Ncbi

Buka data kita

Cari di menu. Nucleotide

Analyze
BLAST klik

Klik blast bawah.

Tunggu. Keluar garis merah2.

Kebawah

Buka data genbank di file kita file ‘original’.

Primer yang dipakai harus sama

CO1.

Nama data genbank tersebut terlalu panjang, kudu disingkat.

Misal SEQCO1

Copy data kita contig ke hemibragus CO1

Buka program mesquite

File

Open file

Buka data hemibragus CO1.

Ubah psp jadi program

Klik FASTA. OK. File dalm bentuk txt. Tanpa mengganti nama file.

DNA SP untuk melihat variasi genetic.

Muncul
ALIGNMENT
Ok

TUNGGU YA

Ini sudah alignment

Geser. Lihat kekanan.
Shift , dan anak panah kiri. Diblok.

Backspace. Klik. Yes.

Potong yang kanan sekarang. Di bp 540, shift anak panah kanan.
Sampai akhir 636. Backsapace yes
Export

Ganti fasta

Save

Data mesquite diminimize aja dulu.

Buka program mega
Retrieve.fastafile.
ok
Noncoding jangan dicentang.

Compute.
Xl
decimal places 2 aja.

Matrix.
Print matrix.. ntar ke XL sendiri

0.03 distancenya.
Diatas 3,5% berarti

Kalau pada

Genetic distance adalah perbedaan genetic.

Phylogeni
Pohonnya terlihat bootstrap 40.

Outgrup 1 genus tapi dia keluar.

Jarak genetic harus didukung dengan pohon.

Garis lurus =identic. 100

100 artinya= satu garis lurus itu sama.

31 itu sangat kecil. Perbedaannya masih kecil.

Boostrap itu tingkat kepercayaan sama.

Kalo yang 100 pada anak panah biru itu berbeda dengan grup anak panah oranye.

Elompok 31 dan 66 itu berbeda tapi kecil, hanya 40.

Anak panah hijau besar. Perseluruh nukleotida 0,020.

Muncul

Figure. Evolutionary relationships of taxa

The evolutionary history was inferred using the Neighbor-Joining method [1]. The optimal tree with the
sum of branch length = 0.30193222 is shown. The percentage of replicate trees in which the associated
taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches [2]. The
tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used
to infer the phylogenetic tree. The evolutionary distances were computed using the Kimura 2-parameter
method [3] and are in the units of the number of base substitutions per site. The analysis involved 11
nucleotide sequences. Codon positions included were 1st+2nd+3rd. All positions containing gaps and
missing data were eliminated. There were a total of 539 positions in the final dataset. Evolutionary
analyses were conducted in MEGA7 [4].

1. Saitou N. and Nei M. (1987). The neighbor-joining method: A new method for reconstructing
phylogenetic trees. Molecular Biology and Evolution 4:406-425.

2. Felsenstein J. (1985). Confidence limits on phylogenies: An approach using the bootstrap. Evolution
39:783-791.

3. Kimura M. (1980). A simple method for estimating evolutionary rate of base substitutions through
comparative studies of nucleotide sequences. Journal of Molecular Evolution 16:111-120.
4. Kumar S., Stecher G., and Tamura K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis version
7.0 for bigger datasets.Molecular Biology and Evolution 33:1870-1874.

Disclaimer: Although utmost care has been taken to ensure the correctness of the caption, the caption
text is provided "as is" without any warranty of any kind. Authors advise the user to carefully check the
caption prior to its use for any purpose and report any errors or problems to the authors immediately
(www.megasoftware.net). In no event shall the authors and their employers be liable for any damages,
including but not limited to special, consequential, or other damages. Authors specifically disclaim all
other warranties expressed or implied, including but not limited to the determination of suitability of
this caption text for a specific purpose, use, or application.

Tata nama spesies denga nama ilmiah yang benar.

DNASP

ok
Titik adalah sama dengan yang paling atas. Consensus.
11 jumlah sekuen kita
Monomorpic site
421bp karena ada
outgroup.
118 itu beda.

Singleton =yang berubah

banget. Di bp 6, 12 dst.

Parsimony=perubahan
berulang.
Ok
Yang penting pada publikasi
itu”
Jumlah haplotype
Nucleotide diversity
Standar deviasinya ditulis ya.
G+C content untuk melihat
komposisi nukleotida.
Include
[1] nt_6 [2] nt_12 [3] nt_18 [4] nt_25 [5] nt_39

[6] nt_42 [7] nt_48 [8] nt_51 [9] nt_57 [10] nt_60

[11] nt_66 [12] nt_69 [13] nt_84 [14] nt_87 [15] nt_97

[16] nt_102 [17] nt_105 [18] nt_123 [19] nt_135 [20] nt_147

[21] nt_150 [22] nt_153 [23] nt_160 [24] nt_171 [25] nt_180

[26] nt_189 [27] nt_193 [28] nt_198 [29] nt_204 [30] nt_207

[31] nt_210 [32] nt_216 [33] nt_217 [34] nt_219 [35] nt_222

[36] nt_225 [37] nt_228 [38] nt_235 [39] nt_237 [40] nt_243

[41] nt_244 [42] nt_246 [43] nt_252 [44] nt_255 [45] nt_258

[46] nt_261 [47] nt_267 [48] nt_270 [49] nt_273 [50] nt_276

[51] nt_284 [52] nt_285 [53] nt_291 [54] nt_294 [55] nt_297

[56] nt_300 [57] nt_303 [58] nt_306 [59] nt_309 [60] nt_312

[61] nt_315 [62] nt_318 [63] nt_321 [64] nt_324 [65] nt_330

[66] nt_333 [67] nt_348 [68] nt_351 [69] nt_355 [70] nt_357
 [71] nt_360 [72] nt_372 [73] nt_378 [74] nt_382 [75] nt_384

[76] nt_387 [77] nt_390 [78] nt_394 [79] nt_399 [80] nt_402

[81] nt_408 [82] nt_412 [83] nt_416 [84] nt_417 [85] nt_418

[86] nt_420 [87] nt_423 [88] nt_426 [89] nt_430 [90] nt_432

[91] nt_435 [92] nt_438 [93] nt_444 [94] nt_447 [95] nt_454

[96] nt_456 [97] nt_459 [98] nt_462 [99] nt_465 [100] nt_468

[101] nt_480 [102] nt_486 [103] nt_489 [104] nt_492 [105] nt_493

[106] nt_498 [107] nt_501 [108] nt_504 [109] nt_510 [110] nt_511

[111] nt_516 [112] nt_519 [113] nt_522 [114] nt_525 [115] nt_531

[116] nt_532 [117] nt_534 [118] nt_535

MATRIX

[ 10 20 30 40 50 60 70 80 90 100 110 ]

[ * * * * * * * * * * * ]

'Contig_1'
TACGCTCACTTCTTAATAACATTATTCGCGCATACACCTATGGTTTACAAGAACTGCTCTTATACTTCCATATTGGTA
TTTAATAGATGTTACGTATGGCAACATCTGCCATTTACAC

'Hemibagrus_nemurus'
.....C......................T...........CA............CA..........C.TG.............C.......CTA...........T.A.....C....

'Hemibagrus_nemurus'
.....C......................T...........CA............CA..........C.TG.............C.......CTA...........T.A.....C....

'Hemibagrus_nemurus'
...A.........C.............AT.....A......A..C........TC...T.......C.........C..............C..C..A....T.....T.G...G...

'Hemibagrus_nemurus'
...A.........C.............AT.....A......A..C........TC...T.......C.........C..............C..C..A....T.....T.G...G...

'Hemibagrus_nemurus'
...A.........C.............AT.....A......A..C........TC...T.......C.........C..............C..C..A....T.....T.G...G...
'Hemibagrus_nemurus'
...A.........C.............AT.....A......A..C........TC...T.......C.........C..............C..C..A....T.....T.G...G...

'Hemibagrus_nemurus'
....TC...C..C.....G.......G.T............A..C....G....CA.CT.......CT........C.............C.....CA.T.GT....AT.....GT..

'Hemibagrus_nemurus'
.....C.......C....G.........T..T.......T.A..C.T...T.T.CA..T..G..T......T.C...T...TT.C...T.CC.AC.....TTT..T.TT.....G...

'Hemibagrus_planice'
C....C.GTCCT..GGC..TGC.GC..A.A.GCGTGTTAGCAACCC......T.CAT..CC..GTC......C.AAC.C.G..C..GC..GCTACG.A
AT..A.CTCAATGCC.GTGT

'Hemibagrus_fortis_'
.GT..CT..C....G..C.TG.CGCC.A.AT.CG.TTTAGCAACCCTTG..GTTGATG.C..C.T.C..TCCC.A...CCA....A.C.CCC.ACG..
A..GAGC.CAAT.CC.GT.T

;
Tulisan harus curier new biar spasi lurus

Di bp ke berapa polymorphic site terjadi.

Buat landscape