© 1998 Nature America Inc. • http://biotech.nature.

com
RESEARCH

High level multiplex genotyping by

MALDI-TOF mass spectrometry
Philip Ross*, Laura Hall, Igor Smirnov, and Larry Haff
PerSeptive Biosystems, 500 Old Connecticut Path, Framingham, MA 01701. *Corresponding author (e-mail: Philip_Ross@pbio.com).

Received 28 July 1998; accepted 27 October 1998

A primer extension assay is used to perform highly multiplexed genotyping of single nucleotide poly-
morphisms (SNPs) present in genomic DNA amplified by a multiplex PCR. The assay uses matrix-assisted
laser desorption ionization time-of-flight mass spectrometry to accurately measure the masses of short
oligonucleotide primers extended by a single dideoxynucleotide. The multiplexed genotyping assays rely
on the natural molecular weight differences of DNA bases. By careful analysis of primer composition
complementary to the target, or by judicious addition of one or more noncomplementary 5´ bases to the
genotyping primers, mass spectra of interleaved genotyping products can be generated with no ambigu-
© 1998 Nature America Inc. • http://biotech.nature.com

ity in allele assignment. Using a model multiplex PCR system, we demonstrate the ability to perform 12-
fold multiplex SNP analysis.

Keywords: genomics, single nuceotide polymorphisms, multiplex PCR

As the full sequence and polymorphic regions of human and other
genomes are uncovered, there will be an increasing demand for tech-
nologies that can provide large amounts of specific genetic informa-
tion in a time-efficient and cost-effective manner. For applications
such as clinical genetic testing, genomic mapping/localization of
candidate disease genes, and human identification, single nucleotide
polymorphisms (SNPs) and other localized point mutations will
compose the majority of sequence variants to be tested. To perform
large-scale testing of such loci, robust, flexible, and inexpensive
assays and platforms permitting a high degree of multiplexing will be
required. Matrix-assisted laser desorption ionization time-of-flight
mass spectrometry (MALDI-TOF MS) has evolved into a versatile
tool for the detailed characterization of nucleic acids. The success of
oligonucleotide analysis using commercially available delayed
extraction (DE) ion source technology1–3 and the discovery of 3-
hydroxy picolinic acid as a matrix compound4 have enabled MALDI-
TOF MS to become a viable platform for genomic DNA characteri-
zation. This platform has been developed into a variety of assays for
point mutation and polymorphism analysis5–12.
The use of MS for screening known polymorphisms becomes
particularly advantageous when a high degree of multiplexing is
possible. A genotyping method, termed the PinPoint assay11, has
been developed for post-PCR analysis of point mutations. The
assay is based on the annealing of an oligonucleotide primer direct-
ly upstream of a known point mutation; the primer is then extend-
ed by a single dideoxynucleotide in a thermal cycled reaction. The
products of the assay are short oligonucleotides that lie in the opti-
mal performance range of the Voyager DE MALDI-TOF MS plat-
form. The assay supports multiplexing by using mass resolved
primers, as demonstrated in a fivefold multiplex assay for muta-
tions in exon 13 of the BRCA1 gene12. Assays using mass spectro-
metric detection of specifically hybridized peptide nucleic acid
probes have the potential for high-level multiplexing; however,
such approaches have been multiplexed only to a level of
twofold13,14. The PinPoint assay uses a standard reaction mixture for
all mutations involving a change of one or several bases down-
stream from a primer annealing site. The assay, including PCR, is
performed in a single tube11,12, eliminating excess handling. The
PinPoint assay can resolve many possible genotypes/loci using a
single, nonfluorescent primer.
In this paper, we perform 12-fold multiplexing of SNPs using an
assay design that capitalizes on the high-molecular-weight accuracy
and resolution of DE MALDI-TOF MS. Reliable genotyping data
are obtained from interleaved primer and extended primer pairs.
Primers, or extended primers of very similar molecular weight, are
adjusted to give resolvable, unambiguous data for different loci. We
use a set of biallelic human genomic SNP markers amplified by a
multiplex PCR15. The success and flexibility of the assay suggests a
role for MALDI-TOF MS in SNP-based genomic mapping16–18.
Results and Discussion
A multiplex PCR assay15 was used to amplify loci that have a high
degree of heterozygosity among normal healthy individuals and
that therefore represent a good performance test of the MALDI-
TOF platform. Multiplex genotyping was previously demonstrated
using five point mutations on a single BRCA1 PCR product12.
Genotyping one locus/PCR product represents, in principle, a sub-
stantially greater degree of difficulty, as the assay must accommo-
date the varied PCR product concentrations at each locus. In addi-
tion, each genotyping primer must generate sufficient levels of
extension product despite varied base compositions and, hence,
annealing temperatures and reaction efficiencies at each locus. To
evaluate assay and purification conditions, fivefold and sixfold
multiplex genotyping assays were examined (Table 1).
Design of multiplex genotyping assay using mass tuning. To suc-
cessfully use MALDI-TOF MS and the PinPoint assay to genotype
multiple loci, the primers and extended primers must be of suffi-
ciently different mass to give both adequate resolution between pos-
sible components and unambiguous molecular weight differences
between each primer/extended primer pair. This is accomplished
using primers of successively increasing length. Genotyping primers
for the fivefold SNP multiplex were synthesized in two-base incre-
ments, ranging from 15 to 23 bases so that each primer/extended
primer pair occupy separate molecular weight regions of the mass
spectrum (Table 1). To give optimum MALDI-TOF performance in
terms of resolution and sensitivity, genotyping primer lengths ideally

NATURE BIOTECHNOLOGY VOLUME 16 DECEMBER 1998 1347

 © 1998 Nature America Inc. • http://biotech.nature.com
RESEARCH

Table 1. Genotyping primers used in model multiplex PinPoint assay.

Locus no. Locus name/polymorphism PinPoint primer sequence (5´–3´) Primer Mr (Da) Extended primer mass window (Da)

1 Antithrombin III (AT3) ctccatgggcccagc 4513.98 4787.17–4827.19

2* Cytochrome P450 2D6 (CP450) aatgatgagaacctg 4625.09 4898.28–4938.30
3* Neurofibromatosis (NFI) ttgtcaccatattaatt 5134.42 5407.61–5447.63
4 Complement component C6 (CC6) ggggacagccatgcactg 5549.65 5822.84–5862.87
5* Alpha-2-macroglobulin (A2M) acagcagcttactccagag 5781.83 6055.02–6095.04
6 Insulin growth factor (IGF) ccagcaaagagaaaagaagg 6226.15 6499.34–6539.36
7* Triglyceride lipase (TGL) ttctgtcttccaggaatctgt 6378.19 6651.38–6691.41
8* Aldolase B (ALDB) cgggccaagaaggtatctacc 6440.25 6713.43–6753.46
9 Integrin B2 subunit (ISB2) gggacatagtgaccgtgcaggt 6840.49 7113.68–7153.70
10* Low-density lipoprotein receptor (LDLR) ttttatgacaccgtcatcagcag 6998.61 7271.80–7311.83
11 Interleukin 1 alpha (IL1A) gggaaatcatcaagcctaggtca 7081.68 7354.87–7394.89
12 Protein S alpha (PRSA) atgatattagagctcactcatgtcc 7616.02 7889.21–7929.23

Molecular weight values of primers and extended primers are based on the following nucleotide exact masses: dC, 289.1847; dT, 304.1964; dA, 313.2097; dG,
329.2091; ddC, 273.1898; ddT, 288.2015; ddA, 297.2148; ddG, 313.2142. *Loci used in initial 5-plex and 6-plex assays.

should be kept to under approximately

40 bases. Placing primers two bases
apart thereby imposes a limit on the
© 1998 Nature America Inc. • http://biotech.nature.com

possible degree of multiplexing. A

strategy for increased multiplexing
within a sample, which we term “mass
tuning,” relies on the natural molecular
weight of DNA bases to closely space
genotying primers in a multiplex spec-
trum. With sufficient variation in tem-
plate composition, oligonucleotides of
identical length will vary substantially
in molecular weight. Within a given
mass range, the number of typed loci
can be increased while avoiding poten-
tial overlaps between primers and
extended primers. This principle was
tested by the addition of a sixth geno-
typing primer to a fivefold multiplex
SNP assay. The 21-mer primers (Table
1) for the TGL and ALDB loci are 62
Da apart, sufficient to easily resolve
both primers and all possible combi-
nations of dideoxy-extension prod-
ucts, including heterozygotes (Fig. 1).
The generation of mass spectra with
interleaved primer/extended primer
combinations did not compromise
peak identification accuracy, as cor-
rectly correlated pairs give mass dif-
Figure 1. Mass compression for a sixfold multiplex genotyping assay. Loci 2, 3, 5, 7, 8, and 10 were
ferences within a 273–314 Da mass amplified and typed using corresponding primers and standard assay conditions. Arrows indicate
window. corresponding primer-extended primer pairs. Molecular weight assignments from two point
Often in a multiplex assay it is not calibration are given.
possible to assemble many primers
and achieve suitable differences in
molecular weight. Despite the high resolution of MS, the assay is mass difference of dG and dC is 40 Da; thus, an 80 Da separation is
constrained mostly by the fact that primer extension windows easily established with two 5´ noncomplementary bases. The most
must be kept separate. Considering that primer extension products challenging instance of identical mass primers will be rare; typical-
occupy a 40 Da mass window, the mass difference between (unex- ly, only one primer will require this form of modification. Apart
tended) genotyping primers should be a minimum of approxi- from facilitating initial assay design, this approach gives a prescrip-
mately 50 Da. In addition, assay design must avoid overlaps tion for adding primers to an existing assay without needing to
between any unextended primer and possible extension products increase the mass range.
of other primers. Genotyping primers for 12 SNP loci were designed with the aid
These concerns are addressed by mass tuning using noncomple- of mass tuning (Table 1), resulting in mass spectra with resolved
mentary bases on the 5´ end of the genotyping primer to impart a primer and extended primer peaks (Fig. 2). This degree of multi-
relative mass shift. Two primers of identical mass can be spectrally plexing was accomplished using primers varying from 15 to 25
resolved by replacement of one or two 5´ bases with dC or dG. The bases in length. All loci gave high levels of extended product and

1348 NATURE BIOTECHNOLOGY VOLUME 16 DECEMBER 1998

 © 1998 Nature America Inc. • http://biotech.nature.com
RESEARCH

clear resolution (50% baseline or better) between peaks at het-
erozygous loci. Mass tuning using complementary primer
sequences or addition of 5´ dG to selected primers was used to sep-
arate all possible primer and extended primer combinations. In
addition to the ALDB and TGL primer pair (Fig. 1), the 15-base
AT3 and CP450 primers have sufficiently different base composi-
tion for separation of primers and products. The use of noncom-
plementary mass tuning is demonstrated for the LDLR and IL1A
primers. At a length of 21 bases, the respective masses are 6391.2
and 6424.2 Da, which resulted in an overlap in the extended primer

A
© 1998 Nature America Inc. • http://biotech.nature.com

Figure 2. (A) Twelve-fold multiplex spectrum expanded in three regions, illustrating primer-extended primer pairs. *Matrix adduct peaks. (B)
Spectra of two individuals using 12-fold multiplex SNP assay. Genotypes for each individual are listed above the product peaks for each locus.

NATURE BIOTECHNOLOGY VOLUME 16 DECEMBER 1998 1349

 © 1998 Nature America Inc. • http://biotech.nature.com
RESEARCH
Table 2. Summary of results from 12-fold multiplex genotyping of 25 individuals.
Locus and 1 2 3 4 5 6
published
genotypes C,T C,T A,G A,C A,G
(ref.) (19) (20) (21) (22) (23)
Genotype T7 C 13 A5 A 12 A 11
summary C 10 C/T 12 G8 C1 G2
T/C 8 A/G 12 A/C 13 A/G 12
mass windows. By adding two dGs to the IL1A primer, all possible
genotyping results are well separated. The use of noncomplemen-
tary dGs was used with the ISB2 primer so that the corresponding
dideoxy-extension products were 32 Da higher in mass than the
IL1A primer. Finally, the CC6 primer sequence was adjusted with
5´ dGs so that dideoxy-extension products did not coincide with
the A2M primer. The addition of noncomplementary 5´ dG
nucleotides does not appear to negatively impact the efficiency of
primer extension. In fact, two of the three primers carrying non-
complementary 5´ dG tails reacted to nearly full extension (Fig.
© 1998 Nature America Inc. • http://biotech.nature.com
2A), such that peaks from the unextended primer are barely dis-
cernable above background noise.
Molecular weight and genotyping accuracy. Despite the visual
complexity of highly multiplexed spectra, interpretation of geno-
typing results was straightforward. First, one or two unextended
primer peaks enabled calibration during data collection. In a five-
fold or greater multiplex, one or more primers will not be fully
extended. Mass differences were then determined based on the
known mass of primers regardless of their presence or absence in
the mass spectrum, permitting accurate allele calling. From analy-
sis of sixfold and 12-fold multiplex assays from 10 and 25 individu-
als, respectively, the observed error in mass difference ranged from
0 to ±0.6 Da and is typically ±0.2 to ±0.4 Da. These results show
that product mass windows of ±1 Da for each of the four dideoxy-
extension products could be established. This level of discrimina-
tion facilitated correlation of corresponding primer/extended-
primer pairs in highly complex spectra. Furthermore, the occa-
sional presence of matrix or salt adducts and depurination peaks
were filtered out.
Samples from 25 unrelated individuals, at 12 well-characterized
biallelic loci, were assayed. All samples gave good extension yields
with signal to noise ratio typically ranging from 50–100, and a
minimum level of approximately 15. All molecular weight assign-
ments corresponded to the known genotypes (Table 2) within 0.6
Da, and the results were consistent with the known high frequency
of heterozygosity at each locus19–30.
The model multiplex genotyping assay shown here demon-
strates considerable flexibility in the MALDI-TOF MS platform and
the PinPoint assay. Currently, 12-fold multiplex assays spotted onto
400-well plates can be analyzed at a rate of 3–4/minute, correspond-
ing to a throughput of up to 20,000 loci in a 10-hour analysis peri-
od. The simple protocol for the PinPoint assay accomodates testing
of large numbers of loci for a single individual, or large-scale popu-
lation testing at several loci. Aside from selecting the sequences nec-
essary to mass resolve the primers, no further design appears to be
required. Although all primers do not extend with equal efficiency,
we have not found it necessary to redesign primers to improve
extension. Polymorphisms such as deletions and insertions can also
be typed, as long as the polymorphism can be detected by a base
change at the 3´ end of a stretch of 12 or more bases. Closely spaced
mutations can be typed using primers with degenerate bases or by
using combinations of forward and reverse strand primers.
As a result of high mass accuracy, peaks arising from salt or
matrix adducts will lie outside the ±1 Da product mass window.
1350
7 8 9 10 11 12
A,G T,G A,G C,T A,G G,T A,G
(24) (25) (26) (27) (28) (29) (30)
A1 T3 A3 C6 A4 G 19 A9
G 18 G6 G9 T 13 G 12 T/G 6 G5
A/G 6 T/G 16 A/G 12 C/T 6 A/G 9 A/G 11
We anticipate that multiplex genotyping to 20 or more loci is feasi-
ble, based on the following considerations. Primers as short as 12
bases can be successfully annealed and extended under the condi-
tions described here; thus, additional loci that occupy the m/z
3500–4500 mass range can be added. Shorter primers may not
anneal reliably, depending on the sequence. Mass tuning of geno-
typing primers with noncomplementary 5´ bases must therefore
accommodate an appropriate length of target sequence. There is
also useful data space extending from m/z 7500 to m/z 9000.
Beyond 9000 Da (30-mer), difficulty may be encountered in resolv-
ing neighboring product peaks differing by 9 Da, as occurs for rare
A/T heterozygotes. Other limitations of the assay arise from several
sources common to many assays based on enzymatic extension or
hybridization. Abnormally high levels of failure products in geno-
typing primers pose potential spectral interference problems.
Annealing of genotyping primers to target must compete with
reannealing of PCR product strands, posing a challenge for geno-
typing of PCR products approaching 1000 bases. Primers with sta-
ble hairpin loop structures may give negligible or erroneous exten-
sion, an issue that can be avoided by typing the alternate strand or
introducing an appropriate internal mismatch.
Experimental protocol
PCR. The simultaneous amplification of the 12 loci tested using zip-coded
PCR primers has been described15. Briefly, low concentrations of PCR
primers harboring noncomplementary 5´ sequence tags are subjected to 10
rounds of thermal cycling (94°C, 64°C) in 25 µl reaction buffer comprising
(final concentrations) 1× Stoffel buffer, 400 µM dNTPs, 4 mM MgCl2, 25 ng
human genomic DNA, 0.5 U Taq DNA polymerase, Stoffel fragment (PE
Biosystems, Foster City, CA). After 50 pmol zip code primer pairs were
added, the mixture was thermal cycled for an additional 15 rounds. The PCR
step could be performed in approximately 100 min. The use of hybrid and
zip-coded PCR primers permitted robust amplification of all 12 loci while
alleviating differences in product yields. Primer-dimer levels were reduced by
elevating reaction mixture temperatures to 80°C prior to addition of dNTPs
and polymerase. Thermal cycling was performed on either a Perkin Elmer
9600 or 2400 DNA thermal cycler. PCR and PinPoint primers were purchased
from PE Biosystems and used as supplied.
Multiplex primer extension assay. The general procedure for the multiplex
primer extension assay has been described11. A single tube reaction was per-
formed in the thermal cycler. Briefly, to 12.5 µl of multiplex PCR mixture was
added 1 U each of shrimp alkaline phosphatase and 10 U exonuclease 1
(Amersham, Arlington Hts, IL). The mixture was incubated for 15 min at
37°C followed by 15 min at 85°C. Then, 12.5 µl of a mixture containing 25
µM ddNTPs, 2 mM MgCl2, 1.5 U Taq Polymerase FS (PE Biosystems), 1×
PCR buffer II, and 20 pmol of each PinPoint primer was added to the PCR
mixture. The resultant mixture was subjected to 25 rounds of thermal cycling
(94°C, 30 s; 37°C, 30 s; 70°C, 20 s). A 10 µl aliquot of the final reaction mix-
ture was desalted by absorption/elution using pipette tips packed with small
quantities of POROS 50 R1 (PerSeptive Biosystems, Framingham, MA) chro-
matography media11. In experiments in which a panel of 25 DNA samples
were tested, PCR reactions were scaled down to 10 µl final volumes, and
genotyping reaction mixtures, including 5 µl PCR product, were scaled down
to 10 µl. For these, 4 µl of final reaction mixture was desalted.
MS. Mass spectra were acquired on a linear MALDI-TOF MS (Voyager DE;
PerSeptive Biosystems) workstation. The instrument is equipped with a 337
nm nitrogen laser, and has a nominal ion flight path length of 1.2 m. For
NATURE BIOTECHNOLOGY VOLUME 16 DECEMBER 1998
 © 1998 Nature America Inc. • http://biotech.nature.com
oligonucleotides in complex mixtures up to 30-mer, resolution of 700 or
greater is typically observed with the instrument. Desalted genotyping reac-
tion mixtures were mixed 1:1 with matrix solution containing 50 mg/ml 3-
hydroxy picolinic acid, 0.05 M ammonium citrate, and 30% acetonitrile, and
were spotted in 400 nl volumes onto polished (no wells) stainless steel sample
plates or 400 well Teflon masked sample plates. Spectra were acquired in pos-
itive ion, delayed extraction mode. Typically, time-of-flight data from 20–50
individual laser pulses were recorded and averaged on a transient digitizer,
after which the averaged spectra were automatically converted to mass by
data processing software.
1. Vestal, M.L., Juhasz, P., and Martin, S.A. 1995. Delayed extraction matrix-
assisted laser desorption time-of-flight mass spectrometry. Rapid. Commun.
Mass. Spectrom. 8:865–868.
2. Juhasz, P., Roskey, M.T., Smirnov, I.P., Haff, L.A., Vestal, M.L., and Martin, S.A.
1996 Applications of delayed extraction matrix-assisted laser desorption/ioniza-
tion time-of-flight mass spectrometry to oligonucleotide analysis. Anal. Chem.
68:941–946.
3. Dai, Y., Whittal, R.M., Weinberger, S.R., and Li, L. 1996. Accurate mass measure-
ment of oligonucleotides using a time-lag focusing matrix-assisted laser desorp-
tion/ionization time-of-flight mass spectrometer. Rapid. Commun. Mass
Spectrom. 9:1792–1796.
4. Wu, K.J., Steding, A., and Becker, C.H. 1993. Matrix-assisted laser desorption
time-of-flight mass spectrometry of oligonucleotides using 3-hydroxypicolinic acid
as an ultraviolet sensitive matrix. Rapid. Commun. Mass Spectrom. 4:99–102.
5. Ross, P.L., Davis, P.A., and Belgrader, P. 1998. Analysis of PCR products from
© 1998 Nature America Inc. • http://biotech.nature.com
conventional and microfabricated thermal cyclers using delayed extraction
MALDI-TOF mass spectrometry. Anal. Chem. 70:2067–2073.
6. Mouradian, S., Rank, D.R., and Smith, L.M. 1996. Analyzing sequencing reac-
tions from bacteriophage M13 by matrix-assisted laser desorption/ionization
mass spectrometry. Rapid. Commun. Mass Spectrom. 10:1475–1478.
7. Braun, A., Little, D.P., and Koster, H. 1997, Detecting CFTR gene mutations using
primer oligo base extension and mass spectrometry. Clin. Chem. 43:1151–1158.
8. Little, D.P., Cornish, T.J., O’Donnell, M.J., Braun, A., Cotter, R.J., and Koster, H.
1997. MALDI on a chip: analysis of arrays of low- to sub-femtomole quantities of
synthetic oligonucleotides and DNA diagnostic products dispensed by a piezo-
electric pipette. Anal. Chem. 69:4540–4546.
9. Fu, D.-J., Tang, K., Braun, A., Reuter, D., Demar, B.D., Little, D.P. et al. 1998.
Sequencing exons 5 to 8 of the p53 gene by MALDI-TOF mass spectrometry.
Nat. Biotechnol. 16:381–384.
10. Roskey, M.T., Juhasz, P., Smirnov, I.P., Takach, E.J., Martin, S.A., and Haff, L.A.
1996. DNA sequencing by delayed extraction matrix-assisted laser
desorption/ionization time-of-flight mass spectrometry. Proc. Natl. Acad. Sci.
USA 93:4724–4729.
11. Haff, L.A. and Smirnov, I.P. 1997. Single nucleotide polymorphism identification
assays using a thermostable DNA polymerase and delayed extraction MALDI-
TOF mass spectrometry. Genome Res. 7:378–388.
12. Haff, L.A. and Smirnov, I.P. 1997. Multiplex genotyping of PCR products with
NATURE BIOTECHNOLOGY VOLUME 16 DECEMBER 1998
RESEARCH
mass tag-labeled primers. Nucleic Acids Res. 25:3749–3750.
13. Ross, P.L., Lee, K., and Belgrader, P. 1997. Discrimination of single nucleotide
polymorphisms in human DNA using peptide nucleic acid probes detected by
MALDI-TOF mass spectrometry. Anal. Chem. 69:4197–4202.
14. Griffin, T.J., Tang, W., and Smith, L.M. 1997. Genetic analysis using peptide
nucleic acid affinity mass spectrometry. Nat. Biotechnol. 15:1368–1372.
15. Belgrader, P., Marino, M.A., Lubin, M., and Barany, F.A 1996. A multiplex
PCR–ligase detection reaction assay for human identity testing. Genome Sci.
and Technol. 1:77–87.
16. Chee, M., Yang, R., Hubbell, E., Berno, A., Huang, X.C., Stern, D. et al. 1996.
Accessing genetic information with high density DNA arrays. Science
274:610–614.
17. Wang, D.G., Fan, J.B., Siao, C.J., Berno, A., Young, P., Sapolsky, R. et al. 1998.
Large-scale identification, mapping, and genotyping of single-nucleotide poly-
morphisms in the human genome. Science 280:1077–1082.
18. Zhao, L.P., Aragaki, C., Hsu, L., and Quiaoit, F. 1998. Mapping of complex traits
by single nucleotide polymorphisms. Am. J. Hum. Genet. 63:225–240.
19. Armstrong, M., Idle, J.R., and Daley, A.K. 1993. A polymorphic Cfo I site in exon
6 of the human cytochrome P450 CYPD6 gene detected by the polymerase
chain reaction. Hum. Genet. 91:616–617.
20. Bock, S.C., Marrinan, J.A., and Radziejewska, E. 1991. Antithrombin III utah: pro-
line 407 to leucine mutation in a highly conserved region near the inhibitor reac-
tive site. Biochemistry 28:3628.
21. Dewald, G., Nothen, M.M., and Cichon, S. 1993. Polymorphism of human com-
plement component C6: an amino acid substitution (glu/ala) within the second
thrombospondin repeat differentiates between the two common allotypes C6 A
and C6 B. Biochem. Biophys. Res. Commun. 194:458–464.
22. Velden, P.A. and Reitsman, P.R. 1993. Amino acid dimorphism in IL-1A is
detectable by PCR amplification. Hum. Mol. Genet. 2:1753.
23. Cawthon, R.M., O’Connel, P., Buchberg, A.M., Viskochil, D., Weiss, R.B., Culver,
M. et al. 1990. Identification and characterization of transcripts from the neurofi-
bromatosis 1 region. The sequence and genomic structure of EV12 and mapping
of other transcripts. Genomics 7:555–565.
24. Brooks, C.C. and Tolan, D.R. 1993. Association of the widespread A149P hered-
itary fructose intolerance mutation with newly identified sequence polymor-
phisms in the aldolase B gene. Am. J. Hum. Genet. 52:835–840.
25. Poller, W., Faber, J.P., and Olek, K. 1991. Sequence polymorphism in the human
alpha 2 macroglobulin (A2M) gene. Nucleic Acids Res. 19:198.
26. Gloudemans, T., Pospiech, I., Van der Ven, L.T.M., Lips, C.J.M., Otter, W.D., and
Sussenbach, J.S. 1993. An Ava II restriction fragment length polymorphism in the
insulin-like growth factor gene and the occurrence of smooth muscle tumors.
Cancer Res. 53:5754–5758.
27. Diepstraten, C.M., Amstel, J.K., and Bertina, R.M. 1991. A CCA/CCG neutral
dimorphism in the codon for pro 626 of the protein S gene Psa (PROS1). Nucleic
Acids Res. 19:5091.
28. Reina, M. and Deeb, S. 1992. SSCP polymorphism in the human hepatic triglyc-
eride lipase (LIPC) gene. Hum. Mol. Genet. 1:453.
29. Mastuura, S. and Kishi, F. 1994. Investigation of the polymorphic AvaII site by a
PCR based assay at the human CD18 gene locus. Hum. Genet. 93:721.
30. Warnich, L., Kotze, M.J., Langenhoven, E., and Retief, A.E. 1992. Detection of a
frequent polymorphism in exon 10 of the low-density liprprotein receptor gene.
Hum. Genet. 89:362.
1351