Lysogenic conversions in bacteria. Bacteriol. Rev. 23:
202–212.
4. Barksdale, L. 1970. Corynebacterium diphtheriae and its relatives. Bacteriol.
Rev. 34:378–422.
5. Barksdale, L. 1981. The genus Corynebacterium, p. 1827–1837. In M. P.
Starr, H. Stoll, H. G. Trüper, A. Balows, and H. G. Schlegel (ed.), The
prokaryotes. Springer-Verlag, Berlin, Germany.
6. Barreiro, C., E. Gonzalez-Lavado, M. Patek, and J. F. Martin. 2004. Tran-
scriptional analysis of the groES-groEL1, groEL2, and dnaK genes in Coryne-
bacterium glutamicum: characterization of heat shock-induced promoters. J.
Bacteriol. 186:4813–4817.
7. Benz, R. 1988. Structure and function of porins from Gram-negative bacte-
ria. Annu. Rev. Microbiol. 42:359–393.
8. Benz, R. 1994. Solute uptake through the bacterial outer membrane, p.
397–423. In J. M. Ghuysen and R. Hakenbeck (ed.), Bacterial cell wall.
Elsevier Science B.V., Amsterdam, The Netherlands.
9. Benz, R. 2001. Porins—structure and function, p. 227–246. In G. Winkel-
mann (ed.), Microbial transport systems. Wiley-VCH, Weinheim, Ger-
many.
10. Benz, R., K. Janko, W. Boos, and P. Läuger. 1978. Formation of large,
ion-permeable membrane channels by the matrix protein (porin) of Esche-
richia coli. Biochim. Biophys. Acta 511:305–319.
11. Benz, R., K. Janko, and P. Läuger. 1979. Ionic selectivity of pores formed by
the matrix protein (porin) of Escherichia coli. Biochim. Biophys. Acta 551:
238–247.
12. Bonnet, J. M., and N. T. Begg. 1999. Control of diphtheria: guidance for
consultants in communicable disease control. Commun. Dis. Public Health
2:242–249.
13. Brennan, P. J., and H. Nikaido. 1995. The envelope of mycobacteria. Annu.
Rev. Biochem. 64:29–63.
14. Bricaire, F. 1996. Diphtheria: apropos of an epidemic. Presse Med. 25:327–
329.
15. Burkovski, A. 1997. Rapid detection of bacterial surface proteins using an
enzyme-linked immunosorbent assay system. J. Biochem. Biophys. Methods
34:69–71.
16. Cerdeno-Tarraga, A. M., A. Efstratiou, L. G. Dover, M. T. Holden, M.
Pallen, S. D. Bentley, G. S. Besra, C. Churcher, K. D. James, A. De Zoysa,
T. Chillingworth, A. Cronin, L. Dowd, T. Feltwell, N. Hamlin, S. Holroyd, K.
Jagels, S. Moule, M. A. Quail, E. Rabbinowitsch, K. M. Rutherford, N. R.
Thomson, L. Unwin, S. Whitehead, B. G. Barrell, and J. Parkhill. 2003. The
complete genome sequence and analysis of Corynebacterium diphtheriae
NCTC13129. Nucleic Acids Res. 31:6516–6523.
17. Costa-Riu, N., A. Burkovski, R. Krämer, and R. Benz. 2003. PorA represents
the major cell wall channel of the gram-positive bacterium Corynebacterium
glutamicum. J. Bacteriol. 185:4779–4786.
18. Costa-Riu, N., E. Maier, A. Burkovski, R. Krämer, F. Lottspeich, and R.
Benz. 2003. Identification of an anion-specific channel in the cell wall of the
gram-positive bacterium Corynebacterium glutamicum. Mol. Microbiol. 50:
1295–1308.
19. Daffé, M., and P. Draper. 1998. The envelope layers of mycobacteria with
reference to their pathogenicity. Adv. Microb. Physiol. 39:131–203.
20. Daffé, M., P. J. Brennan, and M. McNeil. 1990. Predominant structural
features of the cell wall arabinogalactan of Mycobacterium tuberculosis as
revealed through characterisation of oligoglycosyl alditol fragments by gas
chromatography/mass spectrometry and by NMR-analyses. J. Biol. Chem.
265:6734–6743.
7718 SCHIFFLER ET AL.
21. Dixon, J. M. S., W. C. Noble, and G. R. Smith. 1990. Diphtheria; other
corynebacterial and coryneform infections, p. 55–79. In M. T. Parker and
L. H. Collier (ed.), Principles of bacteriology, virology and immunity. Bac-
terial diseases, vol. 3. Toppley and Wilson’s Arnold, London, United King-
dom.
22. Eggeling, L., and H. Sahm. 1999. Glutamate and L-lysine: traditional
products with impetuous developments. Appl. Microbiol. Biotechnol. 52:
146–153.
23. Faller, M., M. Niederweis, and G. E. Schulz. 2004. The structure of a
mycobacterial outer-membrane channel. Science 303:1189–1192.
24. Freudl, R. 1992. Protein secretion in gram-positive bacteria. J. Biotechnol.
23:231–240.
25. Galazka, A. M., and S. E. Robertson. 1995. Diphtheria: changing patterns in
the developing world and industrialized world. Eur. J. Epidemiol. 11:107–
117.
26. Goodfellow, M., M. D. Collins, and D. E. Minnikin. 1976. Thin-layer chro-
matographic analysis of mycolic acid and other long-chain components in
whole organism methanolysates of coryneform and related taxa. J. Gen.
Microbiol. 96:351–358.
27. Harnisch, J. P., E. Tronca, C. M. Nolan, M. Turck, and K. K. Holmes. 1989.
Diphtheria among alcoholic urban adults. Ann. Intern. Med. 111:71–82.
28. Holmes, R. K. 2000. Biology and molecular epidemiology of diphtheria toxin
and the tox gene. J. Infect. Dis. 181:116–120.
29. Holt, J. G., N. R. Krieg, P. H. A. Sneath, J. T. Staley, and S. T. Williams (ed.).
1994. Bergey’s manual of determinative biology, 9th ed., p. 625–650. The
Williams and Wilkins Co., Baltimore, MD.
30. Hünten, P., N. Costa-Riu, D. Palm, F. Lottspeich, and R. Benz. 2005. Iden-
tification and characterization of PorH, a new cell wall channel of Coryne-
bacterium glutamicum. Biochim. Biophys. Acta 1715:25–36.
31. Jarlier, V., and H. Nikaido. 1990. Permeability barrier to hydrophilic solutes
in Mycobacterium chelonae. J. Bacteriol. 172:1418–1423.
32. Keilhauer, C., L. Eggeling, and H. Sahm. 1993. Isoleucine synthesis in
Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvC operon.
J. Bacteriol. 175:5595–5603.
33. Khyse-Andersen, J. 1984. Electroblotting of multiple gels: a simple appara-
tus without buffer tank for rapid transfer of proteins from polyacrylamide to
nitrocellulose. J. Biochem. Biophys. Methods 10:203–209.
34. Kingsford, C. L., K. Ayanbule, and S. L. Salzberg. 2007. Rapid, accurate,
computational discovery of Rho-independent transcription terminators illu-
minates their relationship to DNA uptake. Genome Biol. 8:R22.
35. Kinoshita, S., S. Udaka, and M. Shimono. 1957. Studies on the amino acid
fermentation. Production of L-glutamate by various microorganisms. J. Gen.
Appl. Microbiol. 3:193–205.
36. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of
the head of bacteriophage T4. Nature 227:680–685.
37. Leuchtenberger, W. 1996. Amino acids—technical production and use. Prod-
ucts of primary metabolism, p. 465–502. In H. J. Rehm, A. Pühler, G. Reed,
and P. J. W. Stadler (ed.), Biotechnology, vol. VI. Wiley-VCH, Weinheim,
Germany.
38. Lichtinger, T., A. Burkovski, M. Niederweis, R. Krämer, and R. Benz. 1998.
Biochemical and biophysical characterization of the cell wall channel of
Corynebacterium glutamicum: the channel is formed by a low molecular mass
subunit. Biochemistry 37:15024–15032.
39. Lichtinger, T., B. Heym, E. Maier, H. Eichner, S. T. Cole, and R. Benz. 1999.
Evidence for a small anion-selective channel in the cell wall of Mycobacte-
rium bovis BCG besides a wide cation-selective pore. FEBS Lett. 454:349–
355.
40. Lichtinger, T., G. Reiss, and R. Benz. 2000. Biochemical identification and
biophysical characterization of a channel-forming protein from Rhodococcus
erythropolis. J. Bacteriol. 182:764–770.
41. Lichtinger, T., F. G. Riess, A. Burkovski, F. Engelbrecht, D. Hesse, H. D.
Kratzin, R. Kramer, and R. Benz. 2001. The low-molecular-mass subunit of
the cell wall channel of the Gram-positive Corynebacterium glutamicum.
Immunological localization, cloning and sequencing of its gene porA. Eur.
J. Biochem. 268:462–469.
42. Ludwig, O., V. De Pinto, F. Palmieri, and R. Benz. 1986. Pore formation by
the mitochondrial porin of rat brain in lipid bilayer membranes. Biochim.
Biophys. Acta 860:268–276.
43. MacGregor, R. R. 1995. Corynebacterium diphtheriae, p. 1865–1872. In G. L.
Mandell, J. E. Bennett, and R. Dolin (ed.), Principles and practices of
infectious diseases. Churchill Livingstone, New York, NY.
44. Marienfeld, S., E.-M. Uhlemann, R. Krämer, and A. Burkovski. 1997. Ul-
trastructure of the Corynebacterium glutamicum cell wall. Antonie Leeuwen-
hoek 72:291–297.
45. Minnikin, D. E. 1987. Chemical targets in cell envelopes, p. 19–43. In M.
Hopper (ed.), Chemotherapy of tropical diseases. John Wiley & Sons Ltd.,
Chichester, United Kingdom.
46. Minnikin, D. E., P. V. Patel, and M. Goodfellow. 1974. Mycolic acids of
representative strains of Nocardia and the ‘rhodochrous’ complex. FEBS
Microbiol. Lett. 39:322–324.
47. Navarre, W. W., and O. Schneewind. 1999. Surface proteins of gram-positive
J. BACTERIOL.
bacteria and mechanisms of their targeting to the cell wall envelope. Micro-
biol. Mol. Biol. Rev. 63:174–229.
48. Neuhoff, V., N. Arnold, D. Taube, and W. Erhardt. 1988. Improved staining
of proteins in polyacrylamide gels including isoelectric focusing gels with
clear background at nanogram sensitivity using Coomassie Brilliant Blue
G-250 and R-250. Electrophoresis 9:255–262.
49. Niederweis, M., S. Ehrt, C. Heinz, U. Klöcker, S. Karosi, K. M. Swiderek,
L. W. Riley, and R. Benz. 1999. Cloning of the mspA gene encoding a porin
from Mycobacterium smegmatis. Mol. Microbiol. 33:933–945.
50. Nikaido, H. 1992. Porins and specific channels of bacterial outer membranes.
Mol. Microbiol. 6:435–442.
51. Nikaido, H. 2003. Molecular basis of bacterial outer membrane permeability
revisited. Microbiol. Mol. Biol. Rev. 67:593–656.
52. Nikaido, H., and V. Jarlier. 1991. Permeability of the mycobacterial cell wall.
Res. Microbiol. 142:437–443.
53. Nikaido, H., S. H. Kim, and E. Y. Rosenberg. 1993. Physical organisation of
lipids in the cell wall of Mycobacterium chelonae. Mol. Microbiol. 8:1025–
1030.
54. Ochi, K. 1995. Phylogenetic analysis of mycolic acid-containing wall chemo-
type IV actinomycetes and allied taxa by partial sequencing of ribosomal
protein AT-L30. Int. J. Syst. Bacteriol. 45:653–660.
Downloaded from http://jb.asm.org/ on January 2, 2018 by guest
55. Osborn, M. J., J. E. Gander, E. Parisi, and J. Carson. 1972. Mechanism of
assembly of the outer membrane of Salmonella typhimurium. Isolation and
characterization of cytoplasmic and outer membrane. J. Biol. Chem. 247:
3973–3986.
56. Oteo, J., B. Aracil, A. J. Ignacio, and L. J. Gomez-Garces. 2001. Signif-
icant bacteremias by Corynebacterium amycolatum: an emergent patho-
gen. Enferm. Infect. Microbiol. Clin. 19:103–106.
57. Pappenheimer, A. M., and J. R. Murphy. 1983. Studies on the molecular
epidemiology of diphtheria. Lancet ii:923–926.
58. Peyret, J. L., N. Bayan, G. Joliff, T. Gulik-Krzywicki, L. Mathieu, E.
Schechter, and G. Leblon. 1993. Characterization of the cspB gene encoding
PS2, an ordered surface-layer protein in Corynebacterium glutamicum. Mol.
Microbiol. 9:97–109.
59. Prospero, E., M. Raffo, M. Bagnoli, R. Appignanesi, and M. M. D’Errico.
1997. Epidemiological update and review of prevention strategies. Eur. J.
Epidemiol. 13:527–534.
60. Puech, V., M. Chami, A. Lemassu, M. Lanéelle, B. Schiffler, P. Gounon, N.
Bayan, R. Benz, and M. Daffé. 2001. Structure of the cell envelope of
corynebacteria: importance of the non-covalently bound lipids in the forma-
tion of the cell wall permeability barrier and fracture plane. Microbiology
147:1365–1382.
61. Raynaud, C., G. Etienne, P. Peyron, M. A. Laneelle, and M. Daffe. 1998.
Delineation of extracellular enzymic activities potentially involved in the
pathogenicity of Mycobacterium tuberculosis. Microbiology 144:577–587.
62. Rieß, F. G., and R. Benz. 2000. Discovery of a novel channel-forming protein
in the cell wall of the non-pathogenic Nocardia corynebacteroides. Biochim.
Biophys. Acta 1509:485–495.
63. Rieß, F. G., T. Lichtinger, R. Cseh, A. F. Yassin, K. P. Schaal, and R. Benz.
1998. The cell wall channel of Nocardia farcinica: biochemical identification
of the channel-forming protein and biophysical characterization of the chan-
nel properties. Mol. Microbiol. 29:139–150.
64. Rieß, F. G., U. Dörner, B. Schiffler, and R. Benz. 2001. Study of the prop-
erties of a channel forming protein of the cell wall of the gram-positive
bacterium Mycobacterium phlei. J. Membr. Biol. 182:147–157.
65. Sahm, H., L. Eggeling, B. Eikmanns, and R. Krämer. 1996. Construction of
L-lysine-, L-threonine-, and L-isoleucine-overproducing strains of Corynebac-
terium glutamicum. Ann. N. Y. Acad. Sci. 782:25–39.
66. Schägger, H., and G. von Jagow. 1987. Tricine-sodium dodecyl sulfate-
polyacrylamide gel electrophoresis for the separation of proteins in the range
from 1 to 100 KDa. Anal. Biochem. 166:368–379.
67. Schägger, H., and G. von Jagow. 1991. Blue native electrophoresis for iso-
lation of membrane protein complexes in enzymatically active form. Anal.
Biochem. 199:223–231.
68. Schneewind, O., D. Mihaylova-Petkov, and P. Model. 1993. Cell wall
sorting signals in surface proteins of gram-positive bacteria. EMBO J.
12:4803–4811.
69. Sutcliffe, I. C. 1997. Macroamphiphilic cell envelope components of Rhodo-
coccus equi and closely related bacteria. Vet. Microbiol. 56:287–299.
70. Trias, J., and R. Benz. 1993. Characterization of the channel formed by the
mycobacterial porin of Mycobacterium chelonae in lipid-bilayer membranes:
demonstration of voltage dependent regulation and the presence of negative
point charges at the channel mouth. J. Biol. Chem. 268:6234–6240.
71. Trias, J., and R. Benz. 1994. Permeability of the cell wall of Mycobacterium
smegmatis. Mol. Microbiol. 14:283–290.
72. Trias, J., V. Jarlier, and R. Benz. 1992. Porins in the cell wall of mycobac-
teria. Science 258:1479–1481.
73. Udaka, S. 1960. Screening method for microorganisms accumulating metab-
olites and its use in the isolation of Micrococcus glutamicus. J. Bacteriol.
79:745–755.
74. van der Rest, M. E., C. Lange, and D. Molenaar. 1999. A heat shock
VOL. 189, 2007
following electroporation induces highly efficient transformation of Coryne-
bacterium glutamicum with xenogeneic plasmid DNA. Appl. Microbiol. Bio-
technol. 52:541–545.
75. Weiss, M. S., A. Kreusch, E. Schlitz, U. Nestel, W. Welte, J. Weckesser, and
G. E. Schultz. 1991. The structure of porin from Rhodobacter capsulatus at
1.8A resolution. FEBS Lett. 280:379–382.
CELL WALL PORIN OF C. DIPHTHERIAE 7719
76. Yano, I., and K. Saito. 1972. Gas chromatographic and mass spectrometric
analysis of molecular species of corynomycolic acids from Corynebacterium
ulcerans. FEBS Lett. 23:352–356.
77. Zhang, J., and T. L. Madden. 1997. PowerBLAST: a new network BLAST
application for interactive or automated sequence analysis and annotation.
Genome Res. 7:649–656.
Downloaded from http://jb.asm.org/ on January 2, 2018 by guest