Professional Documents
Culture Documents
DOI 10.1007/s00436-005-1434-3
O R I GI N A L P A P E R
Received: 9 May 2005 / Accepted: 13 June 2005 / Published online: 9 July 2005
Springer-Verlag 2005
certain cases, serological methods such as the immune sample) and ethanol 96% (2.5 volume of the sample)
fluorescence antibody test (IFAT) or immunoperoxidase were added and the samples were incubated for 20 min
test have also been applied (Jianxus and Hung 1997; at 70C or overnight at 20C. DNA was than
Leemans et al. 1997; Shayan et al. 1999). precipitated at 12,000 rpm and, after washing with 70%
One problem discussed in protozoan infection is the ethanol, the pellet was dissolved in TE-buffer (10 mM
determination and characterization of the transmitter Tris–HCl, 0.1 mM EDTA pH 8.0).
agent. Since many analyses were performed with the
salivary gland smear using Methyl-green-puronin-stain- DNA extraction using TriPure isolation reagent
ing method, or Feulgen-staining method, the transfer
vector remains unanswered in some cases. Uilenberg DNA extraction was performed according to the
(1997) stated that T. lestoquardi transmit by Hyalomma manufacturer’s instruction (Roche, Germany). Briefly,
anatolicum anatolicum, while some other investigators 5–10 · 106 blood cells were homogenized with 1 ml
believe that it is transmitted by Repicephalus bursa or TriPure Isolation reagent. After addition of 0.5 ml Iso-
probably also by Repicephalus sanguinius (Dschun- propanol, the suspension was first incubated for 10 min
kowsky and Urodschevich 1924; Ramzi et al. 2003). at room temperature, then centrifuged for 10 min at
Considering the complicated preparation of the samples 12,000 g at 2–8C. A 300 ll 96% ethanol was added to
and their transport to specialized laboratories, we de- the lower and intermediate phases. DNA was precipi-
scribe an easy method for the preparation of samples tated after incubation for 2–3 min at room temperature
involving minimal space, and not requiring special cold by centrifugation at 2000 g at 2–8C. The pellet was then
storage. Furthermore, we show that the same sample can washed twice with 0.1 M sodium citrate in 10% ethanol
be used first for Giemsa-staining and than as a source and subsequently dissolved in TE-buffer.
for the extraction of DNA for further genetical analysis.
In addition, we show that this material is suitable for the
simultaneous detection and differentiation of genera DNA extraction using MBST-kit
Theileria and Babesia.
In contrast to the above mentioned two methods, this
method is based on the specific binding of the DNA to
the carrier. Therefore, neither phenol/chloroform nor
Materials and methods DNA precipitation was used. For > 200 ll blood,
erythrocytes were first lysed in blood samples using
Materials Erys-Lysing-Buffer. DNA was extracted using a DNA
isolation kit (MBST, Germany/Iran) according to the
We obtained 30 peripheral blood samples from sheep manufacturer’s instructions. Briefly, cells were first lysed
with suspicion of theileriosis or babesiosis. Ten of them in 180 ll lysis buffer and the proteins were degraded
were prepared with EDTA and ten samples were fixed with 20 ll proteinase K for 10 min at 55C. After
with ethanol (1 ml blood/3 ml absolute ethanol), and ten addition of 360 ll Bindings buffer and incubation for
unstained or Giemsa stained blood smears. All tissues 10 min at 70C, 270 ll ethanol (100%) was added to the
had been obtained with consent given according to solution and after vortexing, the complete volume was
institutional guidelines. transferred to the MBST-column. The MBST-column
was first centrifuged, then washed twice with 500 ll
washing-buffer. Finally, DNA was eluted from the
DNA extraction carrier with Elution buffer.
DNA extraction using phenol/chloroform
DNA extraction from ethanol fixed blood
In the case of more than 200 ll blood, erythrocytes were
first lysed in 0.155 M NH4Cl, 0.01 M KHCO3 and Ethanol fixed blood was first centrifuged for 20 min at
0.1 mM EDTA for 10 min washed twice with PBS at 13,000 rpm at 8C and then air dried by converting of
1000 g and the pellet was resolved in 200 ll of 10 mM tube. The pellet material was dissolved in lysis buffer
NaCl, 20 mM Tris–HCl pH 8.0 and 1 mM EDTA. Then (obtained from Phenol/chloroform method or from
20 ll proteinase K (10 mg/ml) was added and the sam- MBST kit) using proteinase K for various time intervals,
ple incubated for 10 min at 55C to digest the proteins. until the solution was homogenized. Finally, DNA was
After addition of equal volume of Tris–HCl pH 8.0 extracted according to the protocol of phenol/chloro-
saturated phenol, samples were gently vortexed and form method or the MBST manufacturer’s instructions.
centrifuged at 12,000 rpm for 15 min. Upper liquid
phase was transferred to the clear tube. The last step was DNA extraction from blood smears
repeated once with phenol/chloroform/Isoamylalcohol
(25/24/1) to eliminate proteins and once with chloro- Each blood smear was cleaned in separate vessels by a
form/Isoamylalcohol (24/1) to remove rest phenol in the short passage in acetone and ethanol. Approximately,
solution. Finally, 6 M Na-acetat (1/10 volume of the half the blood smear before and after Giemsa staining
283
Table 1 The sequences for primers used in PCR from heat shock protein (hsp70), T. lestoquardi ms1-2 gene, Babesia rhoptry protein gene and hyper variable region V of 18S rRNA gene
No.
P10
P11
P8
P1
P2
P3
P4
P5
P6
P7
P9
Pure reagent or 100 ll Lysis buffer of the MBST kit.
DNA was extracted as described above and dissolved in
T. lestoquardi-sense
Babesia-antisense
2.5 U Taq Polymerase (Cina gene, Iran), 2 ll of each
Name of primer
primer (20 mM, MWG, Germany), 200 lM of each
For B. motasi
Babesia-sense
For B. ovis
dATP, dTTP, dCTP and dGTP (Fermenta) and 1.5 mM
MgCl2 in automated Thermocycler (Eppendorf, Ger-
many) with the following program: 5 min incubation at
95C to denature double strand DNA, 35–38 cycles of
45 s at 54–58C (annealing step), 45 s, at 72C (exten-
sion step) and 45 s at 94C (denaturing step). Finally,
AY271268 NCBI
AY260176 NCBI
AY260178 NCBI
AY260179 NCBI
product isolated from agarose gel using the MBST-Kit
AJ006448 NCBI
AJ006446 NCBI
M91176 NCBI
according to the manufacturer’s instructions. Briefly, the
DNA bands were cut from the gel under UV control and
dissolved in the binding buffer at 60C. The dissolved
agarose was transferred into the MBST-column. After
washing, the bound DNA was eluted using 100 ll TE-
buffer. A 1–5 ll of the eluted DNA was amplified with
and primers for seminesdted PCR from Theileria spp. and Babesia spp
CACAGGGAGGTAGTGACAAG 3¢
TTTGACTTTGAATAGGCTGCC 3¢
GTTACTCTCACTTCATGTGAG 3¢
CCTTGACATAACCGGCGAGG 3¢
AAGAATTTCACCTCTGACAG 3¢
GCTTGCTTTTTGTTACTTTG 3¢
TGCGCGCGGCCTTTGCGT 3¢
ATTGCTTGTGTCCCTCCG 3¢
methods.
DNA was extracted from different sources of blood
samples from suspected sheep infected with Theileria or
Babesia.using the phenol/chloroform method, Tripure
reagent and MBST-Kit. DNA extraction using the Tri-
pure reagent must be modified in some cases such as
ethanol fixed blood samples due to the absence of some
5¢
5¢
5¢
5¢
5¢
5¢
5¢
5¢
5¢
5¢
389–402 bp Bab.)
669 bp
239 bp
235 bp
181 bp
179 bp
Fig. 3 Extracted DNA from infected blood smear with T. differentiation of Theileria and Babesia parasites infect-
listoquardi, B. ovisand B. motasi analysed with the primers drived ing small ruminants. At present in Iran this method is
from hyper variable region V4 of 18S rRNA. a chematicaly
demonstration of the partial gene from hyper variable region V4 of unpracticable due to the high cost. But our results
18S rRNA and localization of the different primers for PCR and showed that a common primer derived from hyper
seminested PCR. b Amplification of DNA from blood smear variable region V4 of 18S rRNA can be used for
infected with T. annulata (lane 1), T. lestoquardi (lane 2), B. ovis simultaneous differentiation of Theileria from Babesia
lane 3) and B. motasi lane 4) using primer P7/P8, M 100 bp marker.
c Seminested PCR with the PCR products from B: Lane 1 T.
by PCR on the 1.8% agarose gel in the carrier animals.
lestoquardi PCR product amplified with primer P9/P8, lane 2 and 3
B. motasi PCR product amplified with primers P11/P8 and P10/P8, Acknowledgment This work was supported by Grand no. 215/777
respectively, Lane 4 and 5 B. ovis PCR product amplified with of university of Tehran and by the Investigating Unit Molecular
primers P10/P8 and P11/P8, respectively Biological System Transfer (Iran).
Infection with a Babesia-like organism in northern California. Schnittger L, Yin H, Qi B, Gubbels MJ, Beyer D, Niemann S,
N Engl J Med 2 332(5):298–303 Jongejan F, Ahmed JS (2004) Simultaneous detection and dif-
Ramzi GR, Hosseini M, Aslani MR (2003) Identification of tick ferentiation of Theileria and Babesia parasites infecting small
vectors of ovine theileriosis in an endemic region of Iran. Vet ruminants by reverse line blotting. Parasitol Res 92(3):189–196
Parasitol 116:1–6 Shayan P, Biermann R, Schein E, Gerdes J, Ahmed JS (1998)
Rios L, Gonzalo A, Blair S (2003) Serological and parasitological Detection and differentiation of Theileria annulata and Theileria
study and report of the first case of human babesiosis in parva using macroschizont-derived DNA probes. An N Y Acad
Colombia. Rev Soc Bras Med Trop 36(4):493–498. Epub 2003 Sci 29:88–95
Aug 13 Shayan P, Gerlach G, Huegel F-U, Kay G, Ahmed JS (1999)
Schnittger L, Shayan P, Biermann R, Mehlhorn H, Gerdes J, Proliferation-associated nuclear protein Ki-67 in the bovine
Ahmed JS (2000a) Molecular genetic characterization and system: partial characterisation and its application for the
subcellular localization of Theileria annulata mitochondrial determination of the proliferation of Theileria-infected bovine
heat-shok protein 70. Parasitol Res 86:444–452 lymphoblastoid cells. Parasitol Res 85(8–9):613–620
Schnittger L, Yin H, Jianxun L, Ludwig W, Shayan P, Rahbari S, Thomford JW, Conrad PA, Telford SR, Mathiesen D, Bowman
Voss-Holtmann A, Ahmed JS (2000b) Ribosomal small-subunit BH, Spielman A, Eberhard ML, Herwaldt BL, Quick RE,
RNA gene-sequence analysis of Theileria lestoquardi and a Persing DH (1994) Cultivation and phylogenetic characteriza-
Theileria species highly pathogenic for small ruminants in tion of a newly recognized human pathogenic protozoan.
China. Parasitol Res 86(5):352–358 J Infect Dis 169(5):1050–1056
Schnittger L, Yin H, Jianxun L, Ludwig W, Shayan P, Rahbari S, Uilenberg G (1997) General review of tick-borne diseases of sheep
Voss-Holtmann A, Ahmed JS (2000c) Phylogenetic analysis by and goats worldwide. Parasitology 39:161–165
rRNA comparison of the highly pathogenic sheep-infecting Zintle A, Mulcahy G, Skerrett HE, Taylor SM, Gray JS(2003)
parasites Theileria lestoquardi and a Theileria species identified Babesia divergens, Bovine blood parasite of veterinary and
in China. Ann N Y Acad Sci 916:271–275 zoonotic importance. Clin Microbiol Rev 16(4):622–636