2013 Ak

MOL
214
Exam 2
April 4, 2013
Your exam code number is:
Write this number on each

page of your exam.
DO NOT write everything you know about a topic, this will waste your time. If you provide
more than one answer for a question only your first answer will be graded.
If you need extra space, continue only on the back of the page that the question is written on.
Clearly label that you are using the back for your answer.
Remember to write legibly, if we can’t read it, we can’t grade it!
I pledge my honor that I have not violated the honor code
during this examination.
Signature: ______________________________
Printed Name: ___________________________

Exam Code Number:______________
Multiple Choice (18 points)

1. Genome wide association studies investigate which of the following?
A. Single nucleotide polymorphisms
B. Rare mutations that occur in somatic cells after exposure to a chemical
mutagen
C. Transposon insertion sites in the genome
D. All of the above

2. RNA in cells differs from DNA in that ___________________.
A. it contains the base uracil, which pairs with cytosine
B. it is single-‐stranded and cannot form base pairs
C. it is single-‐stranded and can fold up into a variety of structures
D. the sugar ribose contains fewer oxygen atoms than does deoxyribose

3. Phosphorylation of the C-‐terminal domain of RNA polymerase is required for:
A. Unwinding DNA
B. Catalysis of nucleotide addition
C. Recruiting the enzyme needed for capping the mRNA
D. All of the above

4. Which of the following statements about prokaryotic mRNA molecules is false?
A. A single prokaryotic mRNA molecule can be translated into several proteins.
B. Ribosomes must bind to the 5′ cap before initiating translation.
C. mRNAs are not polyadenylated.
D. Ribosomes can start translating an mRNA molecule before transcription is
complete.

5. How are most eukaryotic transcription regulators able to affect transcription when
their binding sites are far from the promoter?
A. by binding to their binding site and sliding to the site of RNA polymerase
assembly
B. by looping out the intervening DNA between their binding site and the
promoter
C. by unwinding the DNA between their binding site and the promoter
D. by attracting RNA polymerase and modifying it before it can bind to the
promoter

2
6. Why do many researchers consider RNA to be the best candidate for the first life-‐form?
A. It is simple in structure.
B. It is capable of self-‐replication and catalysis.
C. It carries more information than any other molecule.
D. All of its nucleotide components have been created under laboratory conditions that
mimic early Earth.

7. Which of the following is not involved in post-‐transcriptional control?
A. the spliceosome
B. dicer
C. mediator
D. RISC

8. In RNA interference a messenger RNA molecule:
A. Is not produced
B. Is produced but at a much lower rate
C. Is produced but never leaves the nucleus
D. Is produced but never gets translated
E. Is produced and translated but the protein is quickly degraded

9. Which of the following molecules of RNA would you predict to be the most likely to
fold into a specific structure as a result of intramolecular base pairing? (2 points)

A. 5′-CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG-3′
B. 5′-UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG-3′
C. 5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′
D. 5′-GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG-3′

Short Answer Questions:

10. When the human genome was first sequenced it cost almost 3 billion dollars. Newer
sequencing methods have brought down the cost to about $10,000. What is one way
that the newer methods differ from the traditional Sanger sequencing method? (2
points)
New methods like pyrosequencing do not use chain termination with ddNTPs, instead
they use methods to detect the polymerization reaction to identify each base as it is
added to DNA.
They are generally more high-‐throughput.
They provide greater coverage.
They generally result in shorter sequencing reads.

3
11. You have made a collection of mutant fruit flies that are defective in various aspects of
DNA repair. You test each mutant for its hypersensitivity to three DNA-‐damaging
agents: sunlight, nitrous acid (which causes deamination of cytosine), and formic acid
(which causes depurination). The results are summarized in the table below, where a
“yes” indicates that the mutant is more sensitive than a normal fly, and “no” indicates
normal sensitivity. (6 points)

Mutant sunlight nitrous acid formic acid
Mut1 yes no no
Mut2 no yes no
Mut3 yes no no
Mut4 yes yes yes
Mut5 no no yes

A. Which mutant is most likely to be defective in the DNA repair polymerase?
Mut4 – 2 points (is more likely than the other mutants to be defective in the DNA
repair polymerase because Mut4 is defective in the repair of all three kinds of
DNA damage. The repair pathways for all three kinds of damage are similar in the
later steps, including a requirement for the DNA repair polymerase.)

B. Which mutant or mutants is likely to have a defect in recognizing or excising
thymidine dimers?
Mut1 and Mut3 (2 points)

C. Which mutant or mutants is likely to have a defect in recognizing or excising
mismatched U-‐G base pairs?
Mut2 (2 points)

12. The following is a sequence of DNA. The TATA box is marked with a box and the
start site of transcription is in bold. Write out the RNA sequence that would be
produced from this DNA. Be sure to label the 5’ and 3’ ends of the RNA. (2 points)

5’CTCTACTATATTCTCAATAGGTCCCACATGCCGCCATCT 3’
3’GAGATGATATAAGAGTTATCCAGGGTGTACGGCGGTACA 5’

5’AGGUCCCACAUGCCGCCAUCU 3’
1 point for correct strand, 0.5 pts for U, 0.5 pts for correct 5’ and 3’

4

13. Below is a sketch of a messenger RNA molecule hybridized to the template strand of
DNA from the corresponding gene. Use the following letters to label the location of
each term. (5 points)

D
B C

E
A. RNA
B. DNA
C. Promoter region
D. Intron
E. Poly A tail

14. If you digested the hybrid molecule above with S1 nuclease, and the DNA was
labelled with radioactivity, how many fragments would you observe after running
the product of the digestion on a non-‐denaturing gel? Please explain your answer (2
points)
1 band (1 pt) because it would still be hybridized to the RNA strand and would run
as one band (1 pt)

15. If you did the same experiment and ran the product of the digestion on a denaturing
gel how many fragments would you observe after running the gel? Please explain
your answer. (2 points)

3 bands (1 pt) because the denaturing gel would separate the DNA and RNA strand,
and due to the removal of the introns in the DNA it would be in 3 pieces.

16. In eukaryotes, how do ribosomes find the start site of translation? (2 points)
By scanning along the mRNA from the 5′ end

5
17. List three ways in which the process of eukaryotic transcription differs from the
process of bacterial transcription. (3 points)
Any three of the following:
In eukaryotes, mRNA is capped, spliced, and polyA tailed. None of these things
happen in bacteria.
Sigma factors specify the transcriptional start site in bacteria, but not eukaryotes.
In bacteria, transcription occurs in the cytoplasm; in eukaryotes, transcription
occurs in the nucleus.

18. Below is the sequence from the 3′ end of an mRNA.

5′-CCGUUACCAGGCCUCAUUAUUGGUAACGGAAAAAAAAAAAAAA-3′

This sequence contains the stop codon for the protein encoded by this mRNA. What
is the anticodon on the tRNA in the P-‐site of the ribosome when the release factor
binds to the A-‐site? (2 points)
The stop codon is UAA. The codon preceding the stop codon is UGG and will be bound
to a tRNA in the P-site of the ribosome when release factor binds to the A-site. The
anticodon of the tRNA will bind to the codon UGG and will be CCA.

19. Pictured below is an mRNA molecule.

Match the items given in the list below with the label lines above. (6 points)
a) ribosome-‐binding site (3)
b) initiator codon (2)
c) stop codon (4)
d) untranslated 3′ region (6)
e) untranslated 5′ region (1)
f) protein-‐coding region (5)

6
20. In E. coli, transcription of the genes required for tryptophan biosynthesis depends
on the levels of tryptophan available to the cell. Depending on the amount of
tryptophan, different stem loops can form in the trp leader sequence that
determines whether or not the trp biosynthetic proteins are produced. Would this
type of regulation work in a eukaryotic cell? Explain your answer. (2 points)
This kind of regulation in which translation of a leader peptide induces terminator hairpin
formation in the RNA transcript would not work in a eukaryotic cell because
transcription and translation are uncoupled (transcription occurs in the nucleus and
translation occurs in the cytoplasm).

21. You are interested in examining the Psf gene. It is known that Psf is normally
produced when cells are exposed to high levels of both calcium (Ca2+) and
magnesium (Mg2+). MetA, MetB, and MetC are proteins that bind to the promoter of
the Psf gene and are involved in regulating its transcription. MetA binds to the “A”
site in the promoter region, MetB to the “B” site, and MetC to the “C” site. You create
binding site mutations in the A, B, and C sites and observe what happens to
transcription of the Psf gene. Your results are summarized in the table below. (8
points) 2+ 2+
Transcription in the presence of Ca and/or Mg

binding sites present
No Ca2+ With With With Ca2+
or Mg2+ Ca2+ Mg2+ and Mg2+
A, B, and C ++
none
A only + +
B only
C only + +
A and B only +
A and C only + + ++
B and C only +

for this table: = no transcription of Psf,
+ = a low level of transcription of Psf, and
+ + = high levels of transcription of Psf

A. Which proteins are likely to act as gene activators?
Both Met A and MetC

B. Which proteins are likely to act as gene repressors?
MetB only

C. Which transcription factors are normally bound to the Psf promoter in the
presence of Mg2+ only?
MetA and MetB
D. Which transcription factors are normally bound to the Psf promoter in the
presence of both Mg2+ and Ca2+?
MetA and MetC

7
22. What likely effect would the following manipulations have on levels of beta-‐
galactosidase (encoded by the lacZ gene) in E. coli relative to a strain that has not
been altered or manipulated in the ways described below? Provide a brief
explanation of the molecular mechanism underlying the effect on beta-‐
galactosidase levels. (8 points)

1) Mutation in the – 35 sequence of the promoter for the lacI gene.
High level transcription would not occur because CAP is not bound in the presence
of glucose. In the absence of glucose, transcription would increase because this
mutation prevents transcription of the LacI repressor.

2) Insertion of 20 base pairs at position -‐20 of the promoter for the lacZYA operon.
The level would not change compared to cells that were growing in glucose because
the promoter would not be functional. Regardless of the condition, the mutant
strain would not express the lacZ gene.

3) Addition of only lactose to the growth medium of an E. coli strain.
The level of lacZ transcript would increase because lactose would bind to the
repressor which would release it from the DNA/operator region.

4) Addition of lactose and glucose to the growth medium of an E. coli strain.
The level of lacZ transcript would stay the same, because in the presence of glucose
the cap protein is not activating transcription of the lacZ gene.

23. You are working with a mutant strain of V. harveyi. This strain is lacking the luxS
gene, which makes the AI-‐2 molecule. Would you expect this strain to produce light
at high cell density? Why or why not (2 points)
This strain would make light at high cell density, provided that the cells around it
were also V. harveyi. It could sense cells of its own species through AI-‐1. It would
make light at high cell density as long as there were other Vibrios around, due to
Intra-‐Genera signaling (CAI-‐1). If these bacteria could no longer sense other
bacteria, the strain would no longer produce light.

24. Give two major causes for the emergence of infectious disease according to the
World Health Organization. (2 points)
Any two of the following:
Economic Development and Land Use
Breakdown of public Health Measures
International Travel and Trade
Technology and Industry
Human Demographics and Behavior
Microbial Adaptation and Change

8
25. You are studying two proteins (P and U) and you suspect that they might interact
with each other. You decide to test your idea by using yeast two-‐hybrid. The results
are summarized in the table below. Regardless of whether P or U is fused to the
DNA-‐binding domain (BD) or the activation domain (AD) of Gal4, you observe
expression of the lacZ reporter gene. Interestingly, when you express the U-‐AD
construct alone (in the absence of the P-‐BD construct), you also detect expression of
lacZ. Expression of the U-‐BD fusion alone does not drive expression of lacZ.

Why is the protein U-‐AD fusion alone sufficient to activate expression of lacZ?
Design an experiment to test your hypothesis. (4 points)
U is a DNA binding protein that binds to the Gal4 promoter. This positions
the AD to drive expression of lacZ. Note that since the U-BD fusion does
not drive expression of lacZ, U itself is not an activator. For the
experiment, any kind of assay to show that U and DNA co-purify is fine.

26. You are enthralled by the topic of quorum sensing. Describe an experiment that
would allow you clone the quorum sensing genes from the bacterium
Chromobacterium violaceum. It is useful to know that this quorum sensing system
controls the production of a bright purple pigment called violacein. (3 points)

Fragment the genome of the bacteria and clone it (make a library) of fragments.
Transform these plasmids (library) into bacteria cells and look for the colonies that
are purple.

9
27. You have identified a new gene in C. elegans. You have mapped its transcriptional
start site to the sequence 5’-‐ATGCATGCATGCATGCATCG-‐3’. (7 points)
A. You wish to prepare cDNA to determine this gene’s intron/exon structure. How
would make the cDNA to this gene? Be specific and include the sequences of any
primers you would use.
(3 points) Use a polyT primer which will recognize the poly A tail on the mRNA (-‐0.5
for saying poly A or poly U primer). Use reverse transcriptase (or RT-‐PCR) to
synthesize the first strand of cDNA. Degrade the RNA and make the second strand
by either adding C’s to the 3’ end of the first strand and use a poly G primer, OR use
the primer 5’ATGCATG3’.

B. Your experiment reveals that there are multiple cDNAs of different lengths
(isoforms) for this gene. What is the most likely explanation for this?
2 points – alternative splicing

C. You hypothesize that the different cDNA isoforms are expressed in different
tissues in the worm. Design an experiment to test your hypothesis. Be as specific as
possible.
2 points
Use each isoform to make a probe to use for in situ hybridization, OR RT-‐PCR using
RNA isolated from different tissues, OR RNA-‐seq/deep sequencing from different
tissue samples. 0.5 points given for using a reporter gene since this will only test
promoter activity, not differential splicing.

28. In the Fire and Mello Nature paper we read in class, what can you conclude from
each of the following pieces of data? (6 points)
A. RNAi targeted to the sequence of an unc-‐54 intron does not work.
2 points. RNAi must occur in the cytoplasm, because introns are removed in the
nucleus.

B. In situ hybridizations using a probe to detect mex-‐3 does not show staining
after mex-‐3 RNAi.

2 points. The mex-‐3 RNA is destroyed/degraded by the RNAi.

10
C. A genetic deletion of the unc-‐54 gene leads to animals that twitch but RNAi
targeted against unc-‐54 leads to paralysis.
2 points. This RNAi also targets a gene with similar sequence that results in a
different phenotype when targeted by RNAi

29. You have performed a microarray on the tumors of a number of patients who have
been diagnosed with leukemia. Your graduate advisor asks you to “cluster” the
results of the microarray, which are shown below.

A. What does your advisor want you to do, and how would the patients be located
relative to one another after this was performed? (3 points)
Essentially, your advisor wants you to group patients that have similar gene
expression patterns together. This could also include grouping genes that have
similar expression patterns together. Patients 1 and 3 should be next to each other.
Patients 2 and 5 should be next because they are the next closest, and then patient 4
isn’t that close to anyone.

B. What do these results suggest about the leukemia of patients 1 and 3? (2 points)
These results suggest that patients 1 & 3 have similar types of leukemia/their
disease is similar.

C. What do these results suggest about the leukemia of patients 2 and 4? (2 points)
These results suggest that patients 2 and 4 have different types of leukemia/their
disease is different or behaves differently.

D. Your advisor wants to know how much of each gene is being transcribed in Patient
5. Can you use the data you have already collected to determine this? Why or why
not? (2 points)
No, because microarray results only help you to determine relative amounts.

11
12

2013 Ak

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

2013 Ak

Uploaded by

Copyright:

Available Formats

MOL

Your exam code number is:

Write this number on each

Printed Name: ___________________________

Multiple Choice (18 points)

You might also like