Phytomedicine 22 (2015) 939–945

Contents lists available at ScienceDirect

Phytomedicine
journal homepage: www.elsevier.com/locate/phymed

The modulating effect of Persea americana fruit extract on the level of

expression of fatty acid synthase complex, lipoprotein lipase, fibroblast
growth factor-21 and leptin – A biochemical study in rats subjected to
experimental hyperlipidemia and obesity
Padmanabhan Monika, Arumugam Geetha∗
Department of Biochemistry, Bharathi Women’s College, Broadway, Chennai 600108, India

a r t i c l e i n f o a b s t r a c t

Article history: Background: Obesity is a multifactorial disorder which is closely associated with hyperlipidemia. Avocados
Received 21 November 2014 are edible fruits traditionally consumed for various health benefits including body weight reduction.
Revised 25 June 2015
Hypothesis/purpose: To determine the hypolipidemic and anti-obesity effect of hydro-alcoholic fruit extract
Accepted 1 July 2015
of avocado (HFEA) in rats fed with high fat diet (HFD).
Study design: Male Sprague Dawley rats were divided into four groups. Groups 1 and 2 rats were fed with
Keywords: normal diet. Groups 3 and 4 rats were fed with HFD for 14 weeks. In addition, Groups 2 and 4 rats were
Hyperlipidemia co-administered with 100 mg/kg body weight of HFEA from 3rd week onwards.
Fatty acid synthase Methods: The HFEA was subjected to HPLC to quantify the major phytonutrients. Body mass index (BMI),
Leptin
adiposity index (ADI), total fat pad mass (TFP), blood lipid levels were determined in all the groups of rats. The
Fibroblast growth factor-21
mRNA expression of fatty acid synthase (FASN), lipoprotein lipase (LPL), fibroblast growth factor 21 (FGF21)
Adiponectin
Lipoprotein lipase and leptin was also assessed.
Results: HFEA was found to contain flavonoids: rutin-141.79, quercetin-5.25, luteolin-165, phenolic
compounds: gallic acid-198.57, ellagic acid-238.22, vanillic acid-4.79 and phytosterols: betasitosterol-70,
stigmasterol-12.5 (mg/100 g). HFEA reduced BMI, ADI, TFP, blood cholesterol, triglycerides, and LDL in rats
fed with HFD. Serum leptin was found reduced in HFEA co-administered rats. The mRNA expression of FASN,
LPL, and leptin in subcutaneous and visceral adipose tissue was found to be significantly reduced in HFEA co-
administered rats. The gene expression of fibroblast growth factor-21 (FGF21) was found to be significantly
increased in HFEA treated rats when compared to HFD control rats.
Conclusion: The hypolipidemic effect of HFEA may be partly due to its modulating effect on endogenous
fat synthesis and adiponectin formation through the transcription factor FGF21. The results also show that
avocado fruit extract has profound influence on leptin activity, which controls satiety and hunger to regulate
the food intake.
© 2015 Elsevier GmbH. All rights reserved.

Introduction
Obesity because of hyperlipidemia, a chronic metabolic disorder
is being characterized by enlarged fat mass and increased blood lipid
levels. Obesity is a complex trait influenced by diet, age, physical
Abbreviations: HFEA, hydroalcoholic fruit extract of avocado; HFD, high fat diet;
FGF21, fibroblast growth factor 21; FASN, fatty acid synthase; LPL, lipoprotein lipase;
PPAR-γ , peroxisome proliferator activated receptor γ ; BMI, body mass index; ADI, adi-
posity index; TFP, total fat pad; RP-HPLC, reverse phase-high performance liquid chro-
matography; GLC, gas liquid chromatography; HDL, high density lipoprotein; LDL, low
density lipoprotein; SAT, subcutaneous adipose tissue; VAT, visceral adipose tissue.
∗
Corresponding author. Tel.: +91 9444902506; fax: +91 44 25286411.
E-mail address: geethaugc2014@gmail.com, geethav21@yahoo.co.in (A. Geetha).
activity, and gene level expression of key enzymes involved in lipid
metabolism (Brockmann and Bevova 2002). Obesity has been caused
by eating too much with fewer mechanical work. Increased adipose
tissue mass is the primary phenotypic characteristic of obesity. Adi-
pose tissue, the largest storage site for triglycerides, plays an impor-
tant role in energy homeostasis. In humans, adipose tissue is found
beneath the skin (subcutaneous fat) and around internal organs (vis-
ceral fat). The number and distribution of adipose tissue will cause
adverse effects such as hyperlipidemia, cardiovascular disease, and
type 2 diabetes (Hurt et al. 2010). Therefore prevention and treatment
of obesity are important for healthy life.
Adipose tissue is now recognized not only as a lipid storage
site, but also as an active endocrine organ that secretes numer-
ous adipocytokines. Leptin is a cytokine-like hormone released from

http://dx.doi.org/10.1016/j.phymed.2015.07.001
0944-7113/© 2015 Elsevier GmbH. All rights reserved.
940 P. Monika, A. Geetha / Phytomedicine 22 (2015) 939–945
white adipose tissue in direct proportion to fat mass (Friedman and
Halaas 1998). Activation of hypothalamic leptin receptors suppresses
food intake and promotes energy expenditures (Singla et al. 2010).
Obesity is associated with decreased lipolysis in adipose tissue.
Increased activity of the lipogenic enzymes in adipose tissue may
contribute to develop obesity. The gene encoding fatty acid syn-
thase (FASN), a central enzyme in lipogenesis acts as a candidate
gene for determining body fat mass. Increased FASN expression links
metabolic changes of excess energy intake, including hyperinsuline-
mia, dyslipidemia and altered adipokine profile to increased body fat
mass (Berndt et al. 2005).
Lipoprotein lipase (LPL) is a multifunctional enzyme produced by
many tissues, including adipose tissue, cardiac and skeletal muscle,
islets, and macrophages. Major role of LPL include the hydrolysis of
TG-rich lipoproteins and the release of non-esterified fatty acids, used
for metabolic energy in peripheral tissue such as muscle, or esterified
into TG and stored in adipose tissue. LPL mRNA is found in human
adipose tissue, and also in muscle, adrenal, kidneys, intestine, and
neo-natal, but not in adult liver (Semenkovich et al. 1989).
Fibroblast growth factor 21 (FGF21) is a key mediator of fatty acid
oxidation and lipid metabolism. Pharmacological doses of FGF21 im-
prove glucose tolerance, and lower serum free fatty acids, and lead to
weight loss in obese mice (Fisher et al. 2010).
Only a few drugs such as statins are well approved for their hy-
polipidemic activity. The ever increasing incidence of obesity de-
mands the investigation of more reliable herbal drugs. Therefore,
much attention is focused on natural products, which may increase
fat oxidation, decrease fatty acid biosynthesis and reduce the fat
mass. Traditionally, fruits are consumed for preventing various health
problems including diabetes and obesity. Recent research has also
indicated that fruits such as Garcinia indica, litchi, durian, jackfruit,
mangosteen, acai, pomegranate, avocado, persimmon, guava, and
blueberry possess potent medicinal values (Baliga et al. 2011).
Avocado, the only edible fruit of the family Lauracea, has
been reported to have antibacterial, antifungal, hypotensive, anti-
inflammatory, and immune-enhancing properties (Adeyemi et al.
2002). Avocados contain monounsaturated fatty acids, dietary fiber
and essential phytonutrients (Fulgoni et al. 2013). Avocado-enriched
diet is used to improve lipid profile in healthy and also in mild hyperc-
holesterolemic patients, with or without hypertriglyceridemia (Lopez
Ledesma et al. 1996). Hence the present study focused on evaluating
the effect of hydro-alcoholic fruit extract of avocado on the gene level
expression of FASN, LPL, FGF21, and leptin, which play important role
in regulating lipid metabolism at the event of diet-induced hyperlipi-
demia.
Materials and methods
Chemicals and reagents
Assay kit for leptin (ab100773) from Abcam, Kolkata, India, As-
say kits for total cholesterol and HDL (AA05-Cholesterol LS), triglyc-
eride (AA18-Triglyceride LS) from Ensure Biotech Pvt Ltd, Hyderabad,
India, RNeasy lipid tissue kit from Qiagen, USA and cDNA reverse
transcription kit from Applied Biosystems-USA were used in this
study. All other chemicals and reagents used were of analytical grade.
Preparation of hydro-alcoholic fruit extract of avocado (HFEA)
Fresh avocados were collected from Pallangi Village in Kodaikanal
Hills (Tamil Nadu, India) during the period from October 2012 to
February 2013 and authenticated by the plant taxonomist Dr. P. Ja-
yaraman, Director, Plant Anatomy Research Centre (PARC), Chennai.
The voucher specimen was deposited in the Department of Biochem-
istry, Bharathi Women’s College, Chennai (Ref. no: PARC/2013/1458)
for future reference. The seed was removed and the edible portion
of the fruit (250 g) was chopped into small pieces, finely minced
and repeatedly extracted using 70% ethanol (1:4). The extract was
concentrated under reduced pressure by a rotary vacuum evaporator
(Equitron-Medica Instrument MFG Co., Chennai) and the thick syrupy
mass lyophilized (Lark Techno Knowledge, Chennai). The yield was
found to be 7.379 g. Herb:extract ratio was calculated. We found that
33.87 g of avocado fruit pulp was required to obtain 1 g of the ex-
tract. Working concentrations of the drug were prepared using dis-
tilled water just before use.
High performance liquid chromatography (HPLC) analysis of HFEA
HPLC analysis was carried out for the quantitative determination
of phytonutrients in HFEA.
Solid phase extraction and fractionation of phenolic acids
using C18 column
Phenolic acids of HFEA was fractioned using a C18 Hypersil Gold
Column (5 μm, 150 × 4.6 mm). Reverse-phase HPLC (RP-HPLC) was
carried out with the resulting fraction. Octadecylsilyl silica gel and
A – phosphoric acid:water (0.5:99.5 v/v), B – acetonitrile were used
as stationary and mobile phases, respectively. Gallic acid, coumaric
acid, ellagic acid, ferulic acid, mandelic acid and vanillic acid were
used as reference standards. For 20 μl sample, a UV detector was set
at 220 nm with a flow rate of 1.0 ml/min.
Fractionation of flavonoids
The presence of various flavonoids in HFEA was determined by
HPLC technique (System name: LACHROM L-7000 MERCK, Proc.
Method-HITACHI). Octadecylsilyl silica gel was used as stationary
phase and acetonitrile, and sodium dihydrogen phosphate with dilute
orthophosphoric acid as mobile phase. For reference rutin, quercetin,
galangin and luteolin standards were used. For 10 μl sample, the UV
detector was set at 350 nm with a flow rate of 0.5 ml/min.
Fractionation of phytosterols
HFEA was subjected to gas liquid chromatography (GLC) for the
fractionation of phytosterols. The analyses was done using a Waters
Atlantis dC18, 5 μm, 150 × 2.1 mm column with a gradient of acetoni-
trile/water (0.01% acetic acid) at a flow rate of 0.5 ml/min and a col-
umn temperature of 30 °C. Mobile phase: helium gas (99.99% purity)
at a flow speed of 0.8 ml/min, and split ratio of 1:50. For 1 μl sample,
the temperature was set at 280 °C. Column temperature: from 260 to
290 °C at the rising speed of 10 °C/min. Ionization mode: EI+. Electron
energy: 70 eV. Interface temperature: 250 °C. Ion source temperature:
200 °C. Detection voltage: 350 V. Cholesterol, brassicasterol, stigmas-
terol, campesterol, and β -sitosterol were used as reference standard.
Experimental animals
Male Sprague Dawley rats (175–200 g) kept in a temperature
controlled (22 ± 2 °C) environment with relative humidity of 44–
55% under 12 h light/dark cycle. Diet and water were provided ad
libitum.
Composition of hypercaloric/cafeteria/high fat diet (HFD)
The standard pellet diet was purchased from M/s Provimi Animal
Nutrition India Pvt. Ltd. (Bangalore, India) which contains protein-
25%, carbohydrate-68.3%, fat-4.3%, and vitamins and minerals-2.7%.
Ground labina-439, roasted peanut-215, casein-129, corn oil-61,
French-fried potatoes-153, vitamins and minerals-3 (g/kg) were the
 P. Monika, A. Geetha / Phytomedicine 22 (2015) 939–945 941

ingredients used for preparing HFD (protein-28%, carbohydrate- Table 1

Primer sequence.
36%, fat-23%, vitamins, minerals, cinders, and water-13%). The finely
ground ingredients were made into pellets and dried (Nascimento S. no. Gene Primer sequence
et al. 2008). The normal diet gives 3.48 kcal/g energy and HFD gives Forward (5 –3 ) Reverse (5 –3 )
4.6 kcal/g energy.
1 FASN GAGTCTGTCTCCCGCTTGAC CCCTCCAGCATGTACACCTT
Experimental protocol 2 LPL GGAGGTCGCCACAAATAAAA CTGACCAGCGGAAGTAGGAG
3 Leptin GAGACCTCCTCCATCTGCTG CATTCAGGGCTAAGGTCCAA
4 FGF21 GCCAACAACCAGATGGAACT GCAAAGGCTCTACCATGCTC
The animals were divided into four groups. Groups 1 and 2 rats 5 GAPDH CAAGGTCATCCATGACAACTTTG GTCCACCACCCTGTTGCTGTAG
were used as control and fed with normal diet. Groups 3 and 4
rats received HFD for 14 weeks. In addition, Groups 2 and 4 rats
received 100 mg/kg body weight of HFEA from the 3rd week. The (annealing) and 60 °C for 30 s (extension). GAPDH gene was used as
study protocol was approved by Institutional Animal Ethics Com- an internal control. Ct values obtained were used to quantify mRNA
mittee (IAEC–XIV/VELS/COL/43/CPCSEA/IAEC/15.07.2013). Once in a expression.
week, body weight was measured and BMI was calculated using the
formula: BMI = weight (g)/l2 (nose–anus) (cm2 ). At the end of the ex- Statistical analysis
perimental period, rats were anesthetized by injecting 0.1 ml/100 g
body weight of ketamine/xylazine mixture prepared by combining Data were analyzed using a commercially available statistics soft-
1.5 ml of 100 mg/ml xylazine and 10 ml of 100 mg/ml ketamine and ware package (SPSS for window V.10). The statistically significant
killed by cervical decapitation. Immediately, blood was collected and variation between different groups was determined by applying one
plasma/serum was separated and stored at 4 °C until analysis. Adi- way ANOVA with post-hoc Bonferroni test and the p Value < 0.05 was
pose tissue (epididymal, visceral and retroperitoneal fat pads) was considered significant.
isolated, weighed and the total fat pad mass was determined. Adi-
posity index (ADI) was also determined by using the formula: (sum Results
of total fat pad mass/body weight) × 100 and expressed as adiposity
percent (%). HPLC–UV analysis of HFEA

Biochemical analysis Fractionation of phenols

The levels of serum total cholesterol, triglycerides, HDL and LDL
were determined according to the kit protocol (Ensure Biotech Pvt
Ltd, Hyderabad, India). Serum leptin level was quantified using com-
mercial ELISA kit (Abcam, Kolkata, India).
Quantitative RT-PCR analysis
The HPLC–UV chromatogram of HFEA showed the presence of
four peaks at 220 nm with the retention time of 30.9, 35.9, and
43.2, respectively (Fig. 1b). The UV spectra of these peaks together
with the analysis of retention time of standards (Fig. 1a and b)
showed the presence of gallic acid (198.57 mg/100 g), ellagic acid
(238.22 mg/100 g) and vanillic acid (4.79 mg/100 g). The total phe-
nolic compounds were found to be 312.04 mg/100 g (Table 2).

Total RNA was extracted from frozen adipose tissue (RNeasy lipid
tissue mini kit) and quantified. According to the high-capacity cDNA
reverse transcription kit protocol, reverse transcription reactions
were performed with total RNA. For real-time PCR, an ABI PRISM Se-
quence Detection System 7700 (Applied Biosystems, USA) was used.
The primer sequences used for the RT-PCR analysis such as FASN,
LPL, Leptin and FGF21 areshown in Table 1. RT-PCR was performed
as follows: 40 cycles of 95 °C for 20 s (denaturation), 55 °C for 30 s
Fractionation of flavonoids
The UV spectra of the flavonoids in HFEA by most reliable
technique HPLC after extracting the flavonoid using the C18 Hy-
persil gold column, are shown in Fig. 1c and d. We have noted
the presence of flavonoids in decreasing order of concentration of
luteolin (165 mg/100 g) > rutin (141.79 mg/100 g) > quercetin
(5.25 mg/100 g). The total flavonoid concentration noted was
441.58 mg/100 g (Table 2).

Fig. 1. HPLC chromatogram of HFEA showing phenolic acids (a, b), flavonoids (c, d) and sterols (e, f) where b, d and f denote the corresponding standards.
942 P. Monika, A. Geetha / Phytomedicine 22 (2015) 939–945

Table 2 Effect of HFEA on BMI, TFP, ADI and serum leptin level
Concentration of flavonoids, phenolic acids and phytos-
Table 3 shows the BMI, TFP, ADI, and serum leptin level in con-
terols in HFEA.
trol and experimental rats. There was a significant (p = 0.000) in-
S. no Phytochemicals mg/100 g of HFEA crease in the BMI of HFD control rats when compared to normal diet-
Flavonoids
fed rats. HFEA-co-administered rats showed a significant decrease in
1 Rutin 141.79 BMI. Comparatively, TFP and ADI were also found to be significantly
2 Quercetin 5.25 (p = 0.000) decreased in HFD + HFEA rats. There was a significant
3 Luteolin 165 decrease in serum leptin level in HFEA-co-administered rats when
Phenolic acids
compared to HFD control rats.
4 Gallic acid 198.57
5 Ellagic acid 238.22
6 Valinic acid 4.79 Effect of HFEA on blood lipids
Phytosterols Serum TC, TG, and LDL concentrations in HFD control rats were
7 Beta-sitosterol 70
significantly increased (p = 0.000) and HDL level was significantly
8 Stigmasterols 12.5
decreased when compared to normal rats (Table 4). HFEA effectively
decreased the plasma TC, TG, and LDL levels and increased HDL level
significantly (p = 0.001) in HFD + HFEA-fed rats.
Extraction of phytosterols
Gas chromatography (GC) is the best and most widely used tool Effect of HFEA on the expression of FASN and LPL in SAT and VAT
for the chromatographic separation, identification, and quantification Expression of lipogenesis-related gene (FASN) and fatty acid
of phytosterols. GC (Fig. 1e and f) has confirmed the presence of β - oxidation-related gene (LPL) was measured by RT-PCR in SAT and VAT
sitosterol (70 mg/100 g) and stigmasterol (12.5 mg/100 g) as shown (Figs. 2 and 3). Expression of FASN mRNA expression in HFD control
in Table 2. group was significantly (p = 0.000) higher than in normal diet group.

Table 3
Effect of HFEA on body mass index (BMI), total fat pad mass (TFP), adiposity index (ADI) and serum leptin level.

Groups BMI (g/cm2 ) TFP (g) ADI (%) Leptin (ng/ml)

Control 0.68 ± 0.08 13.6 ± 1.62 4.97 ± 0.70 17.46 ± 1.76

HFEA control 0.57 ± 0.07NS 12.7 ± 1.60NS 4.48 ± 0.55NS 15.23 ± 2.09NS
HFD 1.52 ± 0.19∗ 24.9 ± 3.41∗ 6.84 ± 0.79∗ 48.69 ± 7.16∗
HFD + HFEA (100 mg/kg b.wt) 0.91 ± 0.10∗ 18.3 ± 2.12∗ 5.32 ± 0.63∗ 34.71 ± 4.27∗

Data were analyzed by one way ANOVA followed by post-hoc Bonferroni test. Values are expressed as mean ± SD
for 6 animals in each group. Statistical significance was calculated by comparing control vs HFEA control, control vs
HFD, HFD vs HFD + HFEA.
∗
p = 0.000, NS = non-significant.

Table 4
Effect of HFEA on serum total cholesterol (TC), triglyceride (TG) and lipoprotein level.

Groups TC (mg/dl) TG (mg/dl) HDL (mg/dl) LDL (mg/dl)

Control 68.72 ± 9.28 92.3 ± 9.32 24.3 ± 3.11 14.7 ± 1.70

HFEA control 61.14 ± 7.46NS 84.6 ± 11.59NS 26.4 ± 3.67NS 12.9 ± 1.38NS
HFD 123.44 ± 17.76∗ 137.1 ± 14.94∗ 16.9 ± 2.06∗ 23.5 ± 2.65∗
HFD + HFEA (100 mg/kg b.wt) 92.54 ± 11.10# 97.4 ± 10.81∗ 20.8 ± 2.93# 18.4 ± 2.01∗

Data were analysed by one way ANOVA followed by post-hoc Bonferroni test. Values are expressed as mean ± SD
for 6 animals in each group. Statistical significance was calculated by comparing control vs HFEA control, control vs
HFD, HFD vs HFD + HFEA.
∗
p = 0.000
#
p = 0.001, NS = non-significant.

Fig. 2. Fatty acid synthase (FASN) gene expression in SAT and VAT of control and experimental rats. Data were analyzed by one way ANOVA followed by post-hoc Bonferroni test.
Values are expressed as mean ± SD for 6 animals in each group. Statistical significance was calculated by comparing control vs HFEA control, control vs HFD, HFD vs HFD + HFEA.
∗
p = 0.000, NS = non-significant.
 P. Monika, A. Geetha / Phytomedicine 22 (2015) 939–945 943

Fig. 3. Lipoprotein lipase (LPL) gene expression in SAT and VAT of control and experimental rats. Data were analyzed by one way ANOVA followed by post-hoc Bonferroni test.
Values are expressed as mean ± SD for 6 animals in each group. Statistical significance was calculated by comparing control vs HFEA control, control vs HFD, HFD vs HFD + HFEA.
∗
p = 0.000, # p = 0.001, @ p = 0.003.

Fig. 4. Fibroblast growth factor (FGF)-21 gene expression in SAT and VAT of control and experimental rats. Data were analyzed by one way ANOVA followed by post-hoc Bonferroni
test. Values are expressed as mean ± SD for 6 animals in each group. Statistical significance was calculated by comparing control vs HFEA control, control vs HFD, HFD vs HFD + HFEA.
∗
p = 0.000, # p = 0.001, NS = non-significant.

Fig. 5. Leptin gene expression in SAT and VAT of control and experimental rats. Data were analyzed by one way ANOVA followed by post-hoc Bonferroni test. Values are expressed
as mean ± SD for 6 animals in each group. Statistical significance was calculated by comparing control vs HFEA control, control vs HFD, HFD vs HFD + HFEA. ∗ p = 0.000, NS = non-
significant.

HFEA significantly (p = 0.000) suppressed the FASN mRNA expres-
sion when co-administered with HFD in both SAT and VAT. LPL gene
expression was found to be significantly greater in HFD control group
compared to normal rats. The mRNA LPL expression was found to be
significantly decreased (p = 0.000) in HFD + HFEA group than in HFD
control rats, which confirms that HFEA actively takes part in decreas-
ing fat deposition in subcutaneous and visceral regions, a major con-
tributor of abdominal obesity.
Effect of HFEA on the expression of FGF21 in SAT and VAT
Fig. 4 shows the mRNA expression of FGF21, a circulating hep-
atokine that favourably affects carbohydrate and lipid metabolism.
FGF21 expression was found to be significantly (p = 0.000) lower
in SAT and VAT of HFD rats. HFEA co-administration significantly
(p = 0.000) increased the FGF21 gene expression in HFD + HFEA
groups, therefore decreasing the adipocyte differentiation in obese
condition.
Effect of HFEA on the expression of leptin in SAT and VAT
Fig. 5 shows the mRNA expression of leptin, a most important
adipocytokine in SAT and VAT of experimental rats. Leptin gene ex-
pression was significantly (p = 0.000) increased in HFD rats when
compared to control rats. In SAT and VAT, leptin expression was found
to be reduced in HFEA control and HFD + HFEA group of rats.
944 P. Monika, A. Geetha / Phytomedicine 22 (2015) 939–945
Discussion
Obesity, a life-threatening disease, is the fifth leading cause of
death worldwide, with more than 2.8 million adults dying each year
because of being overweight or obese (World Heart Federation, 2014).
Obesity is defined as an increase in adipocyte number (hyperplasia)
and size (hypertrophy).
Bioactive compounds, naturally occurring in fruits and vegetables
have enormous potential in regulating adipocyte biology and thus
studied for possible anti-obesity effects, based on that reduce food in-
take or fat absorption, promotes energy expenses, or prevents energy
storage. In this study, the anti-obesity effect of avocado was deter-
mined by anthropometric measures such as BMI, TFP mass and ADI.
BMI is just one signal of potential health risks associated with being
overweight or obese. BMI is closely related to both percentage body
fat and TFP mass (Gray 1991). In this study, it has been found that
HFEA reduced the TFP and ADI significantly and the same is reflected
in BMI (Table 3).
Flavonoids are plant pigments that have favourable metabolic ef-
fects because of their antioxidant powers. They have multiple tar-
gets including lowering blood pressure, reducing body weight, and
preventing dyslipidemia (Tohill et al. 2004). Rutin, a glycosylated
flavonoid widely spread in various plants, have beneficial effects on
the cardiovascular diseases, possibly due to its antioxidant and anti-
inflammatory properties (Middleton-Junior et al. 2000). Rutin pre-
vents hyperlipidemia induced by high cholesterol diet (Al-Rejaie et al.
2013). Park et al. (2002) have also reported that rutin promote the ex-
cretion of fecal sterols, decrease the absorption of dietary cholesterol
and lower the plasma and hepatic cholesterol concentration.
Quercetin exhibits a wide range of biological role with anti-
carcinogenic, anti-inflammatory and anti-viral properties. Hsu and
Yen (2006) reported that incubating adipocytes with quercetin led to
a fall in triacylglycerol content. Luteolin is a food-derived flavonoid
present in medicinal plants and in some vegetables and spices.
A recent review has provided evidence on the antioxidant, anti-
inflammatory, and antiallergic role of luteolin (Lin et al. 2008). The
potential lipid-lowering effect observed in the present study might
be due to the presence of these flavonoids in avocado fruit extract.
Natural phenolic acids present in plants provide many health ben-
efits. Gallic acid (3,4,5-trihydroxybenzoic acid), a naturally rich phe-
nolic compound exhibits hypolipidemic effect against mouse model
of high fat diet induced obesity (Jang et al. 2008). HPLC–UV-spectra
confirmed that P. americana is rich in ellagic acid. Ellagic acid is a phy-
tochemical that can occur naturally in foods, and it is also a break-
down product of ellagitannins in intestines. Absorption of ellagic acid
from food occurs quite rapidly, with maximum levels in blood after
about 1 h. Ellagic acid has been shown to reduce blood cholesterol
level in experimental model of hyperlipedemia (Maruthappan and
Shakti Shree 2010).
HFEA is also found to contain vanillic acid, a benzoic acid deriva-
tive, which is a flavoring agent. It is an oxidized form of vanillin pro-
duced on converting vanillin to ferulic acid. It is well-known that
obesity and hyperlipidemia are associated with inflammatory reac-
tions. Various studies have provided evidence for the effectiveness of
vanillic acid to manage immune or inflammatory responses (Lesage-
Meessen et al. 1996).
Phytosterols are the plant analogs of cholesterol, which could act
as anti-choleserolemic agents. The cholesterol-lowering effect of phy-
tosterols involves inhibition of intestinal cholesterol absorption as
well as reduction in hepatic cholesterol synthesis (Moghadasian and
Frohlich 1999). The presence of beta-sitosterol and stigmasterol in
HFEA confirmed by GC might have reduced the blood cholesterol and
LDL in HFEA-co-administered rats.
Abdominal obesity is a major risk factor for diabetes and car-
diovascular disease (Cornier et al. 2011). Excess VAT and SAT are
key contributors to abdominal obesity but differ in their structural
composition and metabolic significance (Bays et al. 2008). Small
adipocytes in SAT play a powerful role as a buffer and involve in cel-
lular uptake of circulating free fatty acids and TGs in the postpran-
dial period. Fat increase in tissues promotes redistribution of free
fatty acids to ectopic tissues such as VAT, liver, and skeletal muscle,
predisposing to increased metabolic risk (Tan and Vidal-Puig 2008).
VAT and SAT also differ in cytokine secretion profile such as leptin,
adiponectin, interleukin-6, interleukin-8, plasminogen activator in-
hibitor 1, and angiotensin, which may play a significant role in devel-
oping metabolic syndrome (Yang and Smith 2007).
To uphold lipid homeostasis, adipocytes perform lipogenesis or
lipolysis. These two processes are regulated by hormones, lipid
metabolites, and nutritional factors. Fatty acid synthase, lipoprotein
lipase, FGF21, and leptin gene expression was studied in both SAT and
VAT. Fatty acid synthase, a large multifunctional enzyme complex,
initiates the synthesis of fatty acids in a cyclical reaction sequence.
Ahn et al. (2008) also showed that quercetin decreased the sterol
regulatory element-binding proteins (SREBP)-1 and FASN with ac-
companying increase in acetyl-CoA carboxylase. A significant down-
regulation of FASN gene expression (Fig. 2) in HFD + HFEA-fed ani-
mals might have contributed for the lipid-lowering effect of avocado
fruit extract rich in flavonoids (quercetin) and phytosterols (beta-
sitosterol).
Lipoprotein lipase plays a vital role in the metabolism of lipids
and lipoproteins. Major role of LPL includes the hydrolysis of TG-rich
lipoproteins. The present study reveals that avocado fruit extract de-
creases the release of TG from lipoproteins and prevents their depo-
sition in adipose tissue.
Leptin is a satiety hormone formed in fat cells to regulate the fat
storage in the body. It regulates the sensation of hunger and energy
expenditure. Fried et al. (2000) suggested that basal leptin level can
be positively correlated with body fat. The report also showed that
leptin might contribute to hepatic steatosis by promoting insulin re-
sistance and by altering insulin signaling in hepatocytes, to promote
influx of intracellular fatty acids (Uygun et al. 2000). The results
show that avocado fruit extract reduces the pathogenesis of obesity
probably by decreasing the level of leptin and reducing the calories
from the diet.
Fibroblast growth factor-21 is an important transcription fac-
tor from the fibroblast growth factor family, produced by liver and
adipose tissue and regulates lipid metabolism. It was shown that
adiponectin is a downstream regulator of FGF21 and treatments with
FGF21 improved both expression and secretion of adiponectin in
adipocytes, increasing serum levels of adiponectin in mice (Lin et al.
2013). Co-administration of HFEA increased the expression of FGF21
in both SAT as well as in VAT which might have resulted in increased
adiponectin formation and thereby reduced ADI. Expression and se-
cretion of both adiponectin and FGF21 induced in adipose tissue
might be due to the activation of peroxisome proliferator-activated
receptor γ (PPAR-γ ), a nuclear hormone receptor that has an impor-
tant role in adipose tissue homeostasis. Therefore the results of the
present investigation confirm that avocado fruit has promising effect
in reducing the fat mass.
Conclusion
It is concluded that avocados have potent hypolipidemic prop-
erty probably by altering the gene level expression of fatty acid
synthase complex, lipoprotein lipase, FGF21, and leptin in visceral
and subcutaneous adipose tissue. The presence of phytonutrients
such as ellagic acid, gallic acid, vanillic acid, luteolin, quercetin, rutin,
β -sitosterol and stigmasterol might be accounted for the anti-obesity
effect of avocados.
Conflict of interest
The authors declare no conflict of interest.
 P. Monika, A. Geetha / Phytomedicine 22 (2015) 939–945
Acknowledgment
The authors thank Indian Council of Medical Research-Senior Re-
search Fellowship IRIS ID No: 2014-22230, New Delhi, India for the
financial support to carry out the work.
References
Adeyemi, O.O., Okpo, S.O., Ogunti, O.O., 2002. Analgesic and anti-inflammatory effects
of some aqueous extracts of leaves of Persea americana Mill (Lauraceae). Fitoterapia
73, 375–380.
Ahn, J., Lee, H., Suna, K., Park, J., Ha, T., 2008. The anti-obesity effect of quercetin is
mediated by the AMPK and MAPK signaling pathways. Biochem. Biophy. Res. 373,
545–549.
Al-Rejaie, S.S., Aleisa, A.M., Sayed-Ahmed, M.M., AL-Shabanah, O.A., Abuohashish, H.M.,
Ahmed, M.M., Al-Hosaini, K.A., Hafez, M.M., 2013. Protective effect of rutin on the
antioxidant genes expression in hypercholestrolemic male Wistar rat. BMC Com-
plement. Altern. Med. 13, 136.
Baliga, M., Bhat, H., Pai, R., Boloor, R., Palatty, P., 2011. The chemistry and medicinal
uses of the underutilized Indian fruit tree Garcinia indica Choisy (kokum): a review.
Food Res. Int. 44, 1856–1865.
Bays, H.E., González-Campoy, J.M., Bray, G.A., Kitabchi, A.E., Bergman, D.A., Schorr, A.B.,
Rodbard, H.W., Henry, R.R., 2008. Pathogenic potential of adipose tissue and
metabolic consequences of adipocyte hypertrophy and increased visceral adipos-
ity. Expert Rev. Cardiovasc. Ther. 6, 343–368.
Berndt, J., Kloting, N., Kralisch, S., Kovacs, P., Fasshauer, M., Schon, M.R., Stumvou, M.,
Bluhe, M., 2005. Plasma visfatin concentrations and fat depot-specific mRNA ex-
pression in humans. Diabetes 54, 2911–2916.
Brockmann, G.A., Bevova, M.R., 2002. Using mouse models to dissect the genetics of
obesity. Trends Genet. 18, 367–376.
Cornier, M.A., Despres, J.P., Davis, N., et al., 2011. Assessing adiposity: a scientific state-
ment from the American Heart Association. Circulation 124, 1996–2019.
Fisher, F.M., Chui, P.C., Antonellis, P.J., Bina, H.A., Kharitonenkov, A., Flier, J.S., Maratos-
Flier, E., 2010. Obesity is a fibroblast growth factor 21 (FGF21)-resistant state. Dia-
betes 59, 2781–2789.
Fried, S.K., Ricci, M.R., Russell, C.D., Laferrere, B., 2000. Regulation of leptin production
in humans. J. Nutr. 130, 3127S–3131S.
Friedman, J.M., Halaas, J.L., 1998. Leptin and the regulation of body weight in mammals.
Nature 395, 763–770.
Fulgoni, V.L., Dreher, M., Davenport, A.J., 2013. Avocado consumption is associated
with better diet quality and nutrient intake, and lower metabolic syndrome risk
in US adults: results from the National Health and Nutrition Examination Survey
(NHANES) 2001–2008. Nutr. J. 12, 1.
Gray, D.S., Fujioka, K., 1991. Use of relative weight and body mass index for the deter-
mination of adiposity. J. Clin. Epidemiol. 44, 545–550.
Hsu, C.L., Yen, G.C., 2006. Induction of cell apoptosis in 3T3-L1 pre adipocytes by
flavonoids is associated with their antioxidant activity. Mol. Nutr. Food Res. 50,
1072–1079.
Hurt, R.T., Kulisek, C., Buchanan, L.A, McClave, S.A., 2010. The obesity epidemic: chal-
lenges, health initiatives, and implications for gastroenterologists. Gastroenterol.
Hepatol. 6, 780–792.
945
Jang, A., Srinivasan, P., Lee, N.Y., Song, H.P., Lee, J.W., Lee, M., Jo, C., 2008. Comparison of
hypolipidemic activity of synthetic gallic acid–linoleic acid ester with mixture of
gallic acid and linoleic acid, gallic acid, and linoleic acid on high-fat diet induced
obesity in C57BL/6 Cr Slc mice. Chem. Biol. Interact. 174, 109–117.
Lesage-Meessen, L., Delattre, M., Haon, M., Thibault, J.F., Ceccaldi, B.C., Brunerie, P.,
Asther, M., 1996. A two-step bioconversion process for vanillin production from
ferulic acid combining Aspergillus niger and Pycnoporus cinnabarinus. J. Biotechnol.
50, 107–113.
Lin, Z., Tian, H., Lam, K.S., Lin, S., Hoo, R.C., Konishi, M., Itoh, N., Wang, Y., Bornstein, S.R.,
Xu, A., Li, X., 2013. Adiponectin mediates the metabolic effects of FGF21 on glucose
homeostasis and insulin sensitivity in mice. Cell Metab. 7, 779–789.
Lin, Y., Shi, R., Wang, X., Shen, H.M., 2008. Luteolin, a flavonoid with potential for cancer
prevention and therapy. Curr. Cancer Drug Targets 8, 634–646.
Lopez Ledesma, R., Frati Munari, A.C., Hernandez Domínguez, B.C., Cervantes Mon-
talvo, S., Hernandez Luna, M.H., Juarez, C., Moran Lira, S., 1996. Monounsaturated
fatty acid (avocado) rich diet for mild hypercholesterolemia. Arch. Med. Res. 27,
519–523.
Maruthappan, V., Sakthi Shree, K, 2010. Hypolipidemic activity of haritaki (Terminalia
chebula) in atherogenic diet induced hyperlipidemic rats. J. Adv. Pharm. Technol.
Res. 1, 229–235.
Middleton-Junior, E., Kandaswami, C., Theoharides, T.C., 2000. The effects of plant
flavonoids on mammalian cells: implications for inflammation, heart disease and
cancer. Pharmacol. Rev. 52, 673–751.
Moghadasian, M.H., Frohlich, J.J., 1999. Effects of dietary phytosterols on cholesterol
metabolism and atherosclerosis (clinical and experimental evidence). Am. J. Med.
107, 588–594.
Nascimento, A.F., Sugizaki, M.M., Leopoldo, A.S., Lima-Leopoldo, A.P., Luvizotto, R.A.,
Nogueira, C.R., Cicogna, A.C., 2008. A hypercaloric pellet-diet cycle induces obe-
sity and co-morbidities in Wistar rats. Arq. Bras. Endocrinol. Metab. 52, 968–
974.
Park, S.Y., Bok, S.H., Jeon, S.M., Park, Y.B., Lee, S.J., Jeong, T.S., Choi, M.S., 2002. Effect of
rutin and tannic acid supplements on cholesterol metabolism in rats. Nutr. Res. 22,
283–295.
Semenkovich, C.F., Chen, S.H., Wims, M., Luo, C.C., Li, W.H., Chan, L., 1989. Lipoprotein
lipase and hepatic lipase mRNA tissue specific expression, developmental regula-
tion, and evolution. J. Lipid Res. 30, 423–431.
Singla, P., Bardoloi, A., Parkash, A.K., 2010. Metabolic effects of obesity: a review. World
J. Diabetes 15, 76–88.
Tan, C.Y., Vidal-Puig, A., 2008. Adipose tissue expandability: the metabolic problems of
obesity may arise from the inability to become more obese. Biochem. Soc. Trans.
36, 935–940.
Tohill, B.C., Seymour, J., Serdula, M., Kettel-Khan, L., Rolls, B.J., 2004. What epidemio-
logic studies tell us about the relationship between fruit and vegetable consump-
tion and body weight? Nutr. Rev. 62, 365–374.
Uygun, A., Kadayifci, A., Yesilova, Z., et al., 2000. Serum leptin levels in patients with
nonalcoholic steatohepatitis. Am. J. Gastroenterol. 95, 3584–3589.
World Heart Federation-World Congress of Cardiology-25x25: At the heart of Global
Health, Scientific Session 4–7 May 2014, Melbourne, Australia.
Yang, X., Smith, U., 2007. Adipose tissue distribution and risk of metabolic disease: does
thiazolidinedione-induced adipose tissue redistribution provide a clue to the an-
swer? Diabetologia 50, 1127–1139.