The n e w e ng l a n d j o u r na l of m e dic i n e

vided the rationale for our own study evaluating Paul K. Crane, M.D., M.P.H.
longitudinal measures of renal function and de- University of Washington
mentia risk.1 It would be very difficult to evaluate Seattle, WA
pcrane@uw.edu
two time-varying exposures captured sporadically
Rod Walker, M.S.
in clinical care. Because we did not find a strong
Eric B. Larson, M.D., M.P.H.
relationship between the level of renal function-
1
Group Health Research Institute
ing and dementia risk in our cohort, we doubt Seattle, WA
that the associations that we found in our cohort Since publication of their article, the authors report no fur-
between glucose levels and dementia risk are ther potential conflict of interest.
confounded by renal function. We agree that more 1. O’Hare AM, Walker R, Haneuse S, et al. Relationship be-
research is needed to elucidate the underlying tween longitudinal measures of renal function and onset of de-
mentia in a community cohort of older adults. J Am Geriatr Soc
causes of the association between glucose levels 2012;60:2215-22.
and dementia risk. DOI: 10.1056/NEJMc1311765

Induction Regimens for ANCA-Associated Vasculitis

To the Editor: In the 18-month follow-up report
of the Rituximab in ANCA-Associated Vasculitis
(RAVE) trial, Specks et al. (Aug. 1 issue)1 reported
a noninferiority of intravenous rituximab (375 mg
per square meter of body-surface area adminis-
tered weekly for 4 weeks) as compared with oral
cyclophosphamide (taken daily) followed by aza-
thioprine. Complete remission was maintained in
39% of the patients in the rituximab group and
in 33% of the patients in the comparison group.
As compared with the results of the CYCLOPS
trial, the relapse rate in the control group ex-
ceeded expectations (20.8% in the CYCLOPS trial
vs. 29% in the RAVE trial), although the median
follow-up in the CYCLOPS trial was 4.3 years.1,2
One explanation might be the rigorous tapering
of glucocorticoids in the RAVE trial, because
early discontinuation of glucocorticoids is one of
the most significant risk factors for relapse.3 These
differences were not discussed thoroughly, but
clinical trials should address the need to prevent
relapses in order to reduce treatment-related ad-
verse events.
Repeated administration of rituximab has
shown encouraging results.4 Further trials that
are now being conducted will reassess these
preliminary data. Nonetheless, the results of the
RAVE trial have disproved the hypothesis that
prolonged immunosuppressive treatment is ab-
solutely necessary in antineutrophil cytoplasmic
antibody (ANCA)–associated vasculitis.
Andreas Kronbichler, M.D.
Julia Kerschbaum, M.D.
Michael Rudnicki, M.D.
Medical University Innsbruck
Innsbruck, Austria
Andreas.Kronbichler@i-med.ac.at
No potential conflict of interest relevant to this letter was re-
ported.
1. Specks U, Merkel PA, Seo P, et al. Efficacy of remission-
induction regimens for ANCA-associated vasculitis. N Engl J
Med 2013;369:417-27.
2. Harper L, Morgan MD, Walsh M, et al. Pulse versus daily oral
cyclophosphamide for induction of remission in ANCA-associated
vasculitis: long-term follow-up. Ann Rheum Dis 2012;71:955-60.
3. Walsh M, Merkel PA, Mahr AD, Jayne D. Effects of duration
of glucocorticoid therapy on relapse rate in antineutrophil cyto-
plasmic antibody-associated vasculitis: a meta-analysis. Arthri-
tis Care Res (Hoboken) 2010;62:1166-73.
4. Smith RM, Jones RB, Guerry MJ, et al. Rituximab for remis-
sion maintenance in relapsing antineutrophil cytoplasmic anti-
body-associated vasculitis. Arthritis Rheum 2012;64:3760-9.
DOI: 10.1056/NEJMc1311108
To the Editor: Specks et al. report that for the
treatment of severe ANCA-associated vasculitis,
a single course of rituximab is noninferior to
18 months of the conventional regimen of daily
cyclophosphamide followed by azathioprine. How-
ever, there are several reasons for advocating cau-
tion in using rituximab in such patients, particu-
larly those with newly diagnosed disease. First,
20 patients (29%) in the cyclophosphamide–aza-
thioprine group had a relapse before 18 months.
The considerably higher proportion of patients

1864 n engl j med 369;19 nejm.org november 7, 2013

The New England Journal of Medicine

Downloaded from nejm.org at UNIVERSITY OF PITTSBURGH - MAIN on August 10, 2015. For personal use only. No other uses without permission.
Copyright © 2013 Massachusetts Medical Society. All rights reserved.
 correspondence
who had a relapse than in previous trials1,2 could
indicate suboptimal administration of the stan-
dard therapy.3 Second, the results were based on
an intention-to-treat analysis; the stability of the
noninferiority inference should also be reported
with respect to a per-protocol analysis.3 Third,
the number of patients with at least one serious
adverse event or non–disease-related serious ad-
verse event was higher in the rituximab group
than in the cyclophosphamide–azathioprine group
(Table S3 in the Supplementary Appendix of the
article, available at NEJM.org). In addition, the
cost of rituximab far exceeds that of standard
treatment, thereby calling into question the an-
cillary benefits3,4 of the drug that would justify
its use in place of the conventional regimen.
Fotini B. Karassa, M.D.
University of Ioannina School of Medicine
Ioannina, Greece
fkarassa@cc.uoi.gr
No potential conflict of interest relevant to this letter was re-
ported.
1. Jayne D, Rasmussen N, Andrassy K, et al. A randomized
trial of maintenance therapy for vasculitis associated with anti-
neutrophil cytoplasmic autoantibodies. N Engl J Med 2003;349:
36-44.
2. de Groot K, Harper L, Jayne DR, et al. Pulse versus daily oral
cyclophosphamide for induction of remission in antineutrophil
cytoplasmic antibody-associated vasculitis: a randomized trial.
Ann Intern Med 2009;150:670-80.
3. Mulla SM, Scott IA, Jackevicius CA, You JJ, Guyatt GH. How
to use a noninferiority trial: users’ guides to the medical litera-
ture. JAMA 2012;308:2605-11.
4. Piaggio G, Elbourne DR, Pocock SJ, Evans SJ, Altman DG.
Reporting of noninferiority and equivalence randomized trials:
extension of the CONSORT 2010 statement. JAMA 2012;308:2594-
604.
DOI: 10.1056/NEJMc1311108
The authors reply: In response to Kronbichler
et al.: the relapse rate in the RAVE trial appears
higher than that reported for the European Vas-
culitis Study Group (EUVAS) trials. 1,2 The compa-
rability of trial results is affected by important
design differences between these trials and by
specific definitions underpinning the analyses.
The sample size and power calculations of the
RAVE trial were based on results achieved with
conventional therapy in a similar patient popula-
tion, the participants in the Wegener’s Granulo-
matosis Etanercept Trial (WGET).3,4 The results
achieved with cyclophosphamide–azathioprine
n engl j med 369;19 nejm.org november 7, 2013
The New England Journal of Medicine
Downloaded from nejm.org at UNIVERSITY OF PITTSBURGH - MAIN on August 10, 2015. For personal use only. No other uses without permission.
Copyright © 2013 Massachusetts Medical Society. All rights reserved.
in the RAVE trial were similar to those achieved
in the WGET.4 In contrast to the WGET and the
RAVE trial, the EUVAS trials enrolled newly diag-
nosed patients only. Fifty-one percent of partici-
pants in the RAVE trial had relapsing disease at
baseline, resulting in a higher overall relapse rate
than observed in the EUVAS trials. However, the
percentage of newly diagnosed participants in
the RAVE trial who remained in complete remis-
sion that was achieved with cyclophosphamide–
azathioprine (Fig. S3A in the Supplementary Ap-
pendix of our article) was similar to that of
patients in the CYCLOPS trial at the same time
point.2
Karassa asks about the stability of the non-
inferiority inference in a per-protocol analysis.
Only three patients had to be excluded to create
the per-protocol analysis sample, and the results
of the per-protocol analysis did not differ signifi-
cantly from those of the corresponding intention-
to-treat analyses.
In the intention-to-treat analysis up to the
closeout date of the trial, the number of serious
adverse events was numerically, but not signifi-
cantly, higher in the rituximab group than in the
cyclophosphamide–azathioprine group (Table S3
in the Supplementary Appendix of our article).
This analysis includes all events, many of which
occurred long after the protocol-specified experi-
mental treatment, making attribution to either
rituximab or cyclophosphamide–azathioprine dif-
ficult. Therefore, we showed the clinically more
meaningful safety comparison for all patients
receiving the originally assigned treatment in the
main body of the article (Table 2 of our article).
Cost-effectiveness was not addressed by our
trial. This issue requires careful consideration in
the context of different reimbursement systems
keeping the overall economic effect of a specific
treatment, rather than isolated drug cost, in mind.
Patients receiving conventional immunosuppres-
sive therapy need regular blood monitoring to
ensure their safety, resulting in considerable time
away from productive activities, and the down-
stream costs of cyclophosphamide therapy, includ-
ing fertility evaluations, surveillance cystoscopic
examinations, or cancer treatments, can be sub-
stantial. The results of our subgroup analyses
may provide guidance for practitioners and their
1865
 The n e w e ng l a n d j o u r na l of m e dic i n e

patients when making individual treatment deci- 1. Jayne D, Rasmussen N, Andrassy K, et al. A randomized
trial of maintenance therapy for vasculitis associated with anti-
sions, which certainly should include economic neutrophil cytoplasmic autoantibodies. N Engl J Med 2003;349:
considerations. 36-44.
2. Harper L, Morgan MD, Walsh M, et al. Pulse versus daily
Ulrich Specks, M.D.
oral cyclophosphamide for induction of remission in ANCA-
Mayo Clinic associated vasculitis: long-term follow-up. Ann Rheum Dis 2012;
Rochester, MN 71:955-60.
David Ikle, Ph.D. 3. Specks U, Merkel PA, Hoffman GS. Design of the Rituximab
in ANCA-associated Vasculitis (RAVE) Trial. Open Arthritis J 2011;
Rho
4:1-18 (http://benthamscience.com/open/toarthj/articles/V004/
Chapel Hill, NC
1TOARTHJ.pdf).
John H. Stone, M.D., M.P.H. 4. Wegener’s Granulomatosis Etanercept Trial (WGET) Re-
Massachusetts General Hospital search Group. Etanercept plus standard therapy for Wegener’s
Boston, MA granulomatosis. N Engl J Med 2005;352:351-61.
Since publication of their article, the authors report no fur-
DOI: 10.1056/NEJMc1311108
ther potential conflict of interest.

Bradyrhizobium enterica in Cord Colitis Syndrome

To the Editor: A 48-year-old woman presented
with nonbloody diarrhea 9 months after cord-
blood transplantation. Her condition was caused
by colitis and met the criteria for cord colitis syn-
drome.1 Two courses of metronidazole were ad-
ministered and were followed by clinical and en-
doscopically confirmed remission. Colonoscopy
was performed during active colitis and at the
end of antibiotic therapy. Colonic biopsies were
performed on both occasions, and specimens
were frozen and were analyzed by means of 16S
rDNA–based microbial community profiling with

Table 1. Relative Counts of the 10 Most Abundant Bacteria in Mucosa Samples Obtained from a Patient with Cord
­Colitis Syndrome during Active Disease and during Remission.*

Organism Active Disease Remission

Count in Ascending Colon Count in Sigmoid Colon Count in Sigmoid Colon
(N = 3823) (N = 1458) (N = 2418)
percent
Bacteroides fragilis (OTU240)† 35.21 41.29 0.62
Clostridium species (OTU92)† 9.73 5.35 1.24
Ruminococcus species 8.32 4.05 0.00
Escherichia coli 8.03 9.88 18.53
Blautia species (OTU28)† 5.60 1.71 0.58
Veillonella dispar 4.29 1.17 0.04
Fusobacterium species 3.61 0.07 0
B. fragilis (OTU140)† 2.30 3.57 0
Blautia species (OTU529)† 2.17 0.69 0.17
Clostridium species (OTU430)† 2.04 1.71 0
Bradyrhizobium enterica 0 0 0

* Biopsy specimens were obtained during active cord colitis syndrome (336 days after hematopoietic stem-cell trans-
plantation [HSCT]) and after antibiotic therapy (408 days after HSCT). Specimens were analyzed by means of micro­
bial community profiling with the use of the 16S rDNA gene primers 8F (AGAGTTTGATCCTGGCTCAG) and 534R
(ATTACCGCGGCTGCTGG), which are known to capture B. enterica. Organisms are listed according to their abun-
dance in the ascending colon during active disease.
† Two different phylotypes of B. fragilis were identified (operational taxonomic units [OTUs] 240 and 140), and they did
not cluster when a cutoff of 97% sequence similarity was used for the annotation of 16S rDNA reads. They may repre-
sent different strains of B. fragilis. This finding also applies to clostridium species and blautia species.

1866 n engl j med 369;19 nejm.org november 7, 2013

The New England Journal of Medicine

Downloaded from nejm.org at UNIVERSITY OF PITTSBURGH - MAIN on August 10, 2015. For personal use only. No other uses without permission.
Copyright © 2013 Massachusetts Medical Society. All rights reserved.