Infection, Genetics and Evolution 95 (2021) 105040

Contents lists available at ScienceDirect

Infection, Genetics and Evolution

journal homepage: www.elsevier.com/locate/meegid

The genetic and morphological diversity of Haemogregarina infecting turtles

in Colombia: Are mitochondrial markers useful as barcodes for
these parasites?
Germán A. Gutierrez-Liberato a, b, 1, Ingrid A. Lotta-Arévalo b, 1, Leydy P. González b,
Mario Vargas-Ramírez c, d, Oscar Rodríguez-Fandiño e, Axl S. Cepeda b, f,
Martha Lucia Ortiz-Moreno g, Nubia E. Matta b, *
a
Departamento de Salud pública, Facultad de Medicina, Universidad Nacional de Colombia, PO 11321, Bogotá, Colombia
b
Departamento de Biología, Facultad de Ciencias, Universidad Nacional de Colombia, PO 11321, Bogotá, Colombia
c
Instituto de genética, Universidad Nacional de Colombia, PO 11321, Bogotá, Colombia
d
Estación Biológica Tropical Roberto Franco, Universidad Nacional de Colombia, Villavicencio, Meta, Colombia
e
Dirección de investigación, Fundación Universitaria Internacional del Trópico Americano Unitrópico, Yopal, Casanare, Colombia
f
Institute for Genomics and Evolutionary Medicine (iGEM), Temple University, Philadelphia, PA, USA
g
Departamento de Biología y Química, Facultad de Ciencias Básicas e Ingeniería, Universidad de los Llanos-UNILLANOS, Villavicencio, Meta, Colombia

A R T I C L E I N F O A B S T R A C T

Keywords: Adeleorinid parasites commonly infect turtles and tortoises in nature. Currently, our knowledge about such
Adeleorina parasites is extremely poor. Their characterization is based on morphological and molecular approaches using
Mitochondrial molecular markers the 18S rDNA molecular marker. However, there is a limitation with the 18S rDNA due to its slow rate of
Species delimitation
evolution. For that reason, the goals of this study were to 1) design primers for new molecular mitochondrial
Testudines
markers to improve the phylogenetic reconstructions of adeleorinid parasites and 2) to determine the morpho­
logical and genetic diversity of Haemogregarina infecting turtles and tortoises in Colombia. Turtles from 16
species representing six families were examined for the presence of haemoparasites. We analyzed 457 samples
using PCR, and 203 of them were also analyzed by microscopy. Using a mitochondrial genome of Haemogregarina
sequenced in this study, we designed primers to amplify fragments of the cytochrome oxidase I (coxI), cyto­
chrome oxidase III (coxIII), and cytochrome b (cytb) mitochondrial markers in adeleorinid parasites. Lineages
obtained from nuclear and mitochondrial molecular markers clustered according to the turtle lineages from
which they were isolated. It is noteworthy that we found different evolutionary lineages within the same mor­
photype, which may indicate heteroplasmy and/or cryptic diversity in Haemogregarina. Due to this situation, we
could not make a species delimitation, even when integrating the different lines of evidence we had in this study.
However, the primers presented here are useful for diagnosis and, moreover, according to the available infor­
mation, all three genes retain phylogenetic signals; thereby fragments amplified can be used in reconstructing
evolutionary relationships. This effort contributes to the knowledge of the diversity of these parasites infecting
continental turtles from Colombia.

1. Introduction their hosts’ communities in wildlife (Martinsen et al., 2008; Ricklefs

et al., 2014). The main parasitic infections in turtles reported are
Parasitic infections have a determining role in the composition of amoebas, nematodes, flatworms, and protozoans (Lainson, 2012;

Abbreviations: H., Hepatozoon; Hae., Haemogregarina.

* Corresponding author.
E-mail addresses: gagutierrezl@unal.edu.co (G.A. Gutierrez-Liberato), ialottaa@unal.edu.co (I.A. Lotta-Arévalo), lpgonzalezca@unal.edu.co (L.P. González),
maavargasra@unal.edu.co (M. Vargas-Ramírez), direccioninvestigacion@unitropico.edu.co (O. Rodríguez-Fandiño), tul54064@temple.edu (A.S. Cepeda),
mlortiz@unillanos.edu.co (M.L. Ortiz-Moreno), nemattac@unal.edu.co (N.E. Matta).
1
contributed equally to this work as first authors.

https://doi.org/10.1016/j.meegid.2021.105040
Received 14 April 2021; Received in revised form 4 August 2021; Accepted 12 August 2021
Available online 14 August 2021
1567-1348/© 2021 Elsevier B.V. All rights reserved.
G.A. Gutierrez-Liberato et al.
Miñana-Morant and Ponce-Gordo, 2018; Telford, 2009). The genus
Haemogregarina is one of the most common haemoparasite in turtles
(Davis and Sterrett, 2011; Dvořáková et al., 2014; Rossow et al., 2013;
Soares et al., 2014). In Colombia, the haemoparasite diversity present in
turtles remains unknown. Only a few studies have addressed this issue,
which reports the infection with Haemocystidium sp. in Podocnemis vogli-
Savanna Sideneck Turtle (González et al., 2019) and Rhinoclemmys
melanosterna-Colombian Wood Turtle (Gutierrez-Liberato et al., 2021).
Those results are only a little piece of the puzzle of blood parasites in
turtles from Colombia.
Haemogregarina are grouped along with Hepatozoon, Hemolivia,
Karyolysus, Dactylosoma, Desseria, and Cirilia within the Adeleorina
suborder (Adl et al., 2019). They are vector-borne blood parasites of the
Apicomplexa phylum, a highly diverse group of intracellular protozoa
that infects birds, reptiles, and mammals (Morrison, 2009). However, it
is almost exclusively found in turtles (da Costa Maia, 2015; Lainson,
2012; Telford, 2009) and is transmitted by leeches (Arizza et al., 2016;
Paterson and Desser, 1976; Siddall and Desser, 1990). As for all hae­
moparasites, the diagnosis of Haemogregarina has been made tradition­
ally through the study of blood films stained with Giemsa under the light
microscope (Telford, 2009; Valkiūnas, 2005). Thus, parasite identifica­
tion relies on morphological and morphometrical features and the ef­
fects of these parasites on their host cell. Unfortunately, for most
Adeleorina, those features remain insufficient for species determinations
(Ball, 1967; Sloboda et al., 2007; Telford, 2009).
Molecular diagnosis has gained relevance for its sensitivity (Bensch
et al., 2004; Maia et al., 2016; Martinsen et al., 2008). For adeleorinid
parasites, molecular diagnosis relies on the amplification of 18S rDNA
nuclear gene fragments. This molecular marker has a slow evolutionary
rate, making it ideal for reconstructing the evolutionary relationships
between distantly related groups, rather than being a barcode sequence
useful in discerning and estimating the phylogenetic hypotheses be­
tween closely related groups. For that reason, the 18S rDNA nuclear
gene has limitations for species determinations.
Furthermore, the presence of highly divergent paralogous copies of
18S rDNA in parasites such as Eimeria spp. and Plasmodium spp. is known
(Corredor and Enea, 1994; El-Sherry et al., 2013; Nishimoto et al.,
2008). Consequently, it may lead to an overestimation of parasites di­
versity and to unclear phylogenetic estimations.
In other Apicomplexa such as malaria parasites, the extrachromo­
somal genomes like apicoplast and mitochondrial genomes are widely
used for taxonomic purposes and for the study of the evolutionary re­
lationships of the group (Pacheco et al., 2018b; Valkiūnas et al., 2019).
Moreover, while haemosporidian parasites like Plasmodium, which ex­
hibits syngamy without syzygy, have a high synteny in mitochondrial
genomes (Böhme et al., 2018), in Adeleorina parasites, some rear­
rangements make it challenging to design primers for those genomes
(Léveillé et al., 2019a). Currently, there is mitochondrial information
from a few Hepatozoon species, and only one sequence from the apico­
plast genome is available (Léveillé et al., 2019a).
The evolutionary history of turtles reflects millions of years of evo­
lution and multiple biogeographical events that have resulted in more
than 350 species worldwide at present (Rhodin et al., 2017). Here, we
explore the hemoparasites associated with some of the turtle species
found in different ecosystems in Colombia. The species analyzed are
mainly distributed in the northern countries of South America (Rhodin
et al., 2017). within the country, some of these species belonging to the
same suborder share a sympatric distribution (i.e., Podocnemis vogli,
Podocnemis unifilis, and Podocnemis expansa); but also, some species from
different suborders share their distribution (i.e., Rhinoclemmys mela­
nosterna, Podocnemis lewyana, and C. carbonaria) (Rhodin et al., 2017;
Rueda-Almonacid et al., 2007). Therefore, the goals of this study were to
1) design primers for the amplification of new molecular markers from
the mitochondrial genome of Haemogregarina and 2) test them so using
molecular information from the nuclear and mitochondrial markers
along with morphological information to characterize the diversity of
2
Infection, Genetics and Evolution 95 (2021) 105040
haemoparasites in a representative group of Colombian turtles.
2. Materials and methods
2.1. Samples and microscopic analysis
We analyzed samples from 458 turtles and tortoises belonging to 16
species found on both sides of the Colombian Andes mountains (Table 1,
Fig. 1). Individuals were captured by hand as well as using funnel traps
and fishing nets. Blood samples were collected by puncture of the
coccygeal vein and the subcarapacial venous sinus and did not exceed
1% of the sampled individual’s weight.
Blood films from 203 turtle individuals were fixed with methanol for
five minutes and stained with Giemsa 4% pH 7.2 for 45 min (Rodríguez
and Matta, 2001). The remaining samples did not have film preparations
since those samples belong to a biological collection whose main
objective is to investigate the genomes of the hosts. Part of the blood
sample was stored in an EDTA buffer (0.05 M Tris, 0.15 M NaCl, pH 8.0)
or ethanol for molecular analysis. The samples were kept at room tem­
perature in the field and then frozen at − 20 ◦ C in the laboratory.
We examined the blood films by double-blind under light microscopy
(Table 1) and obtained digital images from positive smears using an
Olympus DP27 digital camera coupled with an Olympus CX41 micro­
scope (Olympus Corporation, Tokyo, Japan). The morphological deter­
mination was performed by comparing the taxonomic characters of the
parasite forms observed on the slides with the original descriptions and
previous reports of Haemogregarina (Siddall and Desser, 1992; Soares
et al., 2014; Telford, 2009; Úngari et al., 2018).
2.2. Mitochondrial genome sequencing, primer design, and analysis of
cytb, coxI, and coxIII
2.2.1. Sample collection, gDNA extraction, and sequencing
Almost 1 mL of anticoagulated blood (EDTA) was taken from the
Podocnemis vogli (GERPH-PVM26, lineage PVM26_ 18S_POVOG_002)
infected with Haemogregarina sp., with an intensity of infection of 1.7%.
DNA was extracted using the standard phenol-chloroform protocol
(Sambrook et al., 1989). The DNA concentration obtained was 1200 ng/
μL as determined by a NanoDrop spectrophotometer (Thermoscientific
nanolite). The NGS sequencing library was prepared from 1.2 μg gDNA
by random fragmentation of the DNA sample, followed by 5′ and 3′
adapter ligation according to the TruSeq DNA PCR free sample prepa­
ration kit (insert size average 350 bp; Illumina). Sequencing and library
preparation was conducted using an Illumina Hiseq X. One full lane was
used for this experiment.
2.2.2. Raw data, pre-processing, and assembly
The Illumina HiSeq X generated raw images and base calling were
analyzed through an integrated primary analysis software called RTA2
(Real-Time Analysis 2). The BCL (base calls) binary was converted into
FASTQ using the Illumina package bcl2fastq2-v2.20.0. Read quality was
determined using the FastQC software (Brown et al., 2017). Low quality
read ends and adapter sequences were removed using Trimmomatic
software (Bolger et al., 2014). The trimmed reads were mapped using
the Podocnemis expansa-Giant South American River Turtle representa­
tive genome (accession number GCA_007922195.1) using Burrows-
Wheeler aligner long-read alignment (BWA-mem; Li and Durbin,
2010). Reads mapped to the P. expansa genome were removed, and only
unmapped reads were used for de novo assembly processes. De novo
assembly was done using St. Petersburg genome assembler (SPAdes;
Bankevich et al., 2012) with default parameters and k-mers of 33, 55, 77
and 99.
2.2.3. Primer design for mitochondrial molecular markers
Seven Haemogregarina primer sets were designed (Table 2, Fig. 2)
based on an alignment using the conserved regions between the
G.A. Gutierrez-Liberato et al. Infection, Genetics and Evolution 95 (2021) 105040

Table 1
Occurrence of Haemogregarina sp., in colombian turtles sampled during this study.
Species Locality nT nmic Haemogregarina

Chelidae Bolívar
Mesoclemmys dahli San Juan de Nepomuceno. (16) 1 0 0
9.945930 N; − 75.081577 W.
Córdoba
Lorica.(5) 4 3 0
9.2442 N; − 75.864 W
Magdalena
Pivijay. (20) 1 0 0
10.467272 N; − 74.625079 W
Sucre
Sincelejo. (12) 5 0 0
9.289743 N; − 75.378355 W
Mesoclemmys gibba Cundinamarca
Medina.(29) 7 4 1
4.43222 N; − 73.34 W
Guaviare
El Retorno. (38) 1 0 1
2.540278 N; − 72.714167 W
Mesoclemmys sp. Guaviare El Retorno. (38) 1 0 1
2.540278 N; − 72.714167 W

Emydidae
Trachemmys medemi Chocó
Unguía(2). 5 0 0
8.041538 N; − 77.095164 W.
Trachemys venusta callirostris Córdoba
Lorica. (5) 11 11 0
9.2442 N; − 75.864 W

Geoemydidae
Rhinoclemmys melanosterna Antioquia
Yondó*(23) 5 4 4
6.8053611 N; − 74.2065 W
Puerto Berrío. (8) 1 0 0
7.8712778 N; − 75.32742 W
Caucasia. 11 0 0
7.87128 N; − 75.327 W.
Bolívar Arjona. (17) 12 0 0
10.267 N; 75.336 W.
Cesar
Chimichagua. 1 0 0
9.25 N; − 73.81 W
Terraplén. (22) 7 0 0
7.88283 N; − 73.744 W
Loma Corredor. (21) 4 0 0
8.1358 N; − 73.775 W
Córdoba
Lorica. (5) 10 0 4
9.2442 N; − 75.864 W
Rhinoclemmys diademata Cundinamarca Bogotá. (28) 1 0 0
4.6397 N.-74.083 W

Kinosternidae
Kinosternon scorpioides Atlantico
Sabanalarga. (19) 3 0 0
10.63 N; − 74.923611 W
Bolívar
(16)
San Juan de Nepomuceno. 9.945930 N; − 75.081577. 1 0 0
Córdoba 0
Ayapel. (9) 1 0 0
8.316507 N; − 75.139045 W.
Ciénaga de Oro. (6) 1 0 0
8.871498 N. -75.626825 W
Lorica. (5) 7 3 0
9.2442 N; − 75.864 W
Montería. (4) 1 0 0
8.749348 N. -75.899789 W
Planeta Rica (7). 1 0 0
8.419428 N. -75.577301 W
Sahagún. (11) 11 0 0
8.906797 N. -75.418705 W
Valencia.(3) 11 0 0
8.250278 N. -76.143621 W
Magdalena
Pivijay. (20) 3 0 0
10.467272 N; − 74.625079 W
(continued on next page)

3
G.A. Gutierrez-Liberato et al. Infection, Genetics and Evolution 95 (2021) 105040

Table 1 (continued )
Species Locality nT nmic Haemogregarina

Sucre
Colosó. (14) 8 0 0
9.493125 N. 75.346848 W
Sincelejo. (12) 8 0 0
9.289743 N; − 75.378355 W
Tolú Viejo. (13) 6 0 0
9.459174 N. -75.451792 W

Podocnemididae
Peltocephalus dumerilianus Guainía(37) 2.800577 N. -69.283369 W 1 0 0
Podocnemis erythrocephala Guainía(37)
Puerto Inírida. 21 0 3
3.871 N. -67.931 W
Vichada(35) 4.989261 N. -68.502987 W 1 0 1
Podocnemis expansa Guainía(37) 3 0 0
Puerto Inírida.
3.871 N. -67.931 W
Podocnemis lewyana Antioquia Yondó. (23) 1 0 1
6.8053611 N; − 74.2065 W
Cesar
Chimichagua. 2 0 0
9.25 N; − 73.81 W
Cundinamarca(24)
4.365176 N. -74.665544 W 1 0 0
Córdoba
(5)
Lorica. 27 11 0
9.2442 N; − 75.864 W
Tolima
Prado. (27) 12 0 1
3.755476 N; − 74.918795 W
Melgar. (26) 1 0 0
4.212085 N. -74.681424 W
Podocnemis vogli Casanare
Paz de Ariporo*.(32) 134 134 134
5.705 N; − 71.2464 W
Meta
Villavicencio. (30) 12 12 12
4.064195 N; − 73.617260 W.
Vichada
Puerto Carreño*.(34) 6.2852778 N; − 67.8372 W 13 13 13
Podocnemis unifilis Arauca
Cravo Norte. (33) 1 0 1
6.2419 N; − 70.241958 W
Vichada
Cumaribo (36) 1 0 1
3.3741111 N; − 69.51342 W

Testudinidae
C. carbonaria Antioquia
Yondó. (23) 5 5 0
6.81 N. -74.20 W
Arauca
Cravo Norte. (33) 3 0 0
6.2419 N; − 70.241958 W
Puerto Carreño. (34) 1 0 0
6.2852778 N; − 67.8372 W
Atlántico
Luruaco. (18) 7 0 0
10.608717 N. -75.147307 W
Sabanalarga. 5 0 0
10.63 N; − 74.923611 W
Bolívar
San Juan de Nepomuceno. 9.945930 N; − 75.081577 W. 5 0 0
Zambrano. (15) 5 0 0
9.754135 N. -74.817447 W
Casanare
Aurora. (31) 2 0 0
6.016587 N. -71.369955 W
Paz de Ariporo. (32) 1 1 0
5.705 N; − 71.2464 W
Córdoba
Lorica. (5) 8 0 0
9.2442 N; − 75.864 W
Sahagún. (11) 5 0 0
8.906797 N. -75.418705 W
Cundinamarca
(continued on next page)

4
G.A. Gutierrez-Liberato et al. Infection, Genetics and Evolution 95 (2021) 105040

Table 1 (continued )
Species Locality nT nmic Haemogregarina

Nilo. (25) 3 0 0
4.304408 N. -74.618090 W
Magdalena
Pivijay. (20) 10 0 0
10.467272 N; − 74.625079 W
San Andrés
San Andrés(1). 2 0 0
12.548626 N; − 81.71965 W.
Sucre
La Unión. (10) 2 0 0
8.833639 N; − 75.300279 W
Sincelejo. (12) 7 0 0
9.289743 N; − 75.378355 W
Tolú Viejo. 2 0 0
9.459174 N. -75.451792 W
Vichada
Puerto Carreño.(34) 1 0 0
6.2852778 N; − 67.8372 W
(35)
Chelonoidis denticulata Vichada
Cumaribo*(36) 2 2 0
3.3741111 N; − 69.51342 W
Putumayo(39)
0.520826 N. -76.556687 W 1 0 0

Total 457 203 177

Overall prevalence of infection 38.7%

nT: Total individuals analyzed, nmic: Samples analyzed by microscopy, *: samples with other infections detected. Super-index numbers correspond to the localities
mapped in Fig. 1.

mitochondrial genome of Klosiella equi (GenBank accession number
MH203050.1, Léveillé et al., 2019b) which is the closest species to the
parasite sequenced and the fragments of each one coxI, coxIII and cytb
obtained from the NGS sequencing process. PCR reactions were per­
formed following the premix profile used by Pacheco et al. (2018a).
2.3. DNA extraction and 18S rDNA gene amplification
DNA was extracted from blood samples using DNeasy Blood and
Tissue Kit (QIAGEN, Valencia, CA, USA), quantified using a NanoDrop
Lite spectrophotometer (Thermo Scientific, Massachusetts, USA) and its
integrity checked by performing electrophoresis in agarose gel.
PCR amplifications of the 18S rDNA were done using the primers
HepF300 / Hep900 (Ujvari et al., 2004), from which a fragment of about
600 bp was expected. PCR products’ purification was carried out using
the ethanol and ammonium acetate protocol (Bensch et al., 2000). Af­
terwards, purified PCRs were sequenced in both directions using a
3730xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA). To
corroborate that the lineages obtained corresponded to true sequences
rather than chimeric products generated by the presence of multiple
infections, all samples were tested at least two times in independent
assays. The electropherograms were carefully inspected and edited.
2.4. Index of substitution saturation
The mtDNA is prone to substitution saturation that can lead to loss of
the phylogenetic signal. Therefore, the entropy-based index of substi­
tution saturation (Xia et al., 2003) was calculated for each molecular
marker fragment independently, using the software Dambe v6.4.81 (Xia,
2017). For this purpose, three alignments were constructed, including
different lineages of Haemogregarina produced in this study (16 for coxI,
25 for cytb, and 17 for coxIII) along with sequences of Klosiella equi
(GenBank acc. N◦ MH203050), Eimeria maxima (GenBank acc. N◦
HQ702481), Hepatozoon catesbianae (GenBank acc. N◦ NC_044466), and
Hepatozoon griseisciuri (GenBank acc. N◦ MK452389).
2.5. Phylogenetic analyzes and genetic divergence
All sequences were edited manually, and for each gene, an alignment
was constructed using MEGA 7 (Kumar et al., 2016). For 18S rDNA se­
quences, two alignments were constructed: the first one using fragments
of 585 bp and the second one with sequences of 1450 bp. In these
alignments, sequences of five Haemogregarina species reported in Gen­
Bank along with the lineages produced in this study were included.
Additionally, two Hepatozoon sequences, H. catesbianae (Léveillé et al.,
2014) and H. griseisciuri (Léveillé et al., 2020), were used as an outgroup.
These parasite lineages were aligned in the online tool MAFFT ver7
(Katoh and Standley, 2013, https://mafft.cbrc.jp/alignment/server/),
using the Q-INS-i option, which considers the secondary structure of
RNA.
To assess the phylogenetic resolution of each fragment, evolutionary
relationships of each marker were estimated independently. The align­
ments constructed with sequences of each of the mitochondrial molec­
ular markers amplified did not include sequences of the five species
identified used in the 18S alignment since these species did not have
mitochondrial sequences available. For these analyzes only the se­
quences generated in this study and the lineages from the two Hep­
atozoon species used as outgroup were included and aligned using the
Clustal Omega tool (McWilliam et al., 2013). In all cases, the best fit
model of nucleotide substitution was estimated using the corrected
Akaike criterion implemented in JModeltest 2.1.1 (Darriba et al., 2012).
Phylogenetic reconstructions were performed using both Bayesian
inference (BI) using MrBayes version 3.1.2 (Ronquist and Huelsenbeck,
2003) and maximum likelihood (ML), using the online tool PhyML 3.0
(Guindon et al., 2009) available at http://www.atgc-montpellier.fr/ph
yml/. For BI two independent Markov chain Monte Carlo (MCMC)
simulations were run simultaneously using 10 × 106 generations for
both 18S analyzes and 5 × 106 generations for mitochondrial molecular
markers, sampling every 500 generations. Majority-rule consensus
phylogenies were obtained from 30,000 trees for the 18S and 75,000
trees for mitochondrial molecular markers, after discarding 25% of the
trees as a burn-in period. For the ML analyzes, the nodal values were
calculated using a bootstrap of 1000 replications. All phylogenies were
observed and edited using FigTree 1.4.1 (Rambaut, 2016). Genetic

5
G.A. Gutierrez-Liberato et al. Infection, Genetics and Evolution 95 (2021) 105040

Fig. 1. Geographical location of the sampling sites. Names are provided in Table 1, according to the numbering. Localities dot colors are as follow: Antioquia: salmon
pink, Arauca: light purple; Casanare: medium blue; Córdoba: cyan; Cundinamarca: pale green, Guainía: pink, Guaviare: dark yellow; Meta: pale yellow; Tolima: light
grey; Vichada: brown; San Andres: pale blue; Sucre: dark red; Bolivar: white; Atlántico: orange; Putumayo: black; Cesar: dark grey, Choco: dark purple; and
Magdalena: dark blue. As for dot borders, light blue indicates insular lands, red corresponds to cis-Andean localities, black to trans-Andean sites and dark green for
Andean sites. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Table 2
Primers designed in the present study for amplification of coxI, coxIII and cytb.
Primer name Molecular marker Sequence (5′ -3′ ) PCR type Fragment size (bp) T◦ Anneal

HaemogCOXIIIF2 coxIII GACGCTTACTTCCCGGTC Nested (outer) 863 50

HaemogCOXIIIR1 GGCCCGACGGTAAGACCCTG
HaemogCOXIIIF1 GCTCATYTACAATCDTATCC Nested (inner) 740 56
HaemogCOXIIIR2 CTCTGAATAAAATACAAATTG
HaemogCOXIIIF3 GCATTCSTTGGWTATGTATTRC Nested /Direct (inner) 528 50
HaemogCOXIIIR3 CAACCAHACYAATTCWACRA
HaemogCOXIF2 coxI GATAAAATTCTTTGTTTCCATGTTG Direct 1211 56
HaemogCOXIR3 CADCCTTGYAGACTTTCTTG
HaemogCOXIF3 GCTGTCAGGHGGATTRTTTATG Direct 785 57.2
HaemogCOXIR2 GTTCAGCTGTTGGTTTTAGC
HaemogCOXIF3 GCTGTCAGGHGGATTRTTTATG Direct 565 55.4
HaemogCOXIR3 CADCCTTGYAGACTTTCTTG
HaemogCYTBF2 cytb GCYCATCTMCAATCWTATCC Direct 735 56 ◦ C
HaemogCYTBR1 GGWAGRAAATACCATTCAGG

6
G.A. Gutierrez-Liberato et al. Infection, Genetics and Evolution 95 (2021) 105040

Fig. 2. Schematic representation of the partial mitochondrial genome of Klosiella equi (Léveillé et al., 2019b) with the location of the primer sets developed in this
study. The dark and pale blue fragments indicate the genes from which the information was obtained during the Whole Sequencing Genome (WGS) proceedings.
Primer detailed information and expected product size for each oligonucleotide combination presented are provided in Table 2. (For interpretation of the references
to color in this figure legend, the reader is referred to the web version of this article.)

distances between lineages were estimated using a Kimura two- P. unifilis. (Yellow-spotted Sideneck Turtle).
parameter model of substitution, implemented in MEGA 7.0 (Kumar
et al., 2016).
3.2. Mitochondrial genome sequencing, primer design and analyzes of
3. Results cytb, coxI, and coxIII

3.1. Microscopic analyses
Samples from 458 individuals belonging to six families of continental
turtles and 16 species were analyzed (Table 1). In the peripheral blood
smears, we identified meronts (Fig. 3A), trophozoites, and immature and
mature gametocytes. Based on the morphological characteristics iden­
tified in the gametocytes as described by Telford (2009), we identified
four morphotypes (Fig. 3), which were found in coinfection in 66.7% of
the positive samples revised by microscopy (Table 1). Morphotypes 1
and 2 were the most common, while morphotype 4 was found only in
3.2.1. Raw data, assembly of the mitochondrial genome, and genetic
distances
A total of 1,019,330,560 reads were produced during the NGS
sequencing process. The GC content (%) was 44.62%, and Q20 was
96.7%. Eight partial sequences were obtained, corresponding to the
three protein-coding mitochondrial genes: coxIII (3 sequences), coxI (4
sequences), and cytb (1 sequence). Also, we obtained partial sequences
of the genes LSUE and LSUF which were adjacent to coxIII, and coxI
respectively, but these gene sequences were not used for the analyzes.
Genetic distances between the different lineages of coxI and coxIII
ranged between 0.16 and 0.24 (Table 3).

Fig. 3. Haemogregarina spp. morphotypes found in turtle species of Colombia. Merozoite (A) stages were scarce, and present only in samples with more than one
morphotype. Mature gamonts of morphotype 1 from P. vogli (B) and R. melanosterna (C). Morphotype 1 may present variations in the width and length of the parasite
as observed in images B and C. Morphotype 2 from P. vogli of Casanare (D) and Vichada (E), which may show variability in the configuration of the nucleus and the
length of the parasite; and morphotype 3 (F-G) found in P. vogli. The gamonts of morphotype 3 may exhibit a cap in one of the poles, as well as an intense granulation.
Morphotype 4 from P. unifilis (H). Black arrows indicate the host cell nucleus; the white arrows show the parasite nucleus; black arrowheads indicate granular
cytoplasm on morphotype 3, and white arrowheads, the merozoites in meronts. Double black arrowheads are placed in the cytoplasmic space. Giemsa-stained blood
films. Scale bar = 10 μm.

7
G.A. Gutierrez-Liberato et al. Infection, Genetics and Evolution 95 (2021) 105040

Table 3 3.2.2. Efficiency of primers

Genetic distances between mitochondrial molecular lineages of coxI, LSUF, Primers were tested in 83 Haemogregarina infections selected ac­
coxIII, and LSUE obtained from the whole genome sequencing of the Hemog­ cording to sample availability and quality detected in the following six
regarines sample. host species: Podocnemis erythrocephala-Red-headed Amazon River
Lineages Genetic distance ±SD Turtle (2 individuals), Podocnemis lewyana- Magdalena River Turtle (2
coxI LSUF coxIII LSUE ind.), P. unifilis (1 ind.), P. vogli, (70 ind.) Mesoclemmys gibba- Gibba
Turtle (1 ind.), and R. melanosterna (7 ind.) (Table S1). Using the primers
COXI_POVOG_001 vs. 0.1917 ± 0.0297 – –
sets shown in the Table 2 we obtained 119 sequences (GenBank acces­
±
COXI_POVOG_006 0.013 0.017
COXI_POVOG_001 vs. 0.173 ± 0.0097 ± – – sion numbers: cytb: MW418658-MW418702; coxI: MW418703-
COXI_POVOG_007 0.011 0.009 MW418742 and coxIII: MW418743- MW418776). The primer set used
COXI_POVOG_001 vs. 0.177 ± 0.0297 ± – – for cytb amplification was successful in 44/60 (73.3%) of the evaluated
COXI_POVOG_008 0.012 0.017
samples, from which only five corresponded to parasites isolated from
COXI_POVOG_006 vs. 0.181 ± 0.0196 ± – –
COXI_POVOG_007 0.012 0.014 species different from P. vogli. For coxI amplifications, the primer set
COXI_POVOG_006 vs. 0.157 ± 0.0000 ± – – COXIF3/COXIR2 was the most successful (65.6%, 21/32 samples
COXI_POVOG_008 0.012 0.00 tested), followed by COXIF2/COXIR3 (64.6%, 31/48), and lastly by
COXI_POVOG_007 vs. 0.177 ± 0.0196 ± – – COXIF3/COXIR3 45% (9/20). Despite being the most successful primer
COXI_POVOG_008 0.012 0.014
COXIII_POVOG_004 vs – – 0.238 ± 0.00 ±
set, COXIF3/COXIR2 oligonucleotides seem to show some specificity for
COXIII_POVOG_007 0.019 0.00 the lineages isolated from P. vogli since they were neither able to amplify
COXIII_POVOG_004 vs – – 0.206 ± 0.011 ± sequences of Haemogregarina infecting the other Podocnemididae spe­
COXIII_POVOG_017 0.018 0.011 cies nor parasites of the genus Mesoclemmys (Chelidae) or Rhinoclemmys
COXIII_POVOG_007 vs 0.195 ± 0.014 ±
– –
(Geoemydidae). Instead, with the primers COXIF2/COXIR3, two line­
COXIII_POVOG_017 0.017 0.014
ages, one from P. lewyana and one from R. melanosterna were amplified
(Table S1).
As for coxIII, the nested PCR using the combinations COXIIIF2/
COXIIIR1 as outer and COXIIIF1/COXIIIR2 as inner (success rate 75%,

Fig. 4. Phylogenetic reconstructions obtained from the Cytochrome b (cytb) with fragments of 730 bp. Color conventions of locality and host species are provided in
the figure’s upper left the associated morphotypes also are shown with different tip shapes. The nodal support values are indicated above the branches as BI/ML.
Nodal supports below 0.8/80 not shown.

8
G.A. Gutierrez-Liberato et al.
33/44 samples) showed a better percentage of success as compared to
the primer set COXIIIF3/COXIIIR3 (64.7%, 22/34 samples). Besides, it is
noteworthy that the primer COXIIIF3 showed cross-reaction with the
sequence of cytb in 3.6% of the samples. Therefore, the use of the nested
PCR protocol COXIIIF2/COXIIIR1 and COXIIIF1/COXIIIR2 is advisable.
3.2.3. Index of substitution saturation
Despite the high bias of A/T in most of the Adeleorinid parasite ge­
nomes and particularly the fragments amplified from Haemogregarina,
no saturation was found for any of the genes analyzed (Table S2).
3.3. Phylogenetic analyzes and genetic divergence
3.3.1. Mitochondrial molecular markers (cytb, coxI, coxIII)
Figs. 4–6 depict the Haemogregarina evolutionary relationships using
the mitochondrial molecular markers cytb, coxI, and coxIII, respectively.
As observed with the 18S rDNA, using mitochondrial markers, the
parasite lineages did not group according to the morphotypes they
exhibit but by the host species from which they were isolated.
As expected, a high genetic diversity of mitochondrial lineages was
found compared to the nuclear haplotypes previously established using
18S rDNA. Furthermore, the presence of multiple peaks in some se­
quences, as well as the isolation of at least two different lineages indi­
cating the presence of more than one PCR product in a unique sample,
were common (i.e., sample 109, lineages POVOG_019 and POVOG_020
for cytb; and sample 106, lineages POVOG_002 and POVOG_028 for
coxI). Consequently, data from all mitochondrial molecular markers
could not be concatenated and further analyzed as a single locus.
For the cytb, all revealed lineages were arranged in five clades
(Fig. 4). The clade A included the lineages isolated from P. lewyana,
P. unifilis, P. vogli, and two of the four samples of R. melanosterna
included in the analysis. The remaining samples from R melanosterna
lineages RMH011 and RMH015_Cytb_ RHMEL_001 were placed in clade
F (Fig. 4). Genetic distances between the lineages Cytb_POVOG_019 and
Cytb_POVOG_020 isolated from the sample PZAT109 was 0.146
Fig. 5. Phylogenetic reconstructions obtained from the Cytochrome oxidase I (coxI) fragments of about 1160 bp. Color conventions of locality and host species are
provided in the figure’s upper left, the morphotype associated also are shown with different tip shapes. The nodal support values are indicated above the branches in
this way BI/ML. Nodal supports below 0.8/80 are not shown.
9
Infection, Genetics and Evolution 95 (2021) 105040
(Table S3).
For the coxI, the clade A included all sequences isolated from P. vogli
along with a lineage of R. melanosterna arranged in three subclades
(Fig. 5, subclades AI, AII and AIII). Furthermore, the sequences isolated
from P. lewyana were placed in clade B. Additionally, lineages PZAT_105
and PZAT_083 appeared as successive sister lineages of the clade (AII +
AIII). The high genetic divergences found within clade A are note­
worthy, where the subclades AI and AIII are the most distantly related,
diverging at 0.172 (Table S4).
Compared with the other mitochondrial markers, the hypothesis
obtained from coxIII was poorly resolved at the deep nodes of the phy­
logeny since lineages were arranged in a polytomy (Fig. 6). Podocne­
mididae parasite sequences were placed in four well-supported clades,
regardless of the species of the host. Genetic distances between these
clades ranged between 0.13 and 0.24.
Nevertheless, pairwise genetic divergences among the Haemogre­
garina sequences included in the analyses may reach values far higher,
like the lineages obtained from Mesochlemys gibba (ASM488_COX­
III_MEGIB_001) that showed divergences from 0.48 to 0.592 (Table S5)
with the other Haemogregarina parasites.
Furthermore, although lineages isolated from P. lewyana were
revealed in clade B along with sequences amplified from P. vogli (Fig. 6),
great genetic distances (0.12–0.18; Table S5) differentiated the isolated
sequences of hosts of these two species.
3.3.2. 18S rDNA
We obtained thirty-one unique lineages of 585 bp, and forty-six se­
quences of about 1500 bp, from the six positive turtle species analyzed.
The host species dictated the groupings observed in the phylogenetic
reconstructions (Fig. 7 A, B). Three well- supported clades were formed:
the first clade (A)containing clades AI-AIV, groups were most of the
lineages from the eastern plains (Fig. 7A clades AI-AIV, blue, brown, and
light-yellow tips). In the clade B, one of the lineages isolated from
P. lewyana lies basal to the clade BI that contains the lineages found in
R. melanosterna sampled in a trans Andean location (see Fig. 1, dot 5, 4A
G.A. Gutierrez-Liberato et al. Infection, Genetics and Evolution 95 (2021) 105040

Fig. 6. Phylogenetic reconstructions obtained from Cytochrome oxidase III (coxIII) lineages of fragments of 500 bp approximately. Color conventions of locality and
host species are provided in the figure’s upper left; the morphotype associated also are shown with different tip shapes. The nodal support values are indicated above
the branches in this way BI/ML. Nodal supports below 0.8/80 are not shown.

Fig. 7. Phylogenetic tree based on 18S rDNA. (A) sequences of 585 base pair (bp) and(B) fragments of approximately 1450 bp. Tree topologies for both Bayesian
inference (BI) and Maximum Likelihood (ML) analyzes were similar. Both posterior probabilities (for BI) / bootstrap (ML) values are indicated above branches. Color
conventions of locality and host species are provided in the figure’s upper left, the morphotype associated also are shown with different tip shapes. Nodal supports
below 0.8/80 are not shown.

10
G.A. Gutierrez-Liberato et al.
light green branches), along with the parasite lineage amplified from
M. gibba, and P. erythrocephala, both species captured in cis Andean lo­
cations (Fig. 1, dots 37 and 38, Table 1).
The clade CII grouped only parasite sequences of R. melanosterna
appears as sister taxa of clade CI containing Haemogregarina sequences
from species previously reported in European and Asian hosts. Genetic
distances between the species H balli, H. Pellegrini, and H. stepanowi and
the lineages obtained in this study ranged between 0.048 and 0.10 while
with H. sacaliae divergences were from 0.05 to 0.11 (Table S6).
The lineages obtained from P. vogli (Fig. 7 clade A) clustered with
lineages of P. unifilis (POUNI_001, POUNI_002, and MF476205 Hae.
podocnemis) and P. lewyana (POLEW_001). The lineages POUNI_001 and
POUNI_002 were isolated from the same individual. The genetic dis­
tance between the sequences obtained from a P. unifilis and Hae.
podocnemis was about 1.8% (Table S7).
Furthermore, high variability on the 18S lineages from
R. melanosterna was detected. The clades BI and CII where the parasite
lineages isolated from this species differed at about 9.5%, larger than the
divergence between the outgroup and the clade CI that contained the
described species in the old world (8%) (Fig. 7A).
Regarding the phylogenetic reconstruction performed with se­
quences of 1450 bp fragments, there were few variations when
compared with the reconstruction obtained with the short fragment
(Fig. 7B). For example, of the samples PZAT73, 102, 109, 112 and 122
clustered in a small clade (Fig. 7A. Clade A) they were organized
differently within the polytomy compared with the group A of Hae­
mogregarina lineages obtained in the reconstruction with the short
fragment (Fig. 7A, Group A). Differences can be observed mainly in the
values of the nodal supports. When longer fragment sequences were
used, the nodal values were more robust and the changes in the length of
branches were apparent, such as PZAT 73, 112, 122 (Fig. 7B).
4. Discussion
This study represents the first attempt to describe the Haemogregarina
diversity of parasites infecting continental turtles in Colombia by using
information from new mitochondrial markers developed here and
standardized, in addition to the 18S rDNA and morphological features.
Nevertheless, to date, for this parasite genus, there are primers for
amplification of a small fragment (about 500 pb) of coxI gene (El Hili
et al., 2021). Then, to get more information, we designed primers for
longer gene fragments of the cytb, coxI, and coxIII based on the analysis
of the whole sequencing genome of a sample of Haemogregarina sp.
isolated from P. vogli.
4.1. Efficiency of primers
Primer combinations CYTBF2/CYTBR1 for cytb, COXIF2/COXIR3 for
coxI and the nested PCR COXIIIF2/COXIIIR1, COXIIIF1/COXIIIR2 for
coxIII gave excellent results to obtain fragments from 528 to 1211 pb of
such mitochondrial genes, for diagnosis of parasites infecting different
species of continental turtles of Colombia. Furthermore, the high num­
ber of lineages obtained revealed an astonishing diversity of lineages
hidden under the four morphotypes identified and the 18r DNA lineages
amplified.
4.2. Index of substitution saturation
Despite the high variability found among sequences, the mitochon­
drial molecular markers’ fragments showed low substitution saturation,
which indicates that they retain phylogenetic signal, thus being suitable
for phylogenetic analysis. Similar results have been achieved with other
Apicomplexa like Haemosporidians (Pacheco et al., 2018b). Yet, our
results contrast with previous studies in the closest taxa Eimeria; whose
coxI shows a substantial saturation (Ogedengbe et al., 2018). In this
regard, is important to note that the index of substitution saturation
11
Infection, Genetics and Evolution 95 (2021) 105040
critical (Iss.c) established by the test to determine the usability of the
sequences to “recover the true phylogeny” is highly dependent on the
number of taxa included (Xia et al., 2003). For Haemogregarina,
currently, there are few sequences from closest taxa available. Then such
lack of information might bias the estimation of substitution saturation.
4.3. Phylogenetic analyses and genetic divergence
Comparing the two reconstructions obtained using different
sequence lengths of the 18S rDNA (585 bp, Fig. 7A and 1450 bp Fig. 7B),
similarities between the two topologies could be observed. The differ­
ences between both topologies might be due to a taxa subsampling in the
reconstruction with the long fragment. In both phylogenetic re­
constructions, the samples from Neotropical hosts differed by more than
7% (Table S6.) concerning the Haemogregarina species sequences from
the old world. Also, using 18S rDNA we identified a single parasite
lineage associated with each morphotype (except for P. unifilis).
However, for the amplified mitochondrial molecular markers, it was
common to obtain sequences showing double peaks. This might indicate
either 1) there are co-infections non-recognizable by morphology
(cryptic species) that are common in Apicomplexa (most of this research
has been developed in haemosporida (Bensch et al., 2000; Galen et al.,
2018; Lotta et al., 2016). Such cryptic species are a consequence of few
diagnostic features of gametocytes or 2) there are multiple mitochon­
drial genotypes for the same lineage. The presence of one of those factors
(or both) made it impossible to concatenate the lineages from different
molecular markers to obtain a more robust phylogenetic hypothesis.
Recent multilocus sequencing of mitochondrial genes of adeleorinid
parasites indicate that under a single morphological species isolate,
more than two different genotypes are found (Léveillé, 2019; Léveillé
et al., 2020; El Hili et al., 2021). Thus, finding more than one sequence of
coxI and coxIII from the Haemogregarina sp. genome sequence obtained
in this study and multiple peaks in the sequences amplified from the
samples was not surprising. El Hili et al., 2021 using COI primers
designed mainly in Eimeria spp., identify multiple lineages in two
freshwater turtles in Tunisia. Strikingly for Haemogregarina balli, the
genetic distances between the four genotypes found in the same sample
are as high as 30% (Léveillé, 2019). However, this is not true in Hep­
atozoon species, e.g., H. griseisciuri where the identities percentage for
coxI and coxIII are 92% and 89.9%, respectively (Léveillé et al., 2020).
The genetic distances between sequences obtained in this study for coxI
and coxIII ranged between 0.16 and 0.25. Bearing these findings in
mind, we can speculate that genetic distances above 30% (0.30) in
mitochondrial markers might be associated with different parasite spe­
cies; as observed here, with the distances between the Haemogregarina
lineages isolated from P. vogli and R. melanosterna or P. lewyana
(Table S4; S6).
The organization of the mitochondrial genome in Haemogregarina is
little-known. A possible explanation of our results, which showed mul­
tiple copies highly divergent for mitochondrial molecular markers might
be heteroplasmy. This process has been documented in other Apicom­
plexa. For example, Schmedes et al. (2019) demonstrate this phenom­
enon when they tried to trace the geographic origin of Plasmodium
falciparum lineages in U.S.A Furthermore, heteroplasmy is also reported
in other organisms closely related to Apicomplexa (Waller and Jackson,
2009), such as dinoflagellates (Santos et al., 2002). Also, in Trypanosoma
cruzi heteroplasmy was demonstrated in the mitochondrial genome
using the maxicircle DNA’s deep sequencing methods (Messenger et al.,
2012). 2) Non-functional copies, NUMTs show variable genetic dis­
tances with the functional copies in the mitochondrial genome (Hiko­
saka et al., 2010). However, our results did not show stop codons within
the amplified sequence, a common feature in NUMTs.
The main limitations of data raised in this research are: 1) it was
impossible to link morphologies to a species. It was due the samples with
single infections, the meronts (which can add valuable information for
descriptions (Telford, 2009) were absent. 2) Although phylogenetic
G.A. Gutierrez-Liberato et al.
reconstructions performed with the nuclear molecular marker and the
mitochondrial coxI and cytb were highly congruent, the lack of concor­
dance using coxIII was probably due to a low number of lineages ob­
tained for this marker. 3) There are still few species of Haemogregarina
with their mitochondrial genomes characterized. Therefore, there are no
barcoding sequences identified yet.
For delimitation of species, the complete characterization of the life
cycles and the characteristics of the parasite forms at different stages of
the cycle must be carried out. This should be done through experimental
infections using species with well-defined genotypes. Unfortunately,
unlike other Apicomplexa such as haemosporidia, based on our results,
the mitochondrial markers of the haemogregarines are not generating
enough information to make a clear delimitation of species. These
markers seem to have peculiarities that must be studied in more detail.
In summary, the whole-genome sequencing process led to the design
of primers specific for Haemogregarina, useful for diagnosis. Further­
more, it provides almost complete sequences of mitochondrial genes
with a greater number of informative sites than the amplified fragments
that, according to the information available, still retain phylogenetic
signal making them suitable for more robust phylogenetic analysis. This
information along with nuclear genes and morphological traits will aid
to develop criteria for taxonomic delimitation that allow for an accurate
estimation of diversity; moreover, as address more profound questions
related to evolutionary history, coevolution, virulence, among others.
Compliance with ethical standards
The specimens analyzed in this study came from two biological
collections and newly collected samples obtained from individuals
captured in the wild during fieldwork. The specimens deposited in
biological collections were accessed under the provisions of Decree 1076
of 2015, while the newly collected samples from individuals captured in
the wild were performed under the permit 0255 of March 12, 2014, and
the modificatory resolution 1482 of November 20, 2015 granted by the
National Environmental Licensing Authority (ANLA). The procedures
performed were endorsed by the Fundación Universitaria Unitropico
and the Universidad Nacional de Colombia University’s ethics com­
mittee. All captured individuals were released after sampling.
CRediT authorship contribution statement
Germán A. Gutierrez-Liberato: Conceptualization, Methodology,
Formal analysis, Investigation, Writing – original draft, Writing – review
& editing, Visualization. Ingrid A. Lotta-Arévalo: Conceptualization,
Methodology, Formal analysis, Investigation, Data curation, Writing –
original draft, Writing – review & editing, Visualization, Funding
acquisition. Leydy P. González: Formal analysis, Investigation, Writing
– original draft. Mario Vargas-Ramírez: Conceptualization, Validation,
Writing – original draft, Funding acquisition. Oscar Rodríguez-
Fandiño: Validation, Funding acquisition. Axl S. Cepeda: Software,
Formal analysis, Investigation, Data curation. Martha Lucia Ortiz-
Moreno: Validation. Nubia E. Matta: Conceptualization, Validation,
Writing – original draft, Supervision, Funding acquisition.
Declaration of Competing Interest
None.
Acknowledgements
Many thanks to Ana María Saldarriaga for her assistance in the
Colección Banco de Tejidos de la Biodiversidad (BTBC) of the Instituto
de Genética, Universidad Nacional de Colombia, and to David Felipe
Pinto Osorio for his assistance in the Biological Collection GERPH of the
Biology Department Universidad Nacional de Colombia. We want to
thank the “Grupo de Investigación en Sustentabilidad Ambiental
12
Infection, Genetics and Evolution 95 (2021) 105040
(SUSA)” and the biology laboratory of the “Universidad de los Llanos” in
Villavicencio - Meta for their collaboration during the field work. This
study was supported by the “Ministerio de Ciencia, Tecnología e
Innovación” MINCIENCIAS (Projects code 1101-776-57872, Contract
80740-572-2020 code 75752, and program of postdoctoral stays con­
tract 400- 2019), the Vicerrectoría de investigación Universidad
Nacional de Colombia – Sede Bogotá project numbers 48445 and 50839;
and the agreement of Universidad Nacional de Colombia -MINCIENCIAS
for the postdoctoral stays program - contract 400-2019.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.meegid.2021.105040.
References
Adl, S.M., Bass, D., Lane, C.E., Lukeš, J., Schoch, C.L., Smirnov, A., Agatha, S., Berney, C.,
Brown, M.W., Burki, F., 2019. Revisions to the classification, nomenclature, and
diversity of eukaryotes. J. Eukaryot. Microbiol. 66, 4–119. https://doi.org/10.1111/
jeu.12691.
Arizza, V., Sacco, F., Russo, D., Scardino, R., Arculeo, M., Vamberger, M., Marrone, F.,
2016. The good, the bad and the ugly: Emys trinacris, Placobdella costata and
Haemogregarina stepanowi in Sicily (Testudines, Annelida and Apicomplexa). Folia
Parasitol. 63, 1. https://doi.org/10.14411/fp.2016.029.
Ball, G.H., 1967. Some blood sporozoans from East African reptiles. J. Protozool. 14,
198–210. https://doi.org/10.1111/j.1550-7408.1967.tb01983.x.
Bankevich, A., Nurk, S., Antipov, D., Gurevich, A.A., Dvorkin, M., Kulikov, A.S., Lesin, V.
M., Nikolenko, S.I., Pham, S., Prjibelski, A.D., 2012. SPAdes: a new genome assembly
algorithm and its applications to single-cell sequencing. J. Comput. Biol. 19,
455–477. https://doi.org/10.1089/cmb.2012.0021.
Bensch, S., Stjernman, M., Hasselquist, D., Örjan, Ö., Hannson, B., Westerdahl, H.,
Pinheiro, R.T., 2000. Host specificity in avian blood parasites: a study of Plasmodium
and Haemoproteus mitochondrial DNA amplified from birds. Proc. R. Soc. Lond. B
267, 1583–1589. https://doi.org/10.1098/rspb.2000.1181.
Bensch, S., Péarez-Tris, J., Waldenströum, J., Hellgren, O., 2004. Linkage between
nuclear and mitochondrial DNA sequences in avian malaria parasites: multiple cases
of cryptic speciation? Evolution 58, 1617–1621. https://doi.org/10.1111/j.0014-
3820.2004.tb01742.x.
Böhme, U., Otto, T.D., Cotton, J.A., Steinbiss, S., Sanders, M., Oyola, S.O., Nicot, A.,
Gandon, S., Patra, K.P., Herd, C., 2018. Complete avian malaria parasite genomes
reveal features associated with lineage-specific evolution in birds and mammals.
Genome Res. 28, 547–560. https://doi.org/10.1101/gr.218123.116.
Bolger, A.M., Lohse, M., Usadel, B., 2014. Trimmomatic: a flexible trimmer for Illumina
sequence data. Bioinformatics 30, 2114–2120. https://doi.org/10.1093/
bioinformatics/btu170.
Brown, J., Pirrung, M., McCue, L.A., 2017. FQC dashboard: integrates FastQC results into
a web-based, interactive, and extensible FASTQ quality control tool. Bioinformatics
33, 3137–3139. https://doi.org/10.1093/bioinformatics/btx373.
Corredor, V., Enea, V., 1994. The small ribosomal subunit RNA isoforms in Plasmodium
cynomolgi. Genetics 136, 857–865.
da Costa Maia, J.P.M., 2015. Diversity, Infection Patterns and Host-parasite Associations
of Apicomplexan Parasites in Reptiles. Ph. D. Thesis. Univ. do Porto, Porto, Port,
p. 370.
Darriba, D., Taboada, G.L., Doallo, R., Posada, D., 2012. jModelTest 2: more models, new
heuristics and parallel computing. Nat. Methods 9, 772. https://doi.org/10.1038/
nmeth.2109.
Davis, A., Sterrett, S., 2011. Prevalence of haemogregarine parasites in three freshwater
turtle species in a population in northeast Georgia, USA. Int. J. Zool. Res. 7, 156.
https://doi.org/10.3923/ijzr.2011.156.163.
Dvořáková, N., Kvičerová, J., Hostovský, M., Široký, P., 2014. Haemogregarines from
western Palaearctic freshwater turtles (genera Emys, Mauremys) are conspecific with
Haemogregarina stepanowi Danilewsky, 1885. Parasitology 141, 522–530. https://
doi.org/10.1017/S0031182013001820.
El Hili, R.A., Achouri, M.S., Verneau, O., 2021. Cytochrome c oxydase I phylogenetic
analysis of Haemogregarina parasites (Apicomplexa, Coccidia, Eucoccidiorida,
Haemogregarinidae) confirms the presence of three distinct species within the
freshwater turtles of Tunisia. Parasitol. Int. 82, 102306 https://doi.org/10.1016/j.
parint.2021.102306.
El-Sherry, S., Ogedengbe, M.E., Hafeez, M.A., Barta, J.R., 2013. Divergent nuclear 18S
rDNA paralogs in a turkey coccidium, Eimeria meleagrimitis, complicate molecular
systematics and identification. Int. J. Parasitol. 43, 679–685. https://doi.org/
10.1016/j.ijpara.2013.03.005.
Galen, S.C., Nunes, R., Sweet, P.R., Perkins, S.L., 2018. Integrating coalescent species
delimitation with analysis of host specificity reveals extensive cryptic diversity
despite minimal mitochondrial divergence in the malaria parasite genus
Leucocytozoon. BMC Evol. Biol. 18, 128. https://doi.org/10.1186/s12862-018-1242-
x.
González, L.P., Pacheco, M.A., Escalante, A.A., Maldonado, A.D.J., Cepeda, A.S.,
Rodríguez-Fandiño, O.A., Vargas-Ramírez, M., Matta, N.E., 2019. Haemocystidium
spp., a species complex infecting ancient aquatic turtles of the family
G.A. Gutierrez-Liberato et al.
Podocnemididae: first report of these parasites in Podocnemis vogli from the
Orinoquia. Int. J. Parasitol. 10, 299–309. https://doi.org/10.1016/j.
ijppaw.2019.10.003.
Guindon, S., Delsuc, F., Dufayard, J.-F., Gascuel, O., 2009. Estimating maximum
likelihood phylogenies with PhyML. In: Bioinformatics for DNA Sequence Analysis.
Springer, pp. 113–137. https://doi.org/10.1007/978-1-59745-251-9_6.
Gutierrez-Liberato, G.A., Lotta-Arévalo, I.A., Rodríguez-Almonacid, C.C., Vargas-
Ramírez, M., Matta, N.E., 2021. Molecular and morphological description of the first
Hepatozoon (Apicomplexa: Hepatozoidae) species infecting a neotropical turtle, with
an approach to its phylogenetic relationships. Parasitology 1–42. https://doi.org/
10.1017/S0031182021000184.
Hikosaka, K., Watanabe, Y., Tsuji, N., Kita, K., Kishine, H., Arisue, N., Palacpac, N.M.Q.,
Kawazu, S., Sawai, H., Horii, T., 2010. Divergence of the mitochondrial genome
structure in the apicomplexan parasites, Babesia and Theileria. Mol. Biol. Evol. 27,
1107–1116. https://doi.org/10.1093/molbev/msp320.
Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version 7:
improvements in performance and usability. Mol. Biol. Evol. 30, 772–780. https://
doi.org/10.1093/molbev/mst010.
Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: molecular evolutionary genetics
analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874. https://doi.
org/10.1093/molbev/msw054.
Lainson, R., 2012. Atlas de parasitas protozoários da fauna da Amazônia Brasileira.
Léveillé, A.N., 2019. Scratching the Surface: Diversity Among the First Sequenced
Extrachromosomal Genomes of Parasites in the Suborder Adeleorina (Apicomplexa)
With a Focus on Hepatozoon species. PhD Thesis. The University of Guelph, Ontario,
Canadá.
Léveillé, A.N., Ogedengbe, M.E., Hafeez, M.A., Tu, H.-H.A., Barta, J.R., 2014. The
complete mitochondrial genome sequence of Hepatozoon catesbianae (Apicomplexa:
Coccidia: Adeleorina), a blood parasite of the green frog, Lithobates (formerly Rana)
clamitans. J. Parasitol. 100, 651–657. https://doi.org/10.1645/13-449.1.
Léveillé, A.N., Baneth, G., Barta, J.R., 2019a. Next generation sequencing from
Hepatozoon canis (Apicomplexa: Coccidia: Adeleorina): complete apicoplast genome
and multiple mitochondrion-associated sequences. Int. J. Parasitol. 49, 375–387.
https://doi.org/10.1016/j.ijpara.2018.12.001.
Léveillé, A.N., Bland, S.K., Carlton, K., Larouche, C.B., Kenney, D.G., Brouwer, E.R.,
Lillie, B.N., Barta, J.R., 2019b. Klossiella equi infecting kidneys of Ontario horses: life
cycle features and multilocus sequence-based genotyping confirm the genus
Klossiella belongs in the Adeleorina (Apicomplexa: Coccidia). J. Parasitol. 105,
29–40. https://doi.org/10.1645/18-80.
Léveillé, A.N., El Skhawy, N., Barta, J.R., 2020. Multilocus sequencing of Hepatozoon cf.
griseisciuri infections in Ontario eastern gray squirrels (Sciurus carolinensis) uncovers
two genotypically distinct sympatric parasite species. Parasitol. Res. 119, 713–724.
https://doi.org/10.1007/s00436-019-06583-5.
Li, H., Durbin, R., 2010. Fast and accurate long-read alignment with Burrows–Wheeler
transform. Bioinformatics 26, 589–595. https://doi.org/10.1093/bioinformatics/
btp698.
Lotta, I.A., Pacheco, M.A., Escalante, A.A., González, A.D., Mantilla, J.S., Moncada, L.I.,
Adler, P.H., Matta, N.E., 2016. Leucocytozoon diversity and possible vectors in the
Neotropical highlands of Colombia. Protist 167, 185–204. https://doi.org/10.1016/
j.protis.2016.02.002.
Maia, J.P., Harris, D.J., Carranza, S., 2016. Reconstruction of the evolutionary history of
Haemosporida (Apicomplexa) based on the cyt b gene with characterization of
Haemocystidium in geckos (Squamata: Gekkota) from Oman. Parasitol. Int. 65, 5–11.
https://doi.org/10.1016/j.parint.2015.09.003.
Martinsen, E.S., Perkins, S.L., Schall, J.J., 2008. A three-genome phylogeny of malaria
parasites (Plasmodium and closely related genera): evolution of life-history traits and
host switches. Mol. Phylogenet. Evol. 47, 261–273. https://doi.org/10.1016/j.
ympev.2007.11.012.
McWilliam, H., Li, W., Uludag, M., Squizzato, S., Park, Y.M., Buso, N., Cowley, A.P.,
Lopez, R., 2013. Analysis tool web services from the EMBL-EBI. Nucleic Acids Res.
41, W597–W600. https://doi.org/10.1093/nar/gkt376.
Messenger, L.A., Llewellyn, M.S., Bhattacharyya, T., Franzén, O., Lewis, M.D.,
Ramírez, J.D., Carrasco, H.J., Andersson, B., Miles, M.A., 2012. Multiple
mitochondrial introgression events and heteroplasmy in Trypanosoma cruzi revealed
by maxicircle MLST and next generation sequencing. PLoS Negl. Trop. Dis. 6, e1584
https://doi.org/10.1371/journal.pntd.0001584.
Miñana-Morant, O., Ponce-Gordo, F., 2018. Prevalencia de parásitos intestinalesen
tortugas terrestres en cautividad y análisis de factores de riesgo. Clínica veterinaria
de pequeños animales: revista oficial de AVEPA, Asociación Veterinaria Española de
Especialistas en Pequeños Animales 38, 79–90.
Morrison, D.A., 2009. Evolution of the Apicomplexa: where are we now? Trends
Parasitol. 25, 375–382. https://doi.org/10.1016/j.pt.2009.05.010.
Nishimoto, Y., Arisue, S., Escalante, A.A., Horii, T., Tanabe, K., Hashimoto, T., 2008.
Evolution and phylogeny of the heterogeneous cytosolic SSU rRNA genes in the
genus Plasmodium. Molec. Phylogenet. Evolut. 47, 45–53. https://doi.org/10.1016/j.
ympev.2008.01.031.
Ogedengbe, M.E., El-Sherry, S., Ogedengbe, J.D., Chapman, H.D., Barta, J.R., 2018.
Phylogenies based on combined mitochondrial and nuclear sequences conflict with
morphologically defined genera in the eimeriid coccidia (Apicomplexa). Int. J.
Parasitol. 48, 59–69. https://doi.org/10.1016/S1055-7903(02)00326-3.
Pacheco, M.A., Cepeda, A.S., Bernotienė, R., Lotta, I.A., Matta, N.E., Valkiūnas, G.,
Escalante, A.A., 2018a. Primers targeting mitochondrial genes of avian
haemosporidians: PCR detection and differential DNA amplification of parasites
belonging to different genera. Int. J. Parasitol. 48, 657–670. https://doi.org/
10.1016/j.ijpara.2018.02.003.
13
Infection, Genetics and Evolution 95 (2021) 105040
Pacheco, M.A., Matta, N.E., Valkiūnas, G., Parker, P.G., Mello, B., Stanley Jr., C.E.,
Lentino, M., Garcia-Amado, M.A., Cranfield, M., Kosakovsky Pond, S.L., 2018b.
Mode and rate of evolution of haemosporidian mitochondrial genomes: timing the
radiation of avian parasites. Mol. Biol. Evol. 35, 383–403. https://doi.org/10.1093/
molbev/msx285.
Paterson, W.B., Desser, S.S., 1976. Observations on Haemogregarina balli sp. n. from the
common snapping turtle, Chelydra serpentina. J. Protozool. 23, 294–301. https://doi.
org/10.1111/j.1550-7408.1976.tb03775.x.
Rambaut, A., 2016. FigTree-version 1.4. 3, a graphical viewer of phylogenetic trees. In:
Computer Program Distributed by the Author. Institute of Evolutionary Biology,
University of Edinburgh. Available online: http://tree.bio.ed.ac.uk/software/figtree.
accessed on 16 October 2016.
Rhodin, A.G., Iverson, J.B., Bour, R., Fritz, U., Georges, A., Shaffer, H.B., Van Dijk, P.P.,
2017. Turtles of the World: Annotated Checklist and Atlas of Taxonomy, Synonomy,
Distribution, and Conservation Status. https://doi.org/10.3854/crm.7.checklist.
atlas.v8.2017.
Ricklefs, R.E., Outlaw, D.C., Svensson-Coelho, M., Medeiros, M.C., Ellis, V.A., Latta, S.,
2014. Species formation by host shifting in avian malaria parasites. Proc. Natl. Acad.
Sci. 111, 14816–14821. https://doi.org/10.1073/pnas.1416356111.
Rodríguez, O.A., Matta, N.E., 2001. Blood parasites in some birds from eastern plains of
Colombia. Memor. Inst. Oswaldo Cruz 96, 1173–1176. https://doi.org/10.1590/
S0074-02762001000800026.
Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: bayesian phylogenetic inference under
mixed models. Bioinformatics 19, 1572–1574. https://doi.org/10.1093/
bioinformatics/btg180.
Rossow, J.A., Hernandez, S.M., Sumner, S.M., Altman, B.R., Crider, C.G., Gammage, M.
B., Segal, K.M., Yabsley, M.J., 2013. Haemogregarine infections of three species of
aquatic freshwater turtles from two sites in Costa Rica. Int. J. Parasitol. 2, 131–135.
https://doi.org/10.1016/j.ijppaw.2013.02.003.
Rueda-Almonacid, J.V., Carr, J.L., Mittermeier, R.A., Rodríguez-Mahecha, J.V., Mast, R.
B., Vogt, R.C., Rhodin, A.G.J., de la Ossa-Velásquez, J., Rueda, J.N., Mittermeier, C.
G., 2007. Las tortugas y los cocodrilianos de los países andinos del trópico. Serie de
guías tropicales de campo 6, 412–423 (ISBN: 978-1-934151-10-5).
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual.
Cold Spring Harbor Laboratory Press.
Santos, S.R., Taylor, D.J., Kinzie III, R.A., Sakaj, K., Coffroth, M.A., 2002. Evolution of
length variation and heteroplasmy in the chloroplast rDNA of symbiotic
dinoflagellates (Symbiodinium, Dinophyta) and a novel insertion in the universal core
region of the large subunit rDNA. Phycologia 41, 311–318. https://doi.org/10.2216/
i0031-8884-41-4-311.1.
Schmedes, S.E., Patel, D., Kelley, J., Udhayakumar, V., Talundzic, E., 2019. Using the
Plasmodium mitochondrial genome for classifying mixed-species infections and
inferring the geographical origin of P. falciparum parasites imported to the US. PLoS
One 14, e0215754. https://doi.org/10.1371/journal.pone.0215754.
Siddall, M.E., Desser, S.S., 1990. Gametogenesis and sporogonic development of
Haemogregarina balli (Apicomplexa: Adeleina: Haemogregarinidae) in the leech
Placobdella ornata. J. Protozool 37, 511–520. https://doi.org/10.1111/j.1550-
7408.1990.tb01257.x.
Siddall, M.E., Desser, S.S., 1992. Prevalence and intensity of Haemogregarina balli
(Apicomplexa: Adeleina: Haemogregarinidae) in three turtle species from Ontario,
with observations on intraerythrocytic development. Can. J. Zool. 70, 123–128.
https://doi.org/10.1139/z92-018.
Sloboda, M., Kamler, M., Bulantová, J., Votýpka, J., Modrý, D., 2007. A new species of
Hepatozoon (Apicomplexa: Adeleorina) from Python regius (Serpentes: Pythonidae)
and its experimental transmission by a mosquito vector. J. Parasitol. 93, 1189–1198.
https://doi.org/10.1645/GE-1200R.1.
Soares, P., de Brito, E.S., Paiva, F., Pavan, D., Viana, L.A., 2014. Haemogregarina spp. in a
wild population from Podocnemis unifilis Troschel, 1848 in the Brazilian Amazonia.
Parasitol. Res. 113, 4499–4503. https://doi.org/10.1007/s00436-014-4139-7.
Telford, S.R., 2009. Hemoparasites of the Reptilia: Color Atlas and Text. CRC Press.
Ujvari, B., Madsen, T., Olsson, M., 2004. High prevalence of Hepatozoon spp.
(Apicomplexa, Hepatozoidae) infection in water pythons (Liasis fuscus) from tropical
Australia. J. Parasitol. 90, 670–672. https://doi.org/10.1645/GE-204R.
Úngari, L.P., Santos, A.L.Q., O’Dwyer, L.H., da Silva, M.R.L., de Melo Fava, N.N.,
Paiva, G.C.M., de Pinto, R., Cury, M.C., 2018. Haemogregarina podocnemis sp. nov.:
description of a new species of Haemogregarina Danilewsky 1885 (Adeleina:
Haemogregarinaidae) in free-living and captive yellow-spotted river turtles
Podocnemis unifilis (Testudines: Podocnemididae) from Brazil. Parasitol. Res. 117,
1535–1548. https://doi.org/10.1007/s00436-018-5817-7.
Valkiūnas, G., 2005. Avian Malaria Parasites and Other Haemosporidia. CRC press, Boca
Ratón, Florida.
Valkiūnas, G., Ilgūnas, M., Bukauskaitė, D., Chagas, C.R.F., Bernotienė, R., Himmel, T.,
Harl, J., Weissenböck, H., Iezhova, T.A., 2019. Molecular characterization of six
widespread avian haemoproteids, with description of three new Haemoproteus
species. Acta Trop. 197, 105051 https://doi.org/10.1016/j.
actatropica.2019.105051.
Waller, R.F., Jackson, C.J., 2009. Dinoflagellate mitochondrial genomes: stretching the
rules of molecular biology. Bioessays 31, 237–245. https://doi.org/10.1002/
bies.200800164.
Xia, X., 2017. DAMBE6: new tools for microbial genomics, phylogenetics, and molecular
evolution. J. Hered. 108, 431–437. https://doi.org/10.1093/jhered/esx033.
Xia, X., Xie, Z., Salemi, M., Chen, L., Wang, Y., 2003. An index of substitution saturation
and its application. Molecular Phylogenet. Evol. 26, 1–7. https://doi.org/10.1016/
S1055-7903(02)00326-3.