Lipids
DOI 10.1007/s11745-016-4145-x
ORIGINAL ARTICLE
Celastrus Orbiculatus Thunb. Reduces Lipid Accumulation
by Promoting Reverse Cholesterol Transport in Hyperlipidemic
Mice
Ying Zhang1 · Yanhong Si1 · Lei Zhai1 · Shoudong Guo1 · Jilong Zhao2 · Hui Sang1 ·
Xiaofei Pang1 · Xue Zhang1 · Anbin Chen1 · Shucun Qin1 
Received: 14 January 2016 / Accepted: 15 March 2016
© AOCS 2016
Abstract  Previously, we found that Celastrus orbiculatus
Thunb. (COT) decreases athero-susceptibility in lipopro-
teins and the aorta of guinea pigs fed a high-fat diet, and
increases high-density lipoprotein (HDL). In the present
study, we investigated the effect of COT in reducing lipid
accumulation and promoting reverse cholesterol transport
(RCT) in vivo and vitro. Healthy male mice were treated
with high-fat diet alone, high-fat diet with COT (10.0 g/
kg/d), or general fodder for 6 weeks. Serum levels of total
cholesterol (TC), triglyceride (TG), HDL-C, non-HDL-C,
and 3H-cholesterol in plasma, liver, bile, and feces were
determined. Pathological changes and the levels of TC
and TG in liver were examined. The expression of hepatic
genes and protein associated with RCT were analyzed.
COT administration reduced lipid accumulation in the
liver, ameliorated the pathological changes, and less-
ened liver injury, the levels of TG, TC, and non-HDL-C
in plasma were decreased significantly, and COT led to a
significant increase in plasma HDL-C and apolipopro-
tein A (apoA1). 3H-cholesterol in plasma, liver, bile, and
feces was also significantly increased in COT-treated mice
compared to controls. Both mRNA and protein expression
of SRB1, CYP7A1, LDLR, ATP-binding cassette trans-
porters ABCA1, ABCG5, and LXRα were improved in
Y. Zhang, Y. Si contributed equally to this study.
* Shucun Qin
sdyrx@163.com
1 CYP7A1 Cholesterol 7-alpha hydroxylase
Key Laboratory of Atherosclerosis in the Universities
of Shandong and Institute of Atherosclerosis, Taishan
Medical University, Tai’an 271000, Shandong, China
2
Shandong Agricutural University, Tai’an 271000, Shandong,
China
COT-treated mice. An in vitro isotope tracing experiment
showed that COT and its bioactive ingredients, such as
celastrol, ursolic acid, oleanolic acid, and quercetin, sig-
nificantly increased the efflux of 3H-cholesterol. They also
increased the expression of SRB1, ABCA1, and ABCG1
significantly in macrophages. Our findings provided a posi-
tive role of COT in reducing lipid accumulation by pro-
moting RCT. These effects may be achieved by activating
the SRB1 and ABC transporter pathway and promoting
cholesterol metabolism via the CYP7A1 pathway in vivo.
The effective ingredients in vitro are celastrol, ursolic acid,
oleanolic acid, and quercetin.
Keywords  Celastrus orbiculatus Thunb. · Lipid
accumulation · Reverse cholesterol transport · Cholesterol
efflux · Isotope tracing
Abbreviations
COT  Celastrus orbiculatus Thunb
RCT Reverse cholesterol transport
HDL-C High-density lipoprotein cholesterol
apoA1 Apolipoprotein  A
TC Total cholesterol
TG Triglyceride
SR-B1 Scavenger receptor B1
ABCA1 ATP-binding cassette transporter G1
ABCG1 ATP-binding cassette transporter A1
CE Cholesterol ester
ABCG5 ATP-binding cassette transporters G5
ABCG8 ATP-binding cassette transporters G8
SR-B1 Scavenger receptor class B type 1
LXR Liver X receptor
TCMs Traditional Chinese medicines
AS Atherosclerosis
13
 Lipids
SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel
electrophoresis
CL Celastrol
RT Rutin
QC Quercetin
KF Kaempferol
OA Oleanolic acid
UA Ursolic acid
RT-PCR Real time PCR
LDL-R Low-density lipoprotein receptor
LSC Liquid scintillation counter
Introduction
Atherosclerotic cardiovascular disease is the leading cause
of morbidity and mortality in modern societies [1]. It is
well known that elevated levels of plasma total cholesterol
(TC) and triglyceride (TG) are associated with the devel-
opment of atherosclerotic cardiovascular disease. Reverse
cholesterol transport (RCT) is a cholesterol metabolism
pathway that transports cholesterol from the macrophage
foam cell in atherosclerotic plaque to the liver for excre-
tion in the bile [2]. Increasing evidence indicates that RCT
is a very important defense mechanism in atherosclerotic
diseases. The primary function of high density lipopro-
tein (HDL) is to mediate RCT, and cholesterol in HDL is
transported into hepatocytes through the scavenger recep-
tor B1 (SRB1) [3]. Cholesterol efflux from the macrophage
to HDL is mediated by ATP-binding cassette transporters
A1 and G1 (ABCA1 and ABCG1) on the membrane of the
macrophage, and then cholesterol or cholesterol ester (CE)
is transferred to the liver by HDL for bile acid synthesis
or excretion in the feces by ATP-binding cassette transport-
ers G5 and G8 (ABCG5 and ABCG8) [2]. Another essen-
tial enzyme involving RCT is CYP7A1, the rate-limiting
enzyme of bile acid synthesis. Expression of CYP7A1 is
down-regulated by sterol regulatory element binding pro-
teins when plasma cholesterol levels are low and up-regu-
lated by liver X receptor (LXR) when cholesterol levels are
high [4, 5].
Various anti-atherosclerosis medications or bioactive
components are reported to promote RCT by improving the
expression of certain transporters or key enzymes involved
[5, 6]. Cholesterol efflux is the initial step of RCT and has
become one of the therapeutic targets for atherosclerotic
disease [7]. Statins are the preferred drugs for stabilizing
atherosclerotic plaques because of their lipid-lowering,
anti-inflammatory and endothelial-protection activities.
However, they exhibit side effects and are effective in only
one-third of patients [8]. Some natural products, especially
traditional Chinese medicines, which possess similar lipid-
lowering, anti-inflammatory, and antioxidant activities,
13
are of interest as potential new drugs for the treatment of
atherosclerosis.
Celastrus orbiculatus Thunb. (COT), a member of
the Celastraceae family, is used to prevent and cure can-
cer and inflammatory diseases not only in China but also
in the United States and several European countries [9].
COT is a traditional herb and has been used for thousands
of years in China as a remedy against cancer, inflammatory
diseases, and neurodegenerative diseases [10] due to its
anti-oxidative and anti-inflammatory properties. The com-
position of COT is complex, including such compounds
as sesquiterpenes, flavonoids, and tripenes. Our previous
study showed that COT decreases athero-susceptibility
in lipoproteins and the aorta of guinea pigs fed a high-fat
diet by down-regulating the level of non-HDL-C in plasma
[11]. In this study, the effect of COT on RCT was investi-
gated in C57BL/6J mice, and its bioactive ingredients were
screened by an isotopic tracing assay in vitro.
Materials and Methods
Ethics Statement
This study was approved by the Laboratory Animal Care
Committee of Taishan Medical University, and all animal
experiments were conducted in accordance with the Guide-
lines of Care and Use of Laboratory Animals at the Taishan
Medical University.
Materials
Seven-week-old male C57BL/6J mice (SCXK2009-0004)
were obtained from Hua Fu Kang Biological Technol-
ogy Co., Ltd. (Beijing, China). The mice accessed diet
and water ad libitum and were kept in a temperature and
humidity-controlled room with a 12/12 h light–dark cycle.
Raw 264.7 macrophage was obtained from the Cell Bank
of the Chinese Academy of Sciences, Shanghai Institute
of Cell Biology (Shanghai, China). Primary antibodies
of CYP7A1, SRB1, LDLR, LXRα, ABCA1, apoA1, and
ABCG1 were obtained from Abcam (Cambridge, MA,
USA). Antibodies for β-actin were obtained from Santa
Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Stand-
ards of rutin, kaempferol, quercetin, celastrol, ursolic acid,
and oleanolic acid were purchased from the Drug and Bio-
logical Products Examination Center of China (Beijing,
China); purity of standards was above 98 % (w/w). The
primers for PCR were synthesized by Sangon Biotech Co.,
Ltd (Shanghai, China). TC and TG kits were purchased
from Applygen Technologies Inc. (Beijing, China). The
stems and roots of COT were collected from Mountain
Lipids
Tai in China and identified by Professor Li Tongde in the
School of Pharmacy, Taishan Medical University. 3H-cho-
lesterol was obtained from Perkin Elmer (Waltham, MA,
USA). Chow diet and high fat diet were obtained from Hua
Fu Kang Biological Technology Co., Ltd. (Beijing, China).
Preparation of COT Extract
The stems and roots were dried and minced using a grinder,
and the powder (1000 g) was soaked with 95 % ethanol
overnight (1:15, w:v). The ethanol extract of COT was fil-
tered and concentrated by a rotary evaporator, and 11.34 g
crude extract was obtained. Then the concentrate was
diluted to prepare solutions of 10.0 g crude drug/mL with
5 % sodium carboxymethylcellulose (CMC), which were
stored at 4 °C. Several important ingredients contained in
the stem and root were detected by capillary electrophore-
sis equipment (Beckman Coulter, Inc. Brea, CA, USA) as
shown in Table 1.
Preparation of ox‑LDL
Oxidized-low density lipoprotein (ox-LDL) was prepared
as described in a previous study [12]. Lipoprotein isolation
was done by sequential ultracentrifugation in an LE-80 K
ultracentrifuge (Beckman Coulter, Inc.) as described pre-
viously [13]. LDL was isolated at a density of 1.063 g/
mL and HDL3 was isolated at a density of 1.125–1.21 g/
mL [14]. The purified lipoproteins were dialyzed against
phosphate-buffered saline (PBS) for 48 h. LDL was incu-
bated and dialyzed in PBS (pH 7.2) containing 10 μmol/L
copper sulfate (CuSO4) for 12 h at 37 °C, and further dia-
lyzed in PBS containing 100 mmol/L ethylene diamine
tetraacetic acid (EDTA) for 24 h at 4 °C. Protein was
determined with a BCA assay kit, and the protein concen-
tration was adjusted to 1 g/L and stored at 4 °C. Malon-
dialdehyde (MDA) was determined by thibarbituric acid
Table 1  The contents of bioactive ingredients (OA, UA, CL, RT, KF,
QC) in Celastrus orbiculatus Thunb
Active ingredientsa Contents in sample (mg/g)
Root Stem
OA 0.26 ± 0.045 0.67 ± 0.051
UA 0.37 ± 0.026 0.16 ± 0.047
CL 5.13 ± 0.27 1.51 ± 0.29
RT – 1.80 ± 0.32
KF 0.16 ± 0.031 2.80 ± 0.24
QC 0.017 ± 0.009 0.0072 ± 0.15
a
  OA oleanolic acid, UA ursolic acid, CL celastrol, RT rutin, KF
kaempferol, QC quercetin
b
  Data are mean ± SD of at least three independent samples
methods (TBARS). Ox-LDL was identified using agarose
gel electrophoresis.
3
H‑Cholesterol‑Laden Cell Preparation
3
H-cholesterol-laden cells were prepared as described pre-
viously [15]. Briefly, Raw 264.7 cells were grown in RPMI/
HEPES supplemented with 10 % FBS. Cells were cultured
in Teflon flasks and radio-labeled with 5 µCi/mL 3H-cho-
lesterol and cholesterol-loaded with 100 µg/mL ox-LDL.
At 48 h later, cells were washed with RPMI/HEPES and
equilibrated for 4 h in fresh RPMI/HEPES supplemented
with 0.2 % BSA, then harvested for mice intraperitoneal
injection. The ratio of intracellular 3H-cholesterol and
total 3H-cholesterol in the cell suspension was determined
by liquid scintillation (Beckman Ls 6500, Beckman-Co.,
Carlsbad, California, USA).
Animal Management
Thirty-six male mice were divided into three groups
(n  = 12): regular chow diet (CD), high-fat diet (HFD,
15.8 % fat and 1.25 % cholesterol), and HFD with COT
(HFD + COT). They were fed daily by gastric gavage with
COT (10.0 g COT/kg/day mouse weight, dissolved in 5 %
sodium CMC at a dose of 10 mL/kg mouse weight for 12
mice) or 5 % sodium CMC (10 mL/kg mouse weight) only
for the CD and HFD groups. After 6 weeks, six mice in
each group were selected and 3H-cholesterol-labeled foam
cells (6.0 × 106 cells containing 6.1 × 105 counts per min-
ute in 0.5 mL MEM) were injected intraperitoneally into
each mouse. Blood was collected at 0, 12, 24, and 48 h
after injection. Feces were collected continuously at 24
and 48 h and stored at 4 °C before extraction of cholesterol
and bile acid. At study termination (48 h after injection),
mice were exsanguinated and perfused with cold PBS.
Liver and intestines were removed and stored at −70 °C for
3
H-cholesterol quantification by liquid scintillation. Plasma
and bile were also analyzed using liquid scintillation. The
remaining mice were used for detection of plasma lipids
(TC, TG, HDL-C, non-HDL-C) by an enzymatic method,
and the levels of apolipoprotein A1 (apoA1) in plasma
were analyzed by western blot. The levels of TC and TG in
liver were examined by an enzymatic method; histological
change of liver was detected by HE staining. mRNA and
protein expression were analyzed by real time polymerase
chain reaction (RT-PCR) and western blot.
Lipids Change in Animal Liver and Pathological
Examination
In order to observe lipids changing in animal liver, the
levels of TG and TC in animal liver were detected by an
13
 Lipids

enzymatic method according to the manufacturer’s instruc- dry milk for 2 h at room temperature, the membranes were
tions. In addition, a portion of liver tissue instantly fixed in incubated with antibody and β-actin overnight at 4 °C.
10 % phosphate buffered formalin was processed by rou- After being washed four times with TBS containing 0.1 %
tine histological procedures and then embedded in paraffin. Tween 20, the membranes were incubated with horse-
Tissue Sections (5 μm) were stained with HE for histo- radish peroxidase-conjugated antibodies for 1 h at room
pathological examination. temperature. Protein levels of ABCA1, SRB1, CYP7A1,
apoA1, LXRα, and LDLR were evaluated and referenced
Real Time PCR Experiments with Animal Liver with β-actin by western blot. The content of apoA1 in
plasma was also tested by western blot. Immunoblots were
Total liver mRNA was isolated by TRIZOL reagent (Invit- revealed by enhanced chemiluminescence reaction and
rogen, Carlsbad, CA, USA). The cDNA synthesis was per- visualized using a high-performance chemiluminescence
formed using MuLV Reverse Transcriptase (Applied Bio- film. The integrated optical density value of immunoreac-
systems, Foster, CA, USA). Real-time PCR was performed tive bands were quantified using Image-Pro Plus software
using an RT-PCR automatic analyzer (Rotor-Geneq, Qia- ver.6.0 (Media Cybernetics Corp, Bethesda, MD, USA)
gen, Germany) and a SYBR-green PCR master mix kit and normalized by β-actin.
(TianGen Biotech, Beijing, China). The data was analyzed
by using Rotor-gene Q software ver.1.7 (Qiagen). Relative Cell Culture and Cytotoxicity Assays
mRNA levels were calculated by the method of 2−∆∆Ct
and normalized against GAPDH. Each experiment was To find a suitable concentration for each compound, the
repeated three times. The primers (Sangon Biotech Co. Ltd, classical 3-(4,5)-dimethylthiahiazo (-z-yl)-3,5-diphe-
Shanghai) used for real time PCR are listed in Table 2. nytetrazoliumromide (MTT) method was used to evalu-
ate cell viability of the Raw 264.7 macrophage. Raw
Western Blot Experiments with Animal Liver 264.7 macrophages were cultured in high sugar DMEM
medium with 10 % (v/v) fetal calf serum, antibiotics (100
Fresh livers were harvested and homogenized. Then, the U/mL penicillin A, and 100 μg/mL streptomycin) and
total protein was extracted from liver tissue using a total maintained in a 37 °C humidified incubator containing
protein extraction kit (BestBio, Shanghai, China) accord- 5 % CO2. The effects of active ingredients on the varia-
ing to the manufacturer’s instructions. Equal amounts of tion of cell numbers were determined by the MTT assay.
protein were separated by 8–12 % sodium dodecyl sul- In total, 1 × 104 cells were seeded in 96-well plates. COT
fate polyacrylamide gel electrophoresis (SDS-PAGE) and and the active ingredients, such as rutin (RT), quercetin
transferred onto polyvinylidene fluoride (PVDF) mem- (QC), oleanolic acid (OA), and kaempferol (KF), were
branes by electroblotting. After blocking in Tris-buffered dissolved in DMSO and different concentration solu-
saline (TBS) containing 0.1 % Tween 20 and 10 % nonfat tions (0, 50, 100, 150, 200, and 400 μg/mL) were pre-
pared. Celastrol (CL) concentrations were 0, 0.1, 0.2,
Table 2  Primers used for real time PCR analysis
0.4, 0.6, and 0.8 μg/mL and ursolic acid (UA) concen-
trations were 0, 5, 10, 20, 40, and 60 μg/mL. Exponen-
Gene Primer Sequence (5′–3′) tially growing Raw 264.7 macrophages were incubated
ABCG5 Sense TGCCCTTTCTGAGTCCAGAG with active ingredients at various concentrations for 24 h
Anti-sense GTGCTCTTTCAATGTTCTCCAG before the MTT assay was performed. For this test, sam-
ABCG8 Sense ATGAGCTGGAAGACGGGCTG ples containing the proper concentration of DMSO were
Anti-sense GCCAGTGAGA GCAAGGCTGA used as a control. At the end of the cell growing period,
LDLR Sense AGGCTGTGGGCTCCATAGG
after being incubated with the drugs, Raw 264.7 mac-
Anti-sense TGCGGTCCAGGGTCATCT
rophages were washed twice with PBS, re-supplemented
SR-B1 Sense TCCCCATGAACTG TTCTGTGGA
with 200 μL culture medium containing 10 % MTT dye,
and incubated for 4 h. Cells were washed twice with PBS
Anti-sense TGCCCGATGCCCTTGA
and then suspended in 100 μL DMSO. The plates were
CYP7A1 Sense AGCAACTA AACAACCTGCCAGTACTA
placed in the dark, and continuous gentle shaking was
Anti-sense GTCCGGATATTCAAGGATG CA
applied for 30 min to dissolve the MTT dye thoroughly.
LXRα Sense CGACAGAGCTTCCGTCCACAA
The spectrometric absorbance was measured using a
Anti-sense GCTCGTTCCCCAGCAT TTT
micro-plate reader at 490 nm. In this experiment, the
GAPDH Sense TGGCCTCCAAGGAGTAAGAAAC
maximum tolerated concentration of COT and the active
Anti-sense GGGATAGGGCCTCTCTTGCT
ingredients for cells were detected.

13
Lipids
Cholesterol Efflux Experiments in Macrophages
Raw 264.7 macrophages were co-cultured with 1 µCi/mL
3
H-cholesterol and cholesterol loaded with 100 µg/mL ox-
LDL for 24 h and divided into five groups for each drug:
control group, HDL3 group, and three drug treatment
groups. HDL3 (100 μg/mL) and drugs were added to cul-
ture for 24 h. According to the cell cytotoxicity assay, the
maximum tolerated concentration of COT and its four com-
ponents (RT, QC, OA and KF) were 150 μg/mL and CL
concentrations were 0.4 μg/mL. UA concentrations were
20 μg/mL. For this test, samples containing 3H-cholesterol
and ox-LDL were used as controls; samples containing
HDL3 were positive groups. At the end of the cell grow-
ing period, the ratios of 3H-cholesterol and total 3H-cho-
lesterol intracellular were determined by liquid scintilla-
tion. For the determination of extracellular 3H-cholesterol,
culture solution was transferred into a borosilicate glass
tube, cells were rinsed twice with PBS (1 mL/time), and
the washing fluid was transferred into the borosilicate glass
tube. Solution was centrifuged (2000 rpm/min) for 10 min
at 4 °C. Then 200 μL supernatant and 2.5 mL scintillation
solution were blended together, and the value of extracel-
lular 3H-cholesterol was determined. For the determina-
tion of intracellular 3H-cholesterol, cells were added into
a 2 mL intermixture of normal hexane and isopropanol
(3:2  = v:v) and incubated for 30 min at a room tempera-
ture, eddied, and mixed for 5 min, then intracellular lipids
were extracted. This was done twice. The 200 μL super-
natant and 2.5 mL scintillation solution were blended
together, and the values of intracellular 3H-cholesterol were
determined. The ratio of total cholesterol efflux was calcu-
lated as the sum of intracellular 3H-cholesterol and extra-
cellular 3H-cholesterol. In this study, more than 95 % of the
3
H-cholesterol was taken up by cultured macrophages.
Experiments with COT and its bioactive Ingredients
for ABCA1, ABCG1 and SRB1 Expression
in Macrophages
Raw 264.7 macrophages were cultured in high sugar
DMEM medium with 10 % (v/v) fetal calf serum, antibiot-
ics (100 U/mL penicillin A and 100 μg/mL streptomycin),
and maintained in a 37 °C humidified incubator containing
5 % CO2 for 24 h and divided into a control group (CD) and
15 drug treatment groups. Each drug was divided into a low
dose group (L), a middle dose group (M) and a high dose
group (H). Drugs were added to culture for 12 h. The final
concentrations of COT, QC, and OA were 50, 100, 150 μg/
mL. CL concentrations were 0.1, 0.2, and 0.4 μg/mL, and
UA concentrations were 5, 10, and 20 μg/mL. Samples
containing the proper concentration of DMSO were used
as a control. At the end of the cell growing period, total
protein extracted from cultured cells was separated by
SDS-PAGE. The proteins were transferred on PVDF mem-
branes. Protein levels of ABCA1, ABCG1, and SRB1 were
evaluated and referenced with β-actin by western blot. The
target bands were quantified using Image-Pro Plus software
ver. 6.0 (Media Cybernetics Corp.).
Statistical Analysis
Data were reported as mean ± standard deviation (SD) and
subjected to analysis-of-variance analysis. F-test and the
Student-Neuman-Keuls post-test analyses were performed
on these data to analyze the variances and significances
between groups. Probability values less than 0.05 were
considered significant.
Results
Effects of COT on Body and Liver Weight of Mice
Body weight was measured at week 0 and 6 and liver
weight was measured at week 6. After 6 weeks treatment,
a significant difference in the body weight was observed in
each group. As shown in Table 3, compared with the CD
group, body weight was increased by 18.63 % after HFD
treatment. COT treatment prevented increases in body
weight due to the HFD (mice fed vehicle) by 15.33 %.
Liver weight was increased significantly by 23.15 % in the
HFD group compared with the CD group. COT prevented
increases significantly by 17.29 % in liver weight due to the
HFD.
Effects of COT on Plasma Lipids
The levels of TG, non-HDL-C, and TC in plasma were
increased significantly in the HFD group compared to the
CD group (P < 0.05; P < 0.01), and decreased by 15.26,
Table 3  Comparison of body weight and liver weight of mice
Groupa Body weight (g)b Liver weight (g)b
0 week 6 weeks 6 weeks
CD 19.36 ± 0.63 25.18 ± 1.23 1.08 ± 0.17
HFD 20.17 ± 1.28 29.87 ± 1.46c 1.33 ± 0.22
HFD + COT 20.45 ± 1.19 25.29 ± 1.55d 1.10. ± 0.18
Weight difference between week 0 and week 6
a
  CD, regular chow diet; HFD, high-fat diet; HFD + COT, high-fat
diet + Celastrus orbiculatus Thunb
b
  Data (mean ± SD, n = 12) were expressed as grams
c
  P < 0.05 versus control group
d
  P < 0.05 versus HFD group
13
 Lipids

Fig. 1  Plasma triglyceride (TG), non-high density lipoprotein cho-
lesterol (non-HDL-C) and total cholesterol (TC) were decreased,
high-density lipoprotein cholesterol (HDL-C) and apolipoprotein A1
(apoA1) were increased significantly in the Celastrus orbiculatus
Thunb. (COT) group. Plasma TG (a), non-HDL-C (b), TC (c), and
HDL-C (d) were determined by enzyme methods. The apoA1 (e) was
analyzed by Western Blot. Data (mean ± SD, n = 6) are expressed as
mg per deciliter. *P < 0.05; **P < 0.01 versus CD group; #P < 0.05;
##
P < 0.01 versus HFD group

51.56, and 21.70 %, respectively, in the COT group com-

pared to the HFD group (P < 0.05; P < 0.01) (Fig. 1a–c). In
addition, compared with the HFD group, COT significantly
improved the expression of HDL-C and apoA1 in plasma
by 27.41 and 59.12 % (Fig. 1d, e) (P < 0.05, P < 0.01).

Effects of COT on Lipid Accumulation in Liver

The HE staining experiment showed that the CD group

showed a normal lobular architecture with central veins and
radiating hepatic cords. After a high-fat diet for 6 weeks,
a large amount of lipid droplets appeared in hepatocytes
and denaturation and even necrosis was present in parts
of the hepatocytes in the HFD group. The pathological
changes were significantly attenuated by COT (Fig. 2a–c).
Enzymatic experiments also showed that the levels of TC
and TG in liver decreased by 34.36, 13.24 % (P < 0.01,
P < 0.05) in the COT group compared with the HFD group Fig. 2  COT decreased the TC and TG levels in liver and ameliorated
(Fig. 2d). the pathological changes in C57BL/6J mice fed a high-fat diet. The
histological change in liver was shown by HE staining. a–c Were the
CD group, HFD group, and COT group, respectively. The levels of
Effects of COT on RCT TC and TG (d) were determined by enzymatic methods. Data are pre-
sented as mean ± SD (n = 6). e The levels of TG and TC in different
To evaluate the effects of COT on RCT, a classical isotope- groups of mice liver. **P < 0.01 versus CD group; ##P < 0.01 versus
HFD group
labeled cholesterol tracing assay was employed. Compared
with the HFD group, plasma 3H-labeled cholesterol was
increased in the COT group by 37.53 % (P < 0.01) and suggest that COT enhances cholesterol transport from the
27.07 % (P < 0.01) at 12 and 24 h, respectively, but there macrophages to plasma during the first 24 h. 3H-labeled
was no significant difference at 48 h (Fig. 3a). These results cholesterol was increased by 48.15 % in liver after COT

13
Lipids
Fig. 3  Celastrus orbiculatus Thunb. (COT) promoted reverse
cholesterol transport in C57BL/6J mice. Mice were treated with
either vehicle or high-fat diet alone or high-fat diet with COT for
6 weeks. 3H-cholesterol-labeled and ox-LDL-loaded Raw264.7 cells
(6.0  × 106 cells containing 6.1 × 105 counts per minute in 0.5 mL
MEM per mouse) were injected intraperitoneally. Plasma (a) was
collected at 0, 12, 24, and 48 h after injection for liquid scintillation
counting, and the levels were expressed as the percentage of total
treatment (Fig. 3b). As shown in Fig. 3c, compared with
the HFD group, 3H-cholesterol accumulation in the bile
was increased by 17.06 % (P < 0.05) after COT treatment
and the fecal 3H-tracer level was increased significantly by
46.15 % in the COT group at 0–24 h (Fig. 3d), but there
counts per minute. At the end of the study (48 h after injection), mice
were exsanguinated and perfused with cold PBS, and portions of liver
tissue (b), bile (c) and intestine (e) were removed and flash-frozen
for 3H-tracer analysis by liquid scintillation. Feces were collected
continuously at 24 h (d) and 48 h and stored at 4 °C before analysis
of 3H-tracer (mean ± SD, n = 6),*P < 0.05, **P < 0.01 versus CD
group; #P < 0.05, ##P < 0.01 versus HFD group
were no marked changes at 24–48 h (P > 0.05), the fecal
3
H-tracer levels in the CD, HFD, and COT group were
4.21, 4.27, and 4.37 %, respectively. The 3H-tracer level
was not significantly changed in the intestine (P > 0.05)
(Fig. 3e).
13
 Lipids
Fig. 4  Celastrus orbiculatus Thunb. (COT) enhanced the mRNA
expression of scavenger receptor B1 (SRB1) (a), cholesterol 7 alpha-
hydroxylase (CYP7A1) (b), liver X receptor (LXRα) (c), low den-
sity lipoprotein LDL receptor (LDLR) (d), ATP-binding cassette
transporters G5 (ABCG5) (e) and G8 (ABCG8) (f) in mouse liver.
Effects of COT on mRNA expression of hepatic genes were deter-
13
mined by real-time polymerase chain reactions. Data were calculated
after adjusting for GDAPH using the 2−∆∆Ct method. Expression of
mRNA is indicated as fold differences compared with control mice
(n = 6). *P < 0.05, versus control group; #P < 0.05, ##P < 0.01 versus
HFD group. Data are presented as the mean ± SEM of at least three
independent experiments
Lipids
Effects of COT on Related RCT Enzymes
and Transporters
To investigate the potential mechanisms of COT on RCT,
the expression of related enzymes, transporters, and tran-
scription factors in the liver (SRB1, CYP7A1, LXRα,
LDLR, and ABCG5/g8) were determined by real-time
PCR. As shown in Fig. 4, compared with the HFD group,
COT treatment enhanced the mRNA expression of SRB1
and CYP7A1 by 15.29 and 23.39 %, respectively (P < 0.05)
(Fig.  4a, b). The mRNA expression of LXRα and LDLR
increased by 12.97 and 41.67 %, respectively (P < 0.01)
(Fig. 4c, d). Moreover, COT treatment enhanced the mRNA
expression of ABCG5 by 17.96 %, while there was no dif-
ference in ABCG8 (Fig. 4e, f). Western blot experiments
showed that COT improved the expression of the hepatic
gene involved in RCT in the liver. As shown in Fig. 5, there
were no significant differences, such as liver protein levels
of ABCA1 and CYP7A1, between the HFD group and the
CD group (P > 0.05). Compared with the HFD group, COT
treatment enhanced the protein expression of ABCA1 and
CYP7A1 by 123.51 and 192.07 %, respectively (Fig. 5a,
b). Compared with the CD group, liver protein levels of
SRB1, LDLR, LXRα, apoA1 were increased significantly
in the HFD group (P < 0.01). COT treatment enhanced the
protein expression of SRB1, LDLR, LXRα, and apoA1 by
42.31, 140.31, 104.02, and 45.65 %, respectively, com-
pared to the HFD group (Fig. 5c–f).
MTT Experiments
In general, cell death increases significantly with the drug
concentration. This is the first report of COT with RCT
activity, and the effective components are not known.
Therefore, the previously reported bioactive ingredients of
COT such as CL, RT, QC, KF, OA, and UA were used to
evaluate the RCT effect in vitro. As shown in Fig. 6, there
was no significant influence of the compounds on cell death
under the concentrations screened: COT, QC, RT, OA, and
KF (50–150 μg/mL), UA (5–20 μg/mL), and CL (0.1–
0.4 μg/mL). Beyond the above range, cell death increased
significantly with the drug concentration. The concentra-
tions for the subsequent RCT experiments were partially
based on the MTT results (Fig. 6).
Effects of COT and its Bioactive Ingredients
on Cholesterol Efflux in the Raw 264.7 Macrophage
To evaluate the effects of COT on RCT in vitro, a classi-
cal isotope-labeled cholesterol-tracing assay was employed
using the Raw 264.7 macrophage. COT and four compo-
nents improved 3H-cholesterol efflux in a dose-dependent
manner within the concentrations assayed (Fig. 7a–d, g).
Compared with the HDL3 group, COT improved the
3
H-cholesterol efflux by 21.50 % at the dosage of 150 μg/
mL (P < 0.01). CL exhibited the best effect, followed by
UA, OA, and QC. Compared with the HDL3 group, CL
and QC increased 3H-cholesterol significantly by 22.13 and
17.59 %, respectively, at the highest dosage (P < 0.01). OA
and UA are isomerides and increased the 3H-cholesterol
efflux significantly (P < 0.01) at dosages of 50 and 5 μg/
mL, respectively. Compared with the HDL3 group, KF
decreased cholesterol efflux (Fig. 7f) in a dose-dependent
manner and RT promoted cholesterol efflux, but with no
significant difference (Fig. 7e).
Effects of COT and its Bioactive Ingredients on SRB1,
ABCA1 and ABCG1 Expressions in the Raw 264.7
Macrophage
To further elucidate the effect of COT and its bioactive
ingredients on ABCA1, ABCG1, and SRB1, the Raw 264.7
macrophage were treated with 50, 100, and 150 μg/mL of
COT, QC or OA, 0.1, 0.2, and 0.4 μg/mL of CL, or 5, 10,
and 20 μg/mL of UA. Compared with the control group,
COT and its bioactive ingredients all increased SRB1,
ABCA1, and ABCG1 protein levels. Especially, the mid-
dle and high doses of COT improved SRB1, ABCA1, and
ABCG1 protein levels significantly (Fig. 8a, b) (P < 0.01).
The effects of COT on ABCA1 and SRB1 were similar to
those in the liver setting (Fig. 5a, c). As shown in Fig. 8c,
d, the effects of CL on SRB1 were significant (P < 0.01);
both the middle and high doses improved SRB1, ABCG1
and ABCA1. UA improved SRB1, ABCG1, and ABCA1
in a dose-dependent manner and had a significant effect
(P < 0.01) at the highest dose (Fig. 8e, f). OA also showed
dose-dependent improvement in SRB1, ABCG1, and
ABCA1, which was significant (P < 0.01) in each dose
group (Fig. 8g, h). Compared with the control group,
no improvement in ABCG1 expression was observed at
the three doses of QC, but SRB1 expression levels were
improved significantly at the high dose, and ABCA1
expression levels were improved significantly at the middle
and high doses (P < 0.01), respectively (Fig. 8i, j).
Discussion
It is known that the RCT pathway includes a series of
steps beginning in peripheral tissues with the efflux of
cholesterol or cholesterol esters (CE) to HDL and ending
in the liver and the gastrointestinal tract with the secre-
tion of cholesterol into bile and clearance through feces.
Among these series of steps, HDL and the related cho-
lesterol transporters play crucial roles. A high level of
HDL-C can reduce the risk of atherosclerosis, and apoA1
13
 Lipids

13
 Lipids
◂Fig. 5  Celastrus Orbiculatus Thunb. (COT) enhanced the protein
expression of ATP-binding cassette transporters A1 (ABCA1) (a),
cholesterol 7 alpha-hydroxylase (CYP7A1) (b), scavenger receptor
B1 (SRB1) (c), LDL receptor (LDLR) (d), liver X receptor α (LXRα)
(e), and apolipoprotein A1 (apoA1) (f) in mouse liver (n  = 6).
**P < 0.01 versus control group; ##P < 0.01 versus HFD group. Data
are presented as the mean ± SEM of at least three independent exper-
iments
is the major protein constituent of HDL. In this study, we
found that COT increased the plasma levels of HDL-C
and apoA1 (Fig. 1d, e) significantly (P < 0.05, P < 0.01).
This indicates that COT can discharge peripheral choles-
terol by RCT and alleviate cholesterol accumulation in
vivo in locations such as the arterial wall. We also found
that the levels of TC, TG, and non-HDL-C were increased
significantly in the HFD group (P < 0.01), and they were
decreased significantly (P < 0.05, P < 0.01) in the COT
group compared to the HFD group. A non-HDL-C low-
ering effect and a HDL-C increasing effect of COT on
guinea pigs previously reported by us [11] were consistent
with our findings in C57BL/6J mice in the present study
(Fig. 1b, d).
Our previous studies reported that COT improved the
plasma lipid profile in guinea pigs fed a high-fat diet [11].
Whether or not COT is beneficial to RCT in other animal
models remains unknown. In this study, we selected male
C57BL/6J mice as animal models to confirm the effects of
COT on promoting RCT. Our results provide evidence for
the first time that COT reduces lipid accumulation in the
liver (Fig. 2) and promotes RCT from intraperitoneal mac-
rophages to feces in the murine model (Fig. 3). After intra-
peritoneal injection of 3H-cholesterol-loaded macrophages,
isotopic contents in plasma, liver, bile, feces, and the intes-
tinal wall were determined. The results showed that COT
Fig. 6  The effects of Celastrus Orbiculatus Thunb. (COT) and its
bioactive ingredients on cell viability were detected by MTT meth-
ods. Exponentially growing Raw 264.7 macrophages were incubated
with active ingredients at various concentrations for 24 h before the
MTT assay was performed. Each bioactive ingredient corresponds
with different cell viability; there was no significant difference within
increased cholesterol discharge in the liver pathway, but not
in the intestinal discharge pathway.
Accumulating evidences has shown that RCT is a defen-
sive mechanism to attenuate atherosclerotic lesions [4, 16].
Various enzymes and cholesterol transporters play crucial
roles in the RCT pathway. Researchers have found that
peripheral ABCA1 and ABCG1 are the main transporters
for transferring cholesterol to plasma HDL, and hepatic
SRB1 plays a critical role in cholesterol uptake from
plasma to the liver [17, 18]. SRB1 mediates the exchange of
cholesterol between HDL and cells, and is a crucial factor
in the transport of excessive cellular cholesterol from extra-
hepatic tissues to the liver (“reverse cholesterol transport”)
and also is a factor for cholesterol homeostasis. Hepatic
SRB1 mediates transfer of HDL-cholesterol to the hepato-
cytes where cholesterol may be metabolized to bile acids
[19]. In the liver cells, SRB1 can identify and combine
with the apoA1 in HDL-C. SRB1 can transfer CE in the
center of HDL to liver cells. Furthermore, plasma HDL-C
is closely related to ABCA1 and ABCG1 expression [18].
Our study showed that COT increased the expression of
SRB1 and apoA1 in the liver (Figs. 4a, 5c, f). This indi-
cates that COT promoted RCT by increasing the expression
of SRB1. COT increased HDL-C concentration in plasma
(Fig. 1d) and eliminate plasma 3H-cholesterol more rapidly
(Fig.  3a) than in the HFD group and the CD group. This
is because COT enhanced significantly the HDL level by
affecting the expressions of ABCA1 and g1 and moderately
improved hepatic SRB1 expression.
Liver cholesterol could be affected by de novo synthe-
sis, and liver cholesterol excretion. The main pathway of
liver cholesterol consumption is bile acid synthesis, and
the primary rate-limiting enzyme of bile acid synthe-
sis is CYP7A1 [20]. Our data showed COT significantly
the drug concentration range. The maximum concentrations of COT,
QC, RT, OA, and KF to secure cell viability were 150 μg/mL; UA
was 20 μg/mL, and CL was 0.4 μg/mL, respectively. OA oleanolic
acid, UA ursolic acid, CL celastrol, RT rutin, KF kaempferol, and QC
quercetin. Data are presented as the mean ± SEM of at least three
independent experiments
13
 Lipids
Fig. 7  Effects of Celastrus orbiculatus Thunb. (COT) and its bioac-
tive ingredients on intracellular cholesterol efflux. 3H-cholesterol-
laden macrophages were harvested and counted by liquid scintillation
increased its expression (Figs. 4b, 5b). This suggests that
COT might improve cholesterol uptake of liver and utiliza-
tion of cholesterol by bile acid synthesis, thus leading to the
promotion of RCT. Therefore, the positive effect of COT
on CYP7A1 expression might be the primary reason that
3
H-cholesterol accumulates in bile and in feces (Fig. 3c, d).
13
(n = 6). a CL, b QC, c OA, d UA, e RT, f KF, g COT. **P < 0.01 ver-
sus control; #P < 0.05, ##P < 0.01 versus HDL3 group. Data are pre-
sented as the mean ± SEM of at least three independent experiments
The increase of CYP7A1 expression may be one of the rea-
sons for reduction of liver cholesterol.
LDLR plays a major role in the regulation of plasma
LDL-C by mediating nearly two-thirds of LDL ingres-
sion into the liver for clearance, and its expression in the
liver is negatively correlated with the hepatic cholesterol
Lipids
level [21]. Our study revealed that the level of LDLR was
increased in the HFD group compared to the CD group
(Fig.  5d). This is because increased LDLR expression
might be a compensatory effect to maintain cholesterol
homeostasis in the liver and intestinal tract [21]. LDLR
was compensatorily increased to a decrease of LDL level
induced by HFD in order to maintain the LDL steady-state
in plasma (Fig. 1b). Study also showed that the mRNA
and protein levels of LDLR in C57BL/6 J mice were up-
regulated (Figs. 4d, 5d) significantly after COT treatment.
These results indicate that COT could accelerate transport
of cholesterol from plasma to liver through the up-regula-
tion of LDLR expression.
Dietary cholesterol absorption and bile acid secretion
are important determinants of cholesterol metabolism.
ABCG5 and ABCG8 are two ABC half-transporters, which
form a heterodimer in liver and small intestine. ABCG5/
ABCG8 heterodimers mediate the efflux of dietary choles-
terol out of the intestinal cells, whereas in hepatocytes, they
mediate the efflux of sterols into the bile [22]. In this study,
COT improved the expression of ABCG5 in liver sig-
nificantly (P < 0.05) compared with the CD and the HFD
groups (Fig. 4e). However, there was no difference in the
expression of ABCG8 in the liver (Fig. 4f). This indicates
that ABCG5 plays a role in excretion of sterols into bile.
The effects of ABCG8 and ABCG5 that mediate the efflux
of dietary cholesterol out of the intestine remain uncertain
and will be investigated in our future study. LXR senses
intracellular cholesterol content and initiates various adap-
tive mechanisms, protecting the cell from imbalance of
cholesterol homeostasis [23]. Many genes involved in RCT,
such as ABCA1/g1, SRB1, CYP7A1, and ABCG5/g8, are
regulated by LXR and our data showed that COT promoted
LXR expression in liver (Fig. 4c). The expression of SRB1,
LDLR, and CYP7A1 were increased in keeping with LXR
in the COT group. This suggests that COT treatment might
participate in the expression of LXR subunits.
COT is a medicinal plant widely distributed in China
and is mainly composed of total flavonoids and terpe-
noids, which are responsible for attenuating atherosclerotic
lesions due to their antioxidant activity. Some flavonoids
[24–27] and terpenoids [28, 29] are also bioactive com-
pounds with potential lipid-lowering effects. In the present
study, we determined that the contents of flavonoids and
terpenoids were as follows: CL, UA, KF, and OA- 5.13,
0.37, 0.16, and 0.26 mg/g in the root and 1.51, 0.16, 2.80,
and 0.67 mg/g in stems, respectively. The contents of QC
are 0.017 mg/g in the root and 0.0072 mg/g in stems. The
content of RT is 1.80 mg/g in stems. Results indicate that
flavonoids and terpenoids are abundant in COT, and that
they may be the effective components of COT on RCT.
An in vitro study found that the flavonoid pigment
QC enhanced ABCA1 expression and cholesterol efflux
through a p38-dependent pathway in macrophages [30].
Another flavonoid, KF, has been shown to exert several
beneficial effects on cardiovascular and nervous systems,
such as the reduction of hydroxyl radicals [31], and the
inflammatory response in macrophage cells [32]. As a fla-
vonoid, QC has a wide range of biological functions associ-
ated with the modulation of oxidative stress and inflamma-
tory processes [33–35]. In addition, QC is able to reduce
plasma cholesterol levels in hyperlipidemia animals [36–
38]. In the present study, we found that QC and COT both
promoted 3H-cholesterol efflux from macrophages (Fig. 7b,
g).
CL, an active quinone methide triterpene extracted
from the root bark of the Chinese medicine “Thunder of
God Vine” (tripterygium wilfordii Hook F.), attenuates
hypertension-induced inflammation and oxidative stress
in vascular smooth muscle cells via hemoxygenase-1
induction [39], inhibits cholesterol ester accumulation
in macrophages, and decreases vascular smooth muscle
cell proliferation [40]. In the present study, CL signifi-
cantly promoted 3H-cholesterol efflux from macrophages
(Fig. 7a), which indicates that CL might promote RCT via
mediating cholesterol efflux to play an anti-atherosclerosis
role. Hepato-protective and anti-tumoral activities of OA
have long been recognized [41], and some evidence indi-
cates that it has potential antiatherogenic effects. Chronic
administration of OA to Dahl salt-sensitive rats demon-
strated antihyperlipidemic, antioxidant, and antihyperten-
sive effects [42]. The present study showed that three doses
OA promoted 3H-cholesterol efflux significantly (Fig. 7c).
It indicated that OA could promote cholesterol efflux to
alleviate cholesterol accumulation in vivo.
The results of this study provide evidence for the first
time that COT reduces lipid accumulation and amelio-
rates the pathological changes of a high-fat diet in the liver
(Fig. 2) by promoting RCT in the mice and macrophages.
Furthermore, some effects of bioactive components on RCT
were proved to occur by 3H-cholesterol efflux experiments.
COT and its bioactive components not only increased the
expression of macrophage SRB1, but also ABCG1 and
ABCA1 (Fig. 8), which might play a role, at least in part,
in promoting the first step of RCT by COT and its bioac-
tive components. The study indicated that these compounds
displace apoA-1 from HDL, thus increasing the efficiency
of ABCA1-mediated cholesterol efflux, compared to intact
HDL.
In addition, we found that administration of COT sig-
nificantly prevented increases of the body weight and liver
weight gain in a C57BL/6J mice model of hyperlipidemia
(Table  3), which was consistent with our previous report
[11]. The reason may be that the lipid-lowering activity
of COT was associated with the up-regulation of genes
involved in lipid metabolism in the liver, including LDLR,
13
 Lipids

13
 Lipids
◂ Fig. 8  Celastrus orbiculatus Thunb. (COT) and its bioactive ingre-
dients stimulated the expression of SRB1, ABCA1, and ABCG1
in Raw264.7 macrophages. Protein levels of ABCA1 and ABCG1
and SRB1 in Raw264.7 macrophages were determined after treat-
ment with COT, quercetin (QC), oleanolic acid (OA) 0, 50, 100, and
150 µg/mL; ursolic acid (UA) 0, 5, 10, and 20 µg/mL; celastrol (CL)
0, 0.1, 0.2, and 0.4 µg/mL. a, b Effects of COT on ABCA1, ABCG1,
and SRB1 expression. c, d Effects of CL on ABCA1, ABCG1, and
SRB1 expression. e, f Effects of UA on ABCA1 and ABCG1 and
SRB1 expression. g, h Effects of OA on ABCA1, ABCG1 and SRB1
expression. i, j Effects of QC on ABCA1, ABCG1, and SRB1 expres-
sion. CD Control dose group, L low-dose group, M middle-dose
group, H high-dose group. **P < 0.01 versus CD group. Data are pre-
sented as the mean ± SEM of six independent experiments
CYP7A1, and SRB1, or maybe it is related to the COT-to-
gastrointestinal reaction.
To summarize, the current study revealed that COT
promotes RCT in C57BL/6J mice by raising HDL-C and
improving the expression of hepatic SRB1, CYP7A1,
LXRα, ABCG5, and LDLR. An in vitro study also showed
that CL, QC, OA, and UA promoted macrophage cho-
lesterol efflux by increasing the expressions of SRB1,
ABCA1, and ABCG1. This indicates that these substances
were bioactive components affecting RCT. These find-
ings suggest that COT is an effective Chinese medicine to
reduce lipid levels and improve RCT and add to the accu-
mulating evidence for bioactive components of COT in
cholesterol metabolism. To further understand the mecha-
nisms of COT on RCT, its bioactive components as studied
in vitro in the present study need to be investigated in vivo.
Acknowledgments  This research was supported by financial dona-
tions from the Taishan Scholars Foundation of Shandong Province
(200867), University of Science and Technology Plan Projects Fund
of Shandong Province (J121M01), Taian City Technology Develop-
ment Plan (201440774-03), Key development projects of Shandong
province (2015GSF119008), and the Shandong Provincial Natural
Science Fund (ZR2013HL063, ZR2013HQ014).
Compliance with Ethical Standards  and the expression of ATP-binding cassette transporter A1 and
Conflict of interest  The authors have declared that no conflict of
interest exist.
References
1. Assmann G, Cullen P, Jossa F, Lewis B, Mancini M (1999)
Coronary heart disease: reducing the risk: the scientific back-
ground to primary and secondary prevention of coronary heart
disease. A worldwide view. International task force for the pre-
vention of coronary heart disease. Arterioscler Thromb Vasc Biol
19:1819–1824
2. Lewis GF, Rader DJ (2005) New insights into the regulation of
HDL metabolism and reverse cholesterol transport. Circ Res
96:1221–1232
3. Wang X, Collins HL, Ranalletta M, Fuki IV, Billheimer JT,
Rothblat GH, Tall AR, Rader DJ (2007) Macrophage ABCA1
and ABCG1, but not SR-BI, promote macrophage reverse cho-
lesterol transport in vivo. J Clin Invest 117:2216–2244
4. Rader DJ, Alexander ET, Weibel GL, Billheimer J, Rothblat
GH (2009) The role of reverse cholesterol transport in animals
and humans and relationship to atherosclerosis. J Lipid Res
50(Suppl):S189–S194
5. Naik SU, Wang X, DaSilva JS, Jaye M, Macphee CH, Reilly MP,
Billheimer JT, Rothblat GH, Rader DJ (2006) Pharmacologi-
cal activation of liver X receptors promotes reverse cholesterol
transport in vivo. Circulation 113:90–97
6. Moon M, Lee MS, Kim CT, Kim Y (2007) Dietary chitosan
enhances hepatic CYP7A1 activity and reduces plasma and liver
cholesterol concentrations in diet-induced hypercholesterolemia
in rats. Nutr Res Pract 1:175–179
7. Cavelier C, Lorenzi I, Rohrer L, von Eckardstein A (2006) Lipid
efflux by the ATP-binding cassette transporters ABCA1 and
ABCG1. Biochim Biophys Acta 1761:655–666
8. Beltowski J, Wojcicka G, Jamroz-wisniewska A (2009) Adverse
effects of statins-mechanisma and consequences. Curr Drug Saf
4:209–228
9. Qian YY, Zhang H, Hou Y, Yuan L, Li GQ, Guo SY, Hisamits T,
Liu YQ (2012) Celastrus orbiculatus extract inhibits tumor angi-
ogenesis by targeting vascular endothelial growth factor signal-
ing pathway and shows potent antitumor activity in hepatocarci-
nomas in vitro and in vivo. Chin J Integr Med 18:752–760
10. Jin HZ, Hwang BY, Kim HS, Lee JH, Kim YH, Lee JJ (2002)
Antiinflammatory constituents of Celastrus orbiculatus inhibit
the NF-kappaB activation and NO production. J Nat Prod
65:89–91
11. Zhang Y, Si YH, Yao ST, Yang NN, Song GH, Sang H, Zu DD,
Xu X, Wang J, Qin SC (2013) Celastrus orbiculatus Thunb.
Decreases athero-susceptibility in lipoproteins and the aorta of
guinea pigs fed high fat diet. Lipids 48:619–631
12. Qin L, Qin XP, Wang Z, Zhu BY, Liao DF (2006) Effect of
pravastatin on cholesteryl esters in foam cells and the relation
with caveolin-1. Acta Physiol Sin 58:47–52 (Chinese, English
abstract)
13. Sherman MP, Aeberhard EE, Wong VZ, Griscavage JM, Ignarro
LJ (1993) Pyrrolidine dithiocar -bamate inhibits induction of
nitric oxide synthase activity in rat alveolar macrophages. Bio-
chem Biophys Res Commun 191:1301–1308
14. Chapman MJ, Mills GL, Ledford JH (1975) The distribution
and partial characterization of the serum apolipoproteins in the
guinea pig. Biochem J 149:423–436
15. Yu Y, Si YH, Song GH, Luo T, Wang JF, Qin SC (2011) Etha-
nolic extract of propolis promotes reverse cholesterol transport
G1 in mice. Lipids 46:805–811
16. Zhang Y, Da Silva JR, Reilly M, Billheimer JT, Rothblat GH,
Rader DJ (2005) Hepatic expression of scavenger receptor class
B type I (SR-BI) is a positive regulator of macrophage reverse
cholesterol transport in vivo. J Clin Invest 115:2870–2874
17. Van Eck M, Pennings M, Hoekstra M, Out R, Van Berkel TJ
(2005) Scavenger receptor BI and ATP-binding cassette trans-
porter A1 in reverse cholesterol transport and atherosclerosis.
Curr Opin Lipidol 16:307–315
18. Yvan-Charvet L, Wang N, Tall AR (2010) Role of HDL,
ABCA1, and ABCG1 transporters in cholesterol efflux and
immune responses. Arterioscler Thromb Vasc Biol 30:139–143
19. Trigatti BL, Krieger M, Rigotti A (2003) Influence of the HDL
receptor SR-BI on lipoprotein metabolism and atherosclerosis.
Arterioscler Thromb Vasc Biol 23:1732–1738
20. Chiang JY (2009) Bile acids: regulation of synthesis. J Lipid Res
50:1955–1966
21. Brown MS, Goldstein JL (1986) A receptor-mediated pathway
for cholesterol homeostasis. Science 232:34–47
13
 Lipids
22. Schmitz G, Langmann T, Heimerl S (2001) Role of ABCG1 and
other ABCG family members in lipid metabolism. J Lipid Res
42:1513–2018
23. Malerod L, Juvet L, Hanssen-Bauer A, Eskild W, Berg T (2002)
Oxysterol-activated LXRalpha/RXR induces SR-BI-promoter
activity in hepatoma cells and preadipocytes. Biochem Biophys
Res Commun 299:916–923
24. Bhaskar S, Kumar KS, Krishnan K, Antony H (2013) Querce-
tin alleviates hypercholes-terolemic diet induced inflammation
during progression and regression of atherosclerosis in rabbits.
Nutrition 29:219–229
25. Xiao HB, Lu XY, Sun ZL, Zhang HB (2011) Kaempferol
regulates OPN-CD44 pathway to inhibit the athero-genesis
of apolipoprotein E deficient mice. Toxicol Appl Pharmacol
257:405–411
26. Zhang J, Liang R, Wang L, Yan R, Hou R, Gao S, Yang B (2013)
Effects of an aqueous extract of Crataegus pinnatifida Bge. var.
major N.E.Br. fruit on experimental atherosclerosis in rats. J Eth-
nopharmacol 48:63–69
27. Boots AW, Haenen GR, Bast A (2008) Health effects of
quercetin: from antioxidant to nutraceutical. Eur J Pharmacol
585:325–337
28. Sang WK, Min SK, Hyun SK, Yunho K, Daekeun S, Jung Han
YP, Young HK (2013) Celastrol attenuates adipokine resistin-
associated matrix interaction and migration of vascular smooth
muscle cells. J Cell Biochem 114:398–408
29. Buus NH, Hansson NC, Rodriguez-Rodriguez R, Stankevicius
E, Andersen MR, Simonsen U (2011) Antiatherogenic effects of
oleanolic acid in apolipoprotein E knockout mice. Eur J Pharma-
col 670:519–526
30. Chang YC, Lee TS, Chiang AN (2012) Quercetin enhances
ABCA1 expression and cholesterol efflux through a p38-depend-
ent pathway in macrophages. J Lipid Res 53:1840–1850
31. Park MY, Ji GE, Sung MK (2012) Dietary kaempferol sup-
presses inflammation of dextran sulfate sodium-induced colitis
in mice. Dig Dis Sci 57:355–363
32. Calderón-Montaño JM, Burgos-Morón E, Pérez-Guerrero C,
López-Lázaro M (2011) A review on the dietary flavonoid
kaempferol. Mini Rev Med Chem 11:298–344
13
33. Bischoff SC (2008) Quercetin: potentials in the prevention and
therapy of disease. Curr Opin Clin Nutr Metab Care 11:733–740
34. Rivera L, Morón R, Sánchez M, Zarzuelo A, Galisteo M (2008)
Quercetin ameliorates metabolic syndrome and improves the
inflammatory status in obese Zucker rats. Obesity (Silver Spring)
16:2081–2087
35. Kleemann R, Verschuren L, Morrison M, Zadelaar S, van Erk
MJ, Wielinga PY, Kooistra T (2011) Anti-inflammatory, antipro-
liferative and anti-atherosclerotic effects of quercetin in human
in vitro and in vivo models. Atherosclerosis 218:44–52
36. Juźwiak S, Wójcicki J, Mokrzycki K, Marchlewicz M, Białecka
M, Wenda-Rózewicka L, Gawrońska–Szlarz B, Droździk M
(2005) Effect of quercetin on experimental hyperlipidemia and
atherosclerosis in rabbits. Pharmacol Rep 57:604–609
37. Auger C, Teissedre PL, Gérain P, Lequeux N, Bornet A, Seris-
ier S, Besançon P, Caporiccio B, Cristol JP, Rouanet JM (2005)
Dietary wine phenolics catechin, quercetin, and resveratrol effi-
ciently protect hypercholesterolemic hamsters against aortic fatty
streak accumulation. J Agric Food Chem 53:2015–2021
38. Chirumbolo S (2010) The role of quercetin, flavonols and fla-
vones in modulating inflammatory cell function. Inflamm
Allergy Drug Targets 9:263–285
39. Li H, Wang QJ, Zhu DN, Yang Y (2008) Reinioside C, a triter-
pene saponin of Polygala aureocauda Dunn, exerts hypolipi-
demic effect on hyperlipidemic mice. Phytother Res 22:159–164
40. Kannaiyan R, Shanmugam MK, Sethi G (2011) Molecular tar-
gets of celastrol derived from Thunder of God Vine: potential
role in the treatment of inflammatory disorders and cancer. Can-
cer Lett 303:9–20
41. Somova LO, Nadar A, Rammanan P, Shode FO (2003) Cardio-
vascular, antihyperlipidemic and antioxidant effects of oleanolic
and ursolic acids in experimental hypertension. Phytomedicine
10:115–121
42. Liu J (1995) Pharmacology of oleanolic acid and ursolic acid. J
Ethnopharmacol 49:57–68