Annotated Lesson Plan Format

Name: Jessica Wung Grade: 9th

Unit: Evolution and Cladograms Time Allotted: 50 minutes
Lesson Topic: Evolution Type of Lesson: Developmental

Context for Learning:

Purpose: A class of 9th grade on-level biology students will already be familiar with the
concepts of DNA, mutations, genetic variation, and inheritance. Students should have a solid
grasp on the aforementioned concepts as they have had a few formative and summative
assessments. Students will already be familiar with the more basic concepts of evolution (how
traits are inherited, the overall concept of natural selection and speciation) as well as reading and
interpreting cladograms.

This lesson will focus on the strategy making inferences. Students will infer what the
hidden objects are in their “discovery bags” and use their background knowledge to make
inferences on the relatedness of each organism to each other and where they would fit in an
evolutionary family tree, or cladogram. In an activity later in the lesson, students will be given
morphological and DNA evidence, use their inferencing skills to create a cladogram
demonstrating organism relatedness, and explain their reasoning using the provided evidence.

The theory of evolution states that all life is related and descended from a common
ancestor. Based on analysis of DNA and morphology, we can determine a general “family tree”,
or cladogram, of relatedness between each organism.

Technology: Students are able to easily view the projector screen/smart board that displays the
lesson presentation at the front of the room.

Room arrangement: The class has 23 students and is heterogeneous in terms of ethnic and
cultural background as well as learning style and needs. The classroom demographic leans
heavily towards Hispanic (2 African American students and 21 Hispanic students). There are no
students with physical disabilities.

Tables are arranged in five rows of three facing the front of the room (Figure 1). Each table can
seat two students (black lines), and lab stations are numbered and arranged on the sides of the
room to facilitate group work and can fit 4-5 students.
Figure 1. Classroom seating configuration

Curriculum Standard Addressed:

MSDE Core Learning Standards:

• CLG 1.4 The student will demonstrate that data analysis is a vital aspect of the scientific
process of inquiry and communication.
o CLG 1.4.2 The student will analyze data to make predictions, decisions, or draw
conclusions.
o CLG 1.4.6 The student will describe trends revealed by data.
• CLG 1.5 The student will use appropriate methods for communicating in writing and
orally the processes and results of scientific investigation.
o CLG 1.5.1 The student will demonstrate the ability to summarize data
(measurements/observations).
o CLG 1.5.2 The student will explain scientific concepts and processes through
drawing, writing, and/or oral communication.
o CLG 1.5.7 The student will use, explain, and/or construct various classification
systems.
o CLG 1.5.8 The student will describe similarities and differences when explaining
concepts and/or principles
• CLG 3.4 The student will explain the mechanism of evolutionary change
o CLG 3.4.2 The student will estimate degrees of relatedness among organisms or
species

CCSS ELA Literacy Standards:

CCSS.ELA-LITERACY.RST.9-10.4
Determine the meaning of symbols, key terms, and other domain-specific words and phrases as
they are used in a specific scientific or technical context relevant to grades 9-10 texts and topics.
Objectives (observable and measurable):
• Students will be able to classify organisms by using DNA and morphological evidence
and explain their reasoning through written language.
• Students will be able to infer relatedness between organisms using DNA and
morphological evidence and by demonstrating their understanding with a cladogram.

Materials:
For students:
• “Creating a Cladogram” worksheet
• “Discovering the Tree of Life” worksheet (HW)
Student groups
• Discovery bag: Small plastic figurines of the following organisms in a paper bag that is
stapled shut: horse, fish, bird, and mushroom
o Each lab station will have 1 bag (about 8 bags)

For teacher:
• Teacher computer with Microsoft PowerPoint/Google Slides
• Discovery bag
• Presentation
o https://docs.google.com/presentation/d/1N7-
2khdVWxUe4sQyS7pR_S1G87qkNoLCDzO0prF7Ea8/edit?usp=sharing
• Projector/Smartboard

Proactive Behavior Management:

I will set aside the first day of class at the beginning of the school year to go over
classroom rules and policies to create procedures for students and allow them to understand what
the expectations are (McIntyre, n.d.). It is also imperative to consistently enforce the classroom
rules and expectations; otherwise, it can cause confusion for students as they are not sure what
consequences to expect. I will also practice assertive disciple and escalate consequences in
response to unwanted behavior as appropriate (McIntyre, n.d.).

The configuration referenced in Figure 1 is not one of the most optimal in terms of
teacher mobility; however, the classroom is limited in terms of space so this was an
understandable adaptation (Dunne, 2001). The pairing of students at each table still encourages
student-student interaction nonetheless as it is easy for students to turn to each other during
Think-Pair-Share activities. Students will also have assigned seats as students who choose their
own seats are often three times more disruptive than those who were assigned seats by the
teacher (Bicard, Ervin, Bicard, & Baylot-Casey, 2012).

At the beginning of class, students are expected to pick up the materials on their way in
and sit at their assigned seat until the bell rings to signal the start of the class
period. Establishing this routine at the beginning of the year is critical to maximizing
instructional time by reducing the amount of time students spend getting class materials. Once
class begins, students are expected to take out their warm-up sheet and spend a few minutes
completing it quietly until it is time to discuss it as a class. Warm-ups will be graded, which will
increase student motivation and minimize disruption at the beginning of class.

The warm-up also serves to model what students are expected to do for the Creating a
Cladogram worksheet. If students are unsure how to complete the warm-up, they can at least
listen to my explanation as I go over it. I can help make sure that students are on the same page
in this way and ensure that group work is more productive. I will then go over the classwork
assignment with the whole class and make sure to emphasize the directions. Only after all
students have a complete understanding of what is required of them for the assignment and the
expectations for group work (noise level, on-task behavior, level of participation), will they be
allowed to go to their assigned groups and stations. This strategy will help ensure a smooth
transition to productive group work, rather than confusion over what they are expected to do.

Provisions for Student Grouping:

For this activity, students will be working in pre-assigned heterogeneous groups

(academic level, gender, and ethnicity) of about 3-4 students. Each group will be assigned a lab
station with a “discovery bag”. Groups and their respective stations will be projected onto the
board so students are aware of where they will go and who they will work with.

I will take into account the skill level of each student and pre-assign students to create
balanced groups and assign each group to a lab station. Students at lower levels will be put with
higher level students so they may learn through observing or being scaffolded by their peers
(Herrmann, 2014; Fiorella & Mayer, 2013).

Additionally, students tend to perform better in mixed-gender groups; as a result, effort

will be made to create heterogeneous groups with an even mix of gender, ethnicities, and
academic level (White, 2013; Why Use Cooperative Learning?, 2018). Heterogeneous groups
also have the advantage of promoting student engagement through giving students the
opportunity of being more active in their learning (Heltemes, 2009). Students are also able to
play to their strengths in a mixed-group setting while being supported by their peers in areas they
struggle in (McGlynn & Kozloski, 2016).

Part of a student’s overall grade in the class will be based in participation, or how well they
contribute to group work. This grade will not be very heavily weighted, and at most will be
worth 5%. The following criteria will be used to judge student performance:

• Focus on the task: I will observe how on-task the students are (on-topic discussion and
engagement in the activity)
• Active participation: I will observe visually and audibly how each student in the group
contributes to the discussion and quality of work.
o Is each member doing an equal share of the work?
o Is the work detailed and does it reflect the lesson objectives?
• Collaboration: Similarly to Active Participation, I will be assessing how well each
student works with their peers. This also allows me to observe which students work well
with who, and if adjustments will need to be made in the future for assigned group work.
 I will inform students that I will be walking around and observing how productive each
group member is. This strategy will promote student motivation, effective group work, and
minimize disruptive behaviors. By using this strategy, I can reduce the amount of disruptions and
off-task behaviors and encourage effective group work (McLeod, 2018).

Procedures

1. Material distribution: Students will be greeted as they come in through the door, pick up
materials, and sit at their assigned lab stations with their groups. Assigned groups will be
projected onto the board so students will be able to see it as they walk in, reducing the
amount of class time spent moving students around.

2. Warm-Up/Opening (7 minutes): Each student group will have a “discovery bag” at their
lab station, and will spend a few minutes to infer what is hidden inside through touching,
shaking, or any other method they wish except for opening the bag.
Students will use their senses to infer what is inside of the bag:
• Touch: Touching the objects through the bag gives students the opportunity to
feel the shape and size of the mystery objects.
o Is it hard? Sharp? Soft? Curvy?
• Sound: Shaking the bag can help students infer what the objects are and eliminate
possible choices
o Does it rattle? Does it sound hollow?
• Smell: Does it have an odor?
Students will spend a few minutes working on the follow-up questions (suggested
answers in italics):
What do all these organisms have in common?
They are all multicellular eukaryotic organisms
Make a cladogram of the four organisms. (Answer is on the following slide in red)
All of these organisms descended from a common multicellular eukaryotic
ancestor. The mushroom shares the least amount of traits with the rest of the
organisms, as it does not have muscle for it to move on its own. Next comes the
fish, as it can swim around, but it isn’t warm-blooded or have limbs like the bird
and the horse. The bird has four limbs, the wings and the legs, that are
homologous to horse legs so it is the closest relative to the horse than the other
two organisms. However, it is not a mammal like a horse. Mammals have
placentas, while birds lay eggs.
After approximately 2 minutes, students will be called on to share their answers with the
class.

3. Motivator (3 minutes): Once students have had an opportunity to infer what the objects are,
I will open the bag I have on my front table and reveal what was inside. This activity allows
students to practice their inferencing skills with the benefit of being a more fun and engaging
warm-up activity.

After students have completed the warm-up, I will direct their attention back on the board
and go over the answers with the whole class. The question “What do all these organisms
 have in common” will activate their background knowledge of a previous unit on eukaryotic
vs. prokaryotic cells and organisms (all organisms in the discovery bag activity are
eukaryotic and multicellular). Additionally, the question “Make a cladogram for the four
organisms” will draw upon students’ background knowledge of the four organisms and their
traits to create a diagram that correctly demonstrates the relatedness between the organisms.
Students should be able to recognize and differentiate between the mentioned organisms,
regardless of language/cultural background.

I will then read out the objectives for the day on the board and then transition to the
presentation portion of the lesson.

4. Presentation (7 minutes): Students will be presented with Think-Pair-Share questions on the

board to prepare them for the cladogram group activity. They will be asked to read a DNA
sequence between a common ancestor, nematode (type of roundworm), snake, and rabbit to
determine which organism is the most closely related to the ancestor using the amount of
mutations present. The more mutations, the more distantly related the organism is to the
ancestor. These questions serves as practice for students understand what they should do and
to get everyone on the same page.

I will then give directions for the assignment and review my expectations for group work
(on-task behavior, noise level, and collaboration but independent work). I will emphasize
that this assignment is due at the end of class, and ask students to give me a thumbs up/in the
middle/down to show their understanding of the activity. In this way, I can determine if
further clarification is needed to the whole group.

5. Group work (28 minutes): Students will collaborate with their group on the “Creating a
Cladogram” worksheet to determine how to classify each organism. Each student must
examine the data given (morphological and DNA), draw a cladogram using data as evidence,
and justify their answer. Students may work together with their groups, but their work must
reflect independent thought.

The cladogram activity requires students to use the evidence provided to infer what the
correct order of classification is and how the cladogram should be arranged.

6. Closing (5 minutes): Students will be asked to turn in their work at the front of the room and
complete a 3-2-1 exit ticket: 3 things that they learned, 2 things they found interesting, and 1
question they still have. This exit ticket acts as a formative assessment and will allow me to
gauge the general level of student understanding, what was most engaging, and what students
still need clarification on. Tickets will be collected as students leave the room.

Adaptations:

17% of the school are ESOL students; although I was not able to determine exactly how
many students within the classroom are ELLs, the percentage most likely translates roughly to
the classroom demographic. There are a few students with 504 plans or IEPs, so there is also a
co-teacher present in the classroom.
 There will be a diverse range of student needs and ability within the classroom and it is
imperative that I accommodate their needs to the best of my ability for a differentiated
classroom.

The lesson can be adapted for the following students:

• ELLs: The warm-up is a more tactile activity with the discovery bags, which does not
require much English proficiency. The organisms in the activity are also common
enough that students should be able to recognize and differentiate them regardless of
language or cultural background. The Think-Pair-Share questions are also done with
groups, so they can be scaffolded by peers with a higher English proficiency level than
them.

• Students with learning disabilities: I was not able to determine the exact number of
students with learning disabilities. However, in 2015-2016 students with learning
disabilities made up approximately 13% of public school students, which I assume will
roughly translate to this classroom (National Center for Education Statistics,
2018). There is also a co-teacher for extra support if the students need it.

Students with learning disabilities may require adaptations to reading activities

and accommodations based on their IEP; for example, two students require enlarged font
and worksheets (Morin, 2014). Class notes can also be provided to students as required
by their accommodations. Additionally, there is no text for students to read for
homework; students will watch a video and complete the follow-up questions. Students
may also type up and submit their answers electronically.

Additionally, the lesson is geared towards different learning styles:

• Verbal: Students with a preference for verbal learning will benefit from the written
instructions on the board and the worksheet.
• Visual: Visual learners will benefit from the presentation as it incorporates images and
represents information with tables and pictures. Additionally, the video students will
watch for homework has animations to illustrate the concepts of evolutionary history.
• Auditory: My verbal explanation of group work instructions will benefit students with a
preference for auditory learning.
• Spatial: Students with spatial intelligence will be able to apply their intelligence by
visualizing and creating cladograms.
• Interpersonal: Students with interpersonal intelligence can apply their skills in a group
setting by collaborating on the cladogram activity.

Assessment:

Formative Assessment: Students will complete a 3-2-1 exit ticket: 3 things that they learned, 2
things they found interesting, and 1 question they still have. This exit ticket acts as a formative
assessment and will allow me to gauge the general level of student understanding, what was most
engaging, and what students still need clarification on. Additionally, this ticket will allow me to
get feedback on the lesson and tweak it as necessary for future use. Tickets will be collected as
students leave the room. I will also be continuously assessing student progress as I circulate
around the classroom observing the research groups on the first day.
 I can also gauge general student understanding by asking students to show me thumbs
up/in the middle/down; thumbs up if they understand perfectly, in the middle if they somewhat
understand, or down if they do not understand at all. If most thumbs are up, I will let students
meet with their groups and begin the activity; however, if I see that there are a lot of thumbs in
the middle or down, then further clarification is needed to the whole group. Some students may
feel pressure to show that they understand, and will put their thumbs up even if they are actually
unclear about the instructions. To remedy this, I will ask students to close their eyes and show
me their thumbs, so their answer is not affected by their peers.

Seeing how students collaborate and focus in their groups will also help me make future
decisions on assigned groups by observing which students work best together and what their
strengths and ability levels are. I expect students to continuously evolve over the course of the
year/semester, and will be sure to re-assign student groups to keep things fresh and encourage
collaboration with all of their classmates.

Students will turn in the “Creating a Cladogram” worksheet at the end of class, which
will allow me to gauge the level of student understanding and help document their progress
through the unit.

Summative Assessment: The ability to read and create a cladogram will be assessed a test at the
end of the Evolution unit. The assessment will span the whole unit and will assess student
comprehension with a combination of multiple and free response questions. At least one
question will require students to create a cladogram based on morphological and DNA evidence
and justify their reasoning. Students will also receive a grade based on the accuracy of their
answers and cladogram as well as their level of understanding in the free response questions.

Summary/Closure (7 minutes):

After students have organized their lab stations and turned in their assignments, I will direct
their attention back to me as I wrap up the activity, link back to the objectives, and briefly go
over the homework assignment students picked up on their way in. I will also emphasize that
this assignment will be graded. Students will then take out a piece of paper and complete a 3-2-1
exit ticket to check for understanding.
• 3 things they learned
• 2 things they found interesting
• 1 question they have
Tickets will be collected as students leave class.

Generalization/Extension Activity:

Students may begin their homework assignment for that night if they are done early. They may
also take a Chromebook, watch the video quietly at their seat, and complete the questions.
Review/Reinforcement (Homework):

Students will watch the following video and answer accompanying questions on their
“Discovering the Tree of Life” worksheet.
• Video: https://www.youtube.com/watch?v=AjvLQJ6PIiU

Reflection:
 References

Bicard, D.F., Ervin, A., Bicard, S.C., & Baylot-Casey, L. (2012). Differential effects of seating

arrangements on disruptive behavior of fifth grade students during independent

seatwork. J Appl Behav Anal Journal of Applied Behavior Analysis, 45(2), 407-411.

Fiorella, L. & Mayer, R.E. (2013). The relative benefits of learning by teaching and teaching

expectancy. Contemporary Educational Psychology, 38, 281-288.

https://doi.org/10.1016/j.cedpsych.2013.06.001

Herrmann, E. (2014). Grouping students: Heterogeneous, homogeneous, and random structures.

Retrieved from http://exclusive.multibriefs.com/content/grouping-students-

heterogeneous-homogeneous-and-random-grouping-structures/education

Heltemes, L. (2009). Social and academic advantages and disadvantages of within-class

heterogeneous and homogeneous ability grouping. Fisher Digital Publications. Retrieved

from

https://fisherpub.sjfc.edu/cgi/viewcontent.cgi?article=1092&context=mathcs_etd_masters

Marzano, R.J., Marzano, J.S., & Pickering, D.J. (2003) The critical role of classroom

management. In Classroom management that works: Research-based strategies for

every teacher (Chapter 1). Retrieved from

http://www.ascd.org/publications/books/103027/chapters/The-Critical-Role-of-

Classroom-Management.aspx

McGlynn, K. & Kozloski, J. (2016). Empowering students through collaboration. Science Scope.

Retrieved from https://learn.umuc.edu/content/enforced/353803-026693-01-2192-GO1-

9040/Empowering%20Students%20through%20Collaboration.pdf?_&d2lSessionVal=ajc

SC2npuMkHUt5L7iRiwwYMj
McIntyre, T. (n.d.). Assertive discipline. Retrieved from

http://www.behavioradvisor.com/AssertiveDiscipline.html

McLeod, S. (2012). Zone of proximal development and scaffolding. Retrieved from

https://www.simplypsychology.org/Zone-of-Proximal-Development.html

Morin, A. At a glance: Classroom accommodations for students with ADHD. Retrieved

from https://www.understood.org/en/school-learning/partnering-with-childs-

school/instructional-strategies/at-a-glance-classroom-accommodations-for-adhd

National Center for Education Statistics. (2018). Children and youth with disabilities. Retrieved

from https://nces.ed.gov/programs/coe/indicator_cgg.asp

White, C. (2013, August 31). Study indicates that students may learn better in mixed gender

groups. Retrieved from https://www.education.wisc.edu/soe/research/research-

news/2013/08/31/study-indicates-students-may-learn-better-in-mixed-gender-groups

Why use cooperative learning? (2018, May 07). Retrieved from

https://serc.carleton.edu/introgeo/cooperative/whyuse.html
 Creating a Cladogram

Use the two tables below to construct a cladogram and provide reasoning for your placement of
the organisms on the tree.

Table 1: Comparative Morphology Data

Organism Eukaryote Multicellular Segmented Jaws Limbs Hair Placenta Has
body bone
Amoeba x - - - - - - -
Sponge x x - - - - - -

Earthworm x x x - - - - -

Shark x x x x x - - -

Lizard x x x x x - - x

Kangaroo x x x x x x x x

Dolphin x x x x x x - x

Cat x x x x x x - x

Table 2: Cytochrome c DNA Sequence Data

Organism DNA Sequence # mutations

Ancestor Cell ATTAGCGACCAGTATATCCTACAATCCGTCTACTTCATT none

Amoeba ATTAGCGACCAGTTTATCCTACAATCCCGTCTACTTCAT

Sponge ATTATCGACCAGTTTATCCTACATTCCCGTCTACTTCGT

Earthworm CTTATCGACCCGTTTATCCTACATTCCCGTCTACTTCGT

Shark CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT

Lizard CTAATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT

Kangaroo CTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT

Dolphin CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT

Cat TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT
In the space below, create a cladogram that best shows the relatedness between the
organisms. Note each trait on your diagram (segmented body, jaws, placenta, etc.):

Explain your reasoning for the placement of each organism on your cladogram. Be detailed!
Use the given data as evidence to help justify your answer.
 Discovering the Tree of Life
https://www.youtube.com/watch?v=AjvLQJ6PIiU

Watch the video and answer the following questions:

#1. Why do scientists use a tree metaphor to show evolutionary history?

#2. What are phylogenetic patterns?

#3. How would scientists use DNA to determine the relatedness between two different
organisms?

#4. Sand dollars and sea urchins don’t look the same, yet they are closely related. What are
three other similar examples can you think of?
1.

2.

3.

#5. Consider the two organisms below. What inference can you make in terms of how related
they are?