Exam Code Number:__________________

MOL 214
Exam 1
February 28, 2013

Your exam code number is:

Write this number on each

page of your exam.

DO NOT write everything you know about a topic, this will waste your time. If you provide
more than one answer for a question only your first answer will be graded.

If you need extra space, continue only on the back of the page that the question is written on.
Clearly label that you are using the back for your answer.

Remember to write legibly, if we can’t read it, we can’t grade it!

I pledge my honor that I have not violated the honor code

during this examination.

Signature: ______________________________

Printed Name: ___________________________

1
 Exam Code Number:__________________

Multiple Choice (2 points each)

1. Protein structures have several different levels of organization. Consider the definitions
below and select the one that best fits the term “protein domain.”

A. a small cluster of α helices and β sheets

B. the tertiary structure of a substrate-binding pocket
C. a complex of more than one polypeptide chain
D. a protein segment that folds independently

2. Gyrases are enzymes that

A. relax supercoiled DNA

B. denature double-stranded DNA
C. synthesize a new strand of DNA from a single-stranded DNA template
D. synthesize a strand of DNA from an RNA template

3. You have isolated a novel protein, characterized its structure and determined that it
catalyzes the breakdown of a large substrate and has two binding sites. One of these is
large, apparently the binding site for the large substrate; the other is small, possibly a
binding site for a regulatory molecule. What do these findings suggest to you about the
mode of action of this protein?

A. It is probably a structural protein that is found in tendons or bone.

B. It is probably an enzyme that is controlled through allosteric regulation.
C. It is probably an enzyme that works through autophosphorylation.
D. It is probably a transmembrane protein—like a G protein-coupled receptor.

4. Which level(s) of protein structure could be disrupted by treatment with a reducing agent?

A. primary
B. primary and secondary
C. tertiary
D. secondary and tertiary
E. tertiary and quaternary

5. Cyclin-dependent kinase activity is regulated by

A. phosphorylation.
B. allosteric modification.
C. allolactose.
D. both A and B.

2
 Exam Code Number:__________________

6. Which of the following properties do you predict to be most critical to histone association
with DNA?

A. Histones are small proteins.

B. Histones are positively charged.
C. Histones are highly conserved.
D. There are at least five different histone proteins in every eukaryotic cell.

7. The core octamer is composed of

A. two tetramers of histones H3 and H4

B. one each of 8 different types of histones.
C. a tetramer of histones H3 and H4, and two dimers of histones H2A and H2B.
D. the linker histone H1

8. Phosphodiester bonds are formed between adjacent Okazaki fragments by

A. DNA polymerase I
B. DNA polymerase III
C. DNA ligase
D. DNA gyrase
E. telomerase

9. Methylation and acetylation are common changes made to histone H3, and the
specific combination of these changes is sometimes referred to as the “histone
code.” Which of the following patterns will probably lead to gene silencing?

A. lysine 9 methylation
B. lysine 4 methylation and lysine 9 acetylation
C. lysine 14 acetylation
D. lysine 9 acetylation and lysine 14 acetylation

10. Fully folded proteins typically have polar side chains on their surfaces, where
electrostatic attractions and hydrogen bonds can form between the polar group on
the amino acid and the polar molecules in the solvent. In contrast, some proteins
have a polar side chain in their hydrophobic interior. Which of following would not
occur to help accommodate an internal, polar side chain?

A. A hydrogen bond forms between two polar side chains.

B. A hydrogen bond forms between a polar side chain and protein backbone.
C. A hydrogen bond forms between a polar side chain and an aromatic side chain.
D. Hydrogen bonds form between polar side chains and a buried water molecule.

3
 Exam Code Number:__________________

11. Which of the following statements is true?

A. Peptide bonds are the only covalent bonds that can link together two amino acids
in proteins.
B. The polypeptide backbone is free to rotate about each peptide bond.
C. Nonpolar amino acids tend to be found in the interior of proteins.
D. The sequence of the atoms in the polypeptide backbone varies between different
proteins.

12. At the ends of linear chromosomes the strand of DNA that is extended by
telomerase is the:
A. 3’ end
B. 5’ end
C. both the 3’ and the 5’ ends are extended

13. The amount of cyclin protein in a cell is regulated by:

A. phosphorylation
B. regulated proteolysis
C. allosteric modifications
D. All of the above

Short answer

14. Sodium hydroxide denatures both proteins and nucleic acids, while phenol denatures
proteins but not nucleic acids. In the transformation experiments performed by Griffith with
Streptococcus pneumoniae, what result would be expected if an extract of S-strain
bacteria was treated with phenol, mixed with live R-strain bacteria, and then injected into
mice? Please explain your answer (3 points)

What would be expected if the extract from S-strain bacteria was treated with sodium
hydroxide, mixed with live R-strain bacteria, and then injected into mice? Please explain
your answer (3 points)

4
 Exam Code Number:__________________

15. Explain how hydrophobic interactions are important for stabilizing double-stranded DNA in
aqueous solution. (2 points)

16. Why do eukaryotes need telomeres but bacteria do not? (2 points)

17. Although all protein structures are unique, there are common structural building
blocks that are referred to as regular secondary structures. Some have α helices,
some have β sheets, and still others have a combination of both. What makes it
possible for proteins to have these common structural elements? (4 points)

18. Colleen is studying protein Zzz, an enzyme that regulates sleep patterns in
panthers. She purifies two samples of protein Zzz: the wild-type (non-mutated)
protein and a mutant version that contains a single amino acid substitution. When
washed through the same gel-filtration column, mutant protein Zzz runs through the
column slower than the normal protein. What is the most likely explanation for this
result? (4 points)

5
 Exam Code Number:__________________

19. Label the major and minor grooves of the DNA molecule pictured in panel A. (2
points)

Which base pair is depicted in panel B? (1 point)

20. Because all DNA polymerases synthesize DNA in the 5′-to-3′ direction, and
the parental strands are antiparallel, DNA replication is accomplished with
the use of two mechanisms: continuous and discontinuous replication.
Indicate whether the following items relate to (1) continuous replication, (2)
discontinuous replication, or (3) both modes of replication. (1 point each)

primase

single-strand binding protein

RNA primers

leading strand

lagging strand

Okazaki fragments

DNA helicase

6
 Exam Code Number:__________________

21. Use the terms listed to fill in the blanks in the figure below. (1 point each)
A. A-T base pair
B. G-C base pair
C. deoxyribose
D. phosphodiester bonds
E. purine base
F. pyrimidine base

22. During DNA replication in a bacterium, a C is accidentally incorporated instead of an

A into one newly synthesized DNA strand. Imagine that this error was not corrected
and that it has no effect on the ability of the progeny to grow and reproduce.

A. After this original bacterium has divided once, what proportion of its progeny
would you expect to contain the mutation? (2 points)

B. What proportion of its progeny would you expect to contain the mutation after
three more rounds of DNA replication and cell division? (2 points)

7
 Exam Code Number:__________________

23. Your friend Anne works at the Centers for Disease Control and has discovered a
brand-new virus that has recently been introduced into the human population,
turning everyone into a zombie. She has just developed a new assay that allows her
to detect the virus by using PCR products made from the blood of infected patients.
The assay uses primers in the PCR reaction that hybridize to sequences in the viral
genome.

Anne is distraught because of the result she obtained when she looked at PCR
products made using the blood of three patients suffering from the viral disease,
using her own blood, and using a leaf from her petunia plant (see the gel pictured
below).

a. Assuming that Anne has not actually been infected, what could have caused the
same bands to appear in both her sample and the samples of the infected patients?
(2 points)

b. You advise Anne hold off on eating brains for now, as you believe she is missing an
important control. What additional PCR reaction could she include to demonstrate
that she is not actually infected? (2 points)

24. If the genome of the bacterium E. coli requires about 40 minutes to replicate itself,
how can the genome of the fruit fly Drosophila be replicated in only 3 minutes? (2
points)

8
 Exam Code Number:__________________

25. Dideoxy DNA sequencing is based on chain termination with dideoxynucleotides. Why are
normal deoxynucleotides also included in the reaction? (2 points)

26. What does the smallest fragment at the bottom of a DNA sequencing gel represent? (2
points)

27. You are studying a small gene and want to clone it into a plasmid vector. The part of
the DNA sequence of this gene is shown below.

5′-GGCGTGACTGGAAGCTAGTCATC-3′
3′-CCGCACTGACCTTCGATCAGTAG-5′

This sequence does not contain any HindIII restriction enzyme sites, but you need
to use this enzyme in your cloning reaction. The target sequence for the HindIII
restriction nuclease is shown below.

Explain how you would generate a HindIII in the DNA sequence using site-directed
mutagenesis. Make sure to write out the sequences for any relevant PCR primers
you might need. (6 points)

9
 Exam Code Number:__________________

28. Below is a depiction of a replication bubble. The top strand is labeled “A” and the
bottom strand is labeled “B”.

A 5’ AGCTCCGATCGCGTAACTTT CTAAAGCTTCGGGCATTATCG 3’

B 3’TCGAGGCTAGCGCATTGAAA GATTTCGAAGCCCGTAATAGC 5’

A. Place the following primer on the diagram above: 5’- GCAAAG -3’ and represent the
direction of replication, i.e., the direction in which DNA polymerase moves relative to the
primer, by an arrow. (2 points)

B. If the replication fork moves to the left, will the primer be used to create the leading
strand of replication or the lagging strand? (2 points)

C. You are performing an experiment similar to the Meselson Stahl experiment with the
DNA molecule above. The strands A and B have been labeled with “light” precursors.
What would be the density of a DNA molecule that contains strand B after one round of
replication in “heavy” medium? Circle your choice below and provide a brief explanation for
your choice. (3 points)

Heavy Intermediate Light Can’t tell

D. What would be the density of a DNA molecule that contains strand B after two rounds
of replication? Circle your choice below and provide a brief explanation for your choice. (3
points)

Heavy Intermediate Light Can’t tell

10
 Exam Code Number:__________________

29. Pictured below are the recognition sequences and sites of cleavage for the
restriction enzymes SalI, XhoI, PstI, and SmaI. Also included is a plasmid map with
the sites of cleavage for these enzymes marked.

A. After which of the five treatments listed below can the plasmid re-form into a
circle simply by treating it with DNA ligase? Assume that after treatment any
small pieces of DNA are removed, and it is the larger portion of plasmid that
will reassemble into a circle. (4 points)

1. SalI alone
2. SalI and XhoI
3. SalI and PstI
4. SalI and SmaI
5. SmaI and PstI

B. In which of the treatments can the plasmid re-form into a circle by the
addition of DNA ligase after treating the cut DNA with DNA polymerase in a
mixture containing the four deoxyribonucleotides? Again, assume that you
are trying to get the larger portion of plasmid to reassemble into a circle.
Please explain your answer (6 points)

11