Effects of commercial organic acid blends on male broilers challenged

with E. coli K88: Performance, microbiology, intestinal morphology,

and immune response

N. Khodambashi Emami,∗ A. Daneshmand,∗ S. Zafari Naeini,†,‡ E. N. Graystone,§ and L. J. Broom§,#,1

∗
Department of Animal Science, Ferdowsi University of Mashhad, Mashhad, Iran, 91779-48974; † Technical
Responsible, Shamim Roshd Espadan Co., Sepahan Shahr, Isfahan, Iran; ‡ Department of Animal Science,
Shahrekord University, Shahrekord, Iran, 88186-34141; § Anpario PLC, Manton Wood Enterprise Park, Worksop,
Nottinghamshire, S80 2RS, United Kingdom; and # Faculty of Biological Sciences, University of Leeds, Leeds LS2
9JT, United Kingdom

ABSTRACT This study assessed the effects of 3
commercial organic acid (OA) preparations on growth
performance, intestinal morphology, cecal microbiol-
ogy, and immunity of Escherichia coli K88-challenged
(ETEC) broiler chickens. One thousand one-day-old
male broiler chickens were divided into 8 treatments of
5 replicate pens: Negative control (NC) birds received
a basal diet (BD) and were not challenged with ETEC;
positive control (PC) birds fed the BD and challenged
with ETEC; BD + 0.2% (S1) or 0.4% (S2) of an OA
mixture (Salkil) from one to 35 d; BD + 0.1, 0.075,
and 0.05% (O1) of another OA mixture (Optimax) in
the starter (one to 10 d), grower (11 to 24 d), and fin-
isher (25 to 35 d) diets, respectively, or 0.1% (O2) from
one to 35 d; BD + 0.07, 0.05, and 0.05% (P1) or 0.1,
0.07, and 0.05% (P2) of a further OA mixture (pHorce)
in the starter, grower, and finisher diets, respectively.
All groups (not NC) were challenged with one mL of
ETEC (1 × 108 cfu/mL) at 7 d of age. The 3 OA mix-
Key words: organic acids, E. coli, microbiology, immune response, antibiotic
tures are commercial formic and propionic acid prepa-
rations. Birds challenged with ETEC (PC) had reduced
(P < 0.05) growth performance, ileal morphological pa-
rameters (not crypt depth, which was increased), cecal
lactobacilli, and immune responses, and increased ce-
cal E. coli compared with unchallenged, NC birds. The
addition of OA to the diets of ETEC challenged birds
(S1-P2) either numerically or significantly (P < 0.05)
improved growth performance, ileal morphology and
immune responses, increased cecal lactobacilli, and re-
duced cecal E. coli. For most OA additions, the as-
sessed parameters were generally enhanced to equiva-
lence to NC birds. The results suggest that dietary OA
supplementation can enhance the growth performance,
ileal morphology, cecal microbiota, and immunity of
ETEC-challenged broilers to an extent that, under such
circumstances, the formulations used in this study pro-
vided similar performance and assessed parameters as
non-challenged birds.
2017 Poultry Science 96:3254–3263
http://dx.doi.org/10.3382/ps/pex106

INTRODUCTION to improved intestinal health and bird performance are

Antibiotic growth promoter (AGP) use has been
a key factor in achieving current broiler growth rates
and feed and production efficiency, while maintaining
acceptable bird health and welfare (Cervantes, 2015).
The need to find alternative additives and/or strate-
gies to maintain or continue supporting better bird
health, welfare, and performance is well recognized
(Dibner and Richards, 2005; Lee et al., 2011). The loss
of AGP frequently results in more enteric health prob-
lems and suboptimal animal performance (Huyghebaert
et al., 2011). Therefore, additives that can contribute

C 2017 Poultry Science Association Inc.
Received December 13, 2016.
Accepted March 22, 2017.
1
Corresponding author: leon.broom@anpario.com
highly valued at this time.
Organic acids (OA) are naturally occurring, carbon-
containing compounds with acidic properties. There is
a range of such acids that differ significantly in terms
of molecular size, structure, pKa, water solubility, etc.,
which will affect their properties in a given environ-
ment (Broom, 2015). Formic and propionic acid are
2 OA that have become well accepted in animal nutri-
tion. Initially, the focus was on controlling Salmonella
contamination of animal byproduct meals and mixed
feeds in the 1960s. At this time, low molecular weight
OA were reported to be bacteriostatic or bactericidal
against Salmonella spp. (Khan and Katamay, 1969).
Although preventing and controlling Salmonella con-
tamination of raw materials and finished feeds remains
a significant use of OA, their wider benefits have be-
come better recognized more recently. For example, in

3254
 ORGANIC ACID BLENDS AND BACTERIAL CHALLENGE
vitro, formic acid shows differential antibacterial ac-
tivity, being 10 times more effective against strains of
E. coli than those of lactobacilli (Nakai and Siebert,
2003), while in vivo, administering a blend of formic
and propionic acids to broilers via their drinking water
increased ileal lactobacilli numbers (Nava et al., 2009).
Formic acid, or its combination with propionic acid, has
been shown to increase intestinal morphology, surface
area, and bird growth performance (Garcia et al. 2007;
Senkoylu et al. 2007). These data highlight the ability
of formic and propionic acids to selectively modulate
the gut microbiota and enhance morphology. Therefore,
OA can influence the gut environment and contribute to
improved intestinal health. Either through direct or in-
direct influence, supplementing broilers with formic and
propionic acid blends also has been demonstrated to in-
crease antibodies both to vaccination (Ghasemi et al.,
2014) or antigen challenge (Khodambashi Emami et al.,
2013) and thus bird health. Enhanced intestinal and
broiler health will help improve bird growth and feed
efficiency, which has been demonstrated with OA.
Escherichia coli is a usual member of the intestinal
microbial community but enterotoxigenic strains
of E. coli (ETEC) can cause enteric disease (col-
ibacillosis), resulting in poorer bird performance and
significant economic losses (Alonso et al., 2011). K88
is a fimbrial adhesion factor expressed by important
ETEC strains causing intestinal disease in poultry.
Antibiotics are typically used to control or treat E. coli
infections (Cao et al., 2013). However, concerns about
antibiotic over-use in animals and the development of
resistance can make such infections more difficult to
treat or control.
There is a great need to better manage enteric health,
particularly due to less antibiotic use. In addition, there
is a lack of data relating to the effects of OA in E. coli
challenged broilers. Thus, this study investigated the
effects of OA on the growth performance, intestinal
morphology, cecal microbiota, and immune function of
broiler chickens challenged with a subclinical dose of
E. coli K88.
MATERIALS AND METHODS
The conditions and standards of care used in this
study were approved by the Ethics Committee for
Animal Experiments at the Ferdowsi University of
Mashhad.
Birds, Diets, Housing, and Oral Challenge
A total of 1,000 one-day-old Ross × Ross 308 male
chicks were purchased from a local commercial hatch-
ery. On arrival, birds were weighed and then randomly
assigned to 8 treatments with 5 replicate pens contain-
ing 25 birds each. Treatments were as follows: Negative
control (NC) birds received a corn-soybean meal basal
3255
diet without OA and not challenged with E. coli K88;
positive control (PC) birds fed the basal diet with-
out OA and orally challenged with one mL of E. coli
K88 (1 × 108 cfu/mL) on d 7; (S1) basal diet +
0.2% of an OA mixture (Salkil; Anpario, UK) in the
starter, grower, and finisher diets; (S2) basal diet +
0.4% of an OA mixture (Salkil; Anpario, UK) in the
starter, grower, and finisher diets; (O1) basal diet +
0.1, 0.075, and 0.05% of an OA mixture (Optimax; An-
pario, UK) in the starter, grower, and finisher diets,
respectively; (O2) basal diet + 0.1% of an OA mixture
(Optimax; Anpario, UK) in the starter, grower, and
finisher diets; (P1) basal diet + 0.07% of an OA mix-
ture (pHorce; Anpario, UK) in the starter, and 0.05%
in the grower and finisher diets; and (P2) basal diet
+ 0.1, 0.07, and 0.05% of an OA mixture (pHorce; An-
pario, UK) in the starter, grower, and finisher diets, re-
spectively. All OA supplemented groups were also chal-
lenged with one mL of E. coli K88 (1 × 108 cfu/mL)
on d 7. The 3 OA mixtures have differing combinations
of formic and propionic acids and their salts on dif-
ferent carriers. Organic acid products replaced corn in
the feed formulations. Feeds were provided as a starter
diet from placement to 10 d of age, grower diet to 24 d
of age, and finisher diet to 35 d of age. All diets were
formulated to meet or exceed minimum nutrient rec-
ommendations according to the Ross Broiler Nutrition
Supplement (2009) (Table 1). Feed and water were pro-
vided ad libitum, and the light program was 23L/1D.
The room temperature was 33◦ C for the first d, and
declined by approximately 3◦ C per wk until 21◦ C on
d 28 and then remained constant till the end of the
experiment.
The E. coli challenge was based on the methodol-
ogy of Cao et al. (2013). E. coli inocula were prepared
from a frozen suspension of K88 that was grown on
MacConkey agar plates (Merck, Germany) for 24 h at
37◦ C. Then, cells were obtained and diluted in 20 mL
of buffered peptone water (BPW, Scharlau, Barcelona,
Spain) and incubated for 24 h at 37◦ C. In the next step,
this solution was diluted in 500 mL BPW bottles and in-
cubated at 37◦ C during 24 h to obtain the final inocula
of E. coli K88. The cfu counts in the inocula were con-
firmed before the challenge. Finally, chicks were orally
challenged by syringe in the back of the mouth on d 7
of the study with one mL of 1 × 108 cfu of E. coli per
chick. Birds in the non-challenged group were given an
equal volume of sterile BPW.
Growth Performance and Mortality
Feed consumption and total body weight of each pen
were recorded on placement, at the end of starter (d 10),
grower (d 24), and finisher (d 35) periods to calculate
average daily feed intake (ADFI), average daily gain
(ADG), and feed conversion ratio (FCR). Deaths were
recorded and mortality calculated.
3256 KHODAMBASHI EMAMI ET AL.

Table 1. Composition of basal diets (as fed basis).1

Starter (0 to 10 d) Grower (11 to 24 d) Finisher (25 to 35 d)

Ingredients (%)
Corn (8.54% CP) 54.18 57 63
Soybean meal (44.1% CP) 38.00 35.80 30.22
Soybean oil (9000 Kcal) 3 3 3
Dicalcum phosphate 2 1.8 1.5
Calcium carbonate (37% Ca) 1.2 1.0 1.0
Salt 0.2 0.2 0.2
Sodium bicarbonate 0.22 0.22 0.15
DL-Methionine (99%)2 0.35 0.30 0.25
L-Lysine-HCl (78%)3 0.25 0.15 0.15
L-Threonine (98.5%)4 0.10 0.03 0.03
Vitamin Premix5 0.25 0.25 0.25
Mineral Premix6 0.25 0.25 0.25
Calculated nutrients (%)7
Metabolizable energy (KCal) 2961 2997 3071
Crude protein 21.83 20.93 18.95
Dry matter 91.28 90.87 91.05
Ether extract 5.36 5.45 5.63
Total phosphorus 0.75 0.71 0.64
Available phosphorus 0.50 0.46 0.40
Calcium (Ca) 1.02 0.90 0.81
Chlorine (Cl) 0.16 0.16 0.16
Sodium (Na) 0.18 0.18 0.17
Potassium (K) 0.92 0.88 0.79
Methionine (Met) 0.68 0.62 0.55
Methionine + Cysteine (Met + Cys) 1.03 0.96 0.86
Lysine (Lys) 1.35 1.23 1.09
Arginine (Arg) 1.40 1.34 1.19
Threonine (Thre) 0.91 0.81 0.73
Linoleic Acid 1.34 1.39 1.50
DCAB (meq/kg) 271.1 262.9 232.6
Analyzed nutrients (%)
Crude Protein 21.71 20.75 18.66
Ether extract 5.24 5.42 5.61
Dry matter 90.97 90.75 91.42
1
All organic acid blends were added at expense of the equal amount of mixed feed.
2
MetAMINO, Evonik Degussa Gmbh, Essen, Germany.
3
L-Lysine HCl, AJINOMOTO EUROLYSINE S.A.S, Paris, France.
4
ThreAMINO, Evonik Degussa Gmbh, Essen, Germany.
5
Vitamin concentrations per kilogram of diet: retinol 18 mg, cholecalciferol 4 mg, α -tocopherol acetate 36 mg,
vitamin K3 2 mg, thiamine 1.75 mg, riboflavin 6.6 mg, niacin 9.8 mg, pantothenic acid 29.65 mg, pyridoxine 2.94 mg,
folic acid 1 mg, vitamin B12 0.015 mg, biotin 0.1 mg, choline chloride 250 mg and ethoxyquin 1 mg.
6
Mineral concentrations per kilogram of diet: Mn 99.2 mg, Fe 50 mg, Zn 84.7 mg, Cu 10 mg, I 0.99 mg, Se 0.2 mg.
7
Based on ingredient composition data from NRC (1994).

Acid Binding Capacity
Acid binding capacity (ABC) of the experimental
diets was measured after preparation of the starter,
grower, and finisher feeds. For each of the starter,
grower, and finisher diets, 4 samples were analyzed per
treatment. The ABC was defined as the amount of hy-
drochloric acid in milli-equivalents (mEq) needed to
decrease the pH of one kilogram of sample to pH 3, and
measured according to the method described by Gilani
et al. (2013) using deionized water (Direct-Q Millipore
System, Billerica, MA).
Cecal Microbiology
At 10 and 35 d of age, 3 birds per rep (15 birds per
treatment) were killed by CO2 asphyxiation and cecal
contents were separately removed under aseptic con-
dition. Cecal contents of birds in each replicate were
pooled and kept at −80 ◦ C until further analysis.
In order to prepare the standard curve for
quantification of bacteria, pure E. coli and Lactobacil-
lus suspensions were plated on MacConkey agar sup-
plemented with 4-methyllumbilliferyl-beta- D-gluconic
acid (MUG; Remel, Lenexa, Waltham, MA) and MRS
(Man Rogosa and Sharp), respectively, and incubated
aerobically for 24 h at 37◦ C. Plates were examined for
E. coli colonies under an ultraviolet lamp. Then, DNA
was extracted from pure cultures by the use of Qia-
gen DNeasy Tissue Kit (Qiagen, Valencia, CA), and
DNA concentration was detected by spectrophotomet-
ric analysis. After that, DNA stocks from E. coli and
Lactobacillus were serially diluted (6 times) and real-
time quantitative PCR (ABI 7300, Applied Biosystems,
Foster City, CA) was performed on the stock and di-
luted samples in order to determine the threshold cycle
(Ct) value related to each. Finally, a standard curve
 ORGANIC ACID BLENDS AND BACTERIAL CHALLENGE
Table 2. Sequences of primer pairs used for amplification of target and reference genes.
Bacterial group Primers Sequence (5/ →3/ )
Lactobacillus Forward Reverse CATCCAGTGCAAACCTAAGAG GATCCGCTTGCCTTCGCA
Escherichia coli Forward Reverse GACCTCGGTTTAGTTCACAGA CACACGCTGACGCTGACCA
For each gene the primer sequence for forward (F) and reverse (R) (5/ -3/ ), the amplicon size (bp), and the annealing temperature (Temp) in o C,
are shown.
was drawn using the DNA concentrations and their rel-
ative Ct values.
DNA from cecal samples were extracted via a QI-
Aamp DNA Stool Mini Kit according to the manu-
facturer’s guidelines (Qiagen, Valencia, CA) and was
stored at −80◦ C for subsequent quantitative PCR. The
abundance of DNA copies in DNA samples from ce-
cal digesta was determined by a real-time PCR sys-
tem (ABI 7300, Applied Biosystems, Foster City, CA)
and chemicals were supplied from Thermo Scientific,
Waltham, MA (SYBR PrimeScript RT-PCR kit). Each
reaction was performed in a total volume of 20 μl in
3 replicates with a no template control according to
MIQE guidelines (Bustin et al., 2009). Primer details
are shown in Table 2, and 16S rRNA region was used
for designing primers for each bacterial group.
Quantitation of the number of Lactobacillus and
E. coli present in cecal samples was calculated by com-
paring the Ct values of DNA samples from cecal digesta
with the generated standard curve, and estimating their
log10 cfu.
Intestinal Morphology
Gut morphology was assessed at 21 d of age in sam-
ples from 2 birds of mean weight per replicate. Af-
ter euthanizing the birds with CO2 asphyxiation, the
ileum was gently washed with distilled water and a
2 cm segment of the mid-ileum was fixed in 10% forma-
lin. Sections of the fixed samples were then prepared
using a microtome, stained with hematoxyline–eosin,
before examination under a light microscope. The pro-
cedures and equipment used were as described previ-
ously (Khodambashi Emami et al., 2012). For each sam-
ple, there were 3 cross sections and 10 measurements
per section. Upon examination of the sections under
a light microscope, villus height (VH), crypt depth
(CD), villus height to crypt depth ratio (VH:CD),
villus width (VW) midway up the villi, villus surface
area (VSA; [2π × (VW/2) × VH]), and lamina pro-
pria thickness (LPT) were determined. For detection
and enumeration of goblet cells (GCN), the acid-Schiff
staining method (Smirnov et al., 2006) was performed
on the samples.
Immune Responses
Humoral Anti-SRBC Response To quantify pri-
mary and secondary antibody responses, one mL of 7%
3257
Size Temp. Reference
286 60 Amit-Romach et al. (2004)
585 60
sheep red blood cells (SRBC) was injected intraperi-
toneally into 2 birds per replicate at 14 and 28 d of
age. Seven d after each injection (d 21 and 35), all
birds were bled by brachial venipuncture. After segre-
gating serum by centrifugation at 2,655 g for 10 min,
sera were stored at −18 ◦ C for later analysis. Serum
total immunoglobulins (Ig) and IgG (mercaptoethanol
[ME]-resistant antibody against SRBC) were detected
as described by Wegmann and Smithies (1966) and Ya-
mamoto and Glick (1982), respectively. All antibody
titers were reported as log2 of the reciprocal of the
last dilution in which agglutination was observed. The
amount of IgM (mercaptoethanol [ME]–sensitive anti-
body against SRBC) was calculated by subtracting IgG
from total Ig.
Cutaneous Basophil Hypersensitivity (CBH)
Response At 35 d of age, cutaneous basophil hyper-
sensitivity (CBH) was measured for examining cellular
immune responses. At 34 d of age, 2 birds from each
replicate were selected and 100 μg of phytohemag-
glutinin (suspended in 0.10 mL of sterile saline)
were injected interadermally between the third and
fourth digits of the left foot. Before and one d (24
h) after injection, toe web swelling was measured
with a constant-tension micrometer. Subtraction of
pre-injection skin thickness from post-injection skin
thickness was regarded as toe web swelling.
CD4 and CD8 For the detection of CD4 and CD8
T cells, flow cytometry was used. At 35 d of age, a
2 mL sample of blood was taken in a heparinized sy-
ringe from the wing vein of 3 birds per replicate. The
3 samples per replicate were then pooled, creating 5
pooled samples per treatment. The blood samples were
immediately placed on ice and transported to the labo-
ratory for flow cytometry analysis. The CD8 and CD4
populations were detected with the modified method
of direct immunofluorescence staining of lysed whole
blood as described by Gheisari et al. (2002). Briefly,
cells treated with phycoerythrin (PE) conjugated
with CT8 specific mouse anti-chicken monoclonal an-
tibodies (CT8mAb-PE) and fluorescein isothiocyanate
conjugated with CT4 specific mouse anti-chicken mon-
oclonal antibodies (CT4mAb-FITC) (Southern Biotech
Associates, Birmingham, AL). Then, fluorescence
intensities were measured by 2-color flow cytometric
analysis using a FACStar flow cytometer (Becton Dick-
inson Immunocytometry Systems San Jose, CA) and
data were analyzed via Lysis II software (Becton Dick-
inson Immunocytometry systems, San Jose, CA) for de-
termination of positive cells.
3258 KHODAMBASHI EMAMI ET AL.

Table 3. Effects of different organic acids on growth performance (g/b/d) of male broilers (d 0 to 35) challenged with
E. coli K88.1

Starter (0 to 10 d old) Grower (11 to 24 d old) Finisher (25 to 35 d old) Total (0 to 35 d old)
2 3
Treatments ADFI ADG FCR ADFI ADG FCR ADFI ADG FCR ADFI ADG FCR
a,b a c a,b a-c b-d b a,b b a a
NC 28.02 22.57 1.24 89.12 57.67 1.54 162.45 89.58 1.81 93.19 56.60 1.63b,c
PC 26.44b 19.35b 1.36a 89.08a,b 54.66c 1.62a 157.53c 81.88d 1.92a 86.54c,d 50.16d 1.72a
S1 27.93a,b 21.30a,b 1.31a,b 91.03a 58.31a,b 1.56b-d 157.14c 87.17c 1.80b,c 88.11b,c 53.89b,c 1.63b,c
S2 28.12a,b 21.46a 1.30a,b 85.17b 56.26b,c 1.51d 155.45c 88.16b,c 1.76c 85.34d 53.37c 1.59d
O1 28.80a 22.00a 1.30a,b 89.17a,b 56.64b,c 1.57a-c 162.17b 88.22b,c 1.83b 88.86b 53.66b,c 1.65b
O2 27.74a,b 21.60a 1.28b,c 89.36a,b 58.83a,b 1.51c,d 162.34b 89.65a,b 1.81b 88.62b 54.78a,b 1.61c,d
P1 28.46a,b 21.50a 1.32a,b 90.56a 57.17a-c 1.58a,b 163.53b 88.76b,c 1.84b 89.76b 53.90b,c 1.66b
P2 28.84a 22.56a 1.27b,c 93.05a 59.85a 1.55b-d 166.70a 90.77a 1.83b 92.14a 56.06a 1.64b,c
P-value 0.047 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001
SEM4 0.461 0.391 0.012 0.853 0.567 0.012 0.584 0.347 0.009 0.372 0.302 0.007
a-d
In each column, means with the same letter are not significantly different (P < 0.05).
1
Data represent the mean value of 5 replicate pens of 25 birds.
2
Treatments include: Negative control (NC) birds received a corn-soybean meal basal diet without any organic acids and not challenged
with E. coli K88; positive control (PC) birds fed the basal diet without any organic acids and orally challenged with one mL of E. coli
K88 (1 × 108 cfu/mL) on d 7; (S1) basal diet + 0.2% of an organic acid mixture (Salkil) in the starter, grower, and finisher diets; (S2)
basal diet + 0.4% of an organic acid mixture (Salkil) in the starter, grower, and finisher diets; (O1) basal diet + 0.1, 0.075, and 0.05%
of an organic acid mixture (Optimax) in the starter, grower, and finisher diets, respectively; (O2) basal diet + 0.1% of an organic acid
mixture (Optimax) in the starter, grower, and finisher diets; (P1) basal diet + 0.07% of an organic acid mixture (pHorce) in the starter,
and 0.05% in the grower and finisher diets; (P2) basal diet + 0.1, 0.07, and 0.05% of an organic acid mixture (pHorce) in the starter,
grower, and finisher diets, respectively. All organic acid supplemented groups also were challenged with one mL of E. coli K88 (1 × 108
cfu/mL) on d 7.
3
ADFI: Average daily feed intake, ADG: average daily gain, FCR: feed conversion ratio.
4
SEM: Standard errors of mean.

Statistical Analysis mortality between any of the groups (P > 0.05) (data
not shown).
Statistical analysis for all data was performed using
the GLM model procedure of SAS (SAS Institute, 2004)
and significance among treatments (P < 0.05) was de- Acid Binding Capacity
termined by the Tukey test. The statistical model for
data analysis was as below: The effect of OA supplementation on the ABC of
Yij = μ+Ai+eij the diets is summarized in Table 4. The addition of OA
Yij = the measured value for each observation (data) reduced the ABC of the starter and grower feeds, which
μ = mean were significant (P < 0.05) in all cases except for O1.
Ai = treatment effect For the finisher diets, only S2 and O2 reduced the ABC
eij = experimental error compared to the basal diet (P < 0.05).

RESULTS
Growth Performance
In most growth phases and overall, the performance
of non-challenged birds (NC) was better than the
ETEC-challenged group (PC) (P < 0.05) (Table 3).
The exceptions were ADFI in the starter and grower
phases and ADG in the grower phase. The addition
of OA to the diets of ETEC-challenged broiler chick-
ens numerically or significantly (P < 0.05) improved
performance parameters in most phases and overall,
and, in numerous instances, these groups were not dif-
ferent from non-challenged control birds. Overall, only
S1 and S2 did not stimulate feed intake compared to
PC birds, while only P2 was equivalent to NC. Over-
all ADG and FCR were improved in all OA groups
compared to PC birds, and O2 and P2 were equiv-
alent to NC birds for ADG and all groups for FCR
(except S2). Feed conversion of S2 was actually bet-
ter than NC (P < 0.05). There were no differences in
Cecal Microbiology
ETEC challenge increased d 10 and 35 cecal E. coli
and reduced d 35 lactobacilli (P < 0.05). Dietary sup-
plementation with OA reduced cecal E. coli numbers
at 10 d of age compared to ETEC challenged broilers
(P < 0.05) (Table 5), with these groups not different
from non-challenged birds. There were no differences in
cecal lactobacilli on d 10 (P > 0.05). At 35 d of age,
all OA groups had lower cecal E. coli and most (except
S2) had higher lactobacilli compared to the challenged
group (P < 0.05), with all OA groups not different from
non-challenged birds.
Intestinal Morphology
Birds in the NC treatment group had higher (P
< 0.05) VH, VH:CD, VW, and VSA and lower CD than
PC birds (Table 6). For VH and CD, OA groups were
predominantly intermediate to the NC and PC. The ex-
ceptions were that O2 and P2 birds had higher VH than
 ORGANIC ACID BLENDS AND BACTERIAL CHALLENGE 3259
Table 4. Acid binding capacity (mEq/kg) of starter, grower, Table 5. Effects of different organic acids on cecal bacte-
and finisher diets supplemented with different mixtures and rial numbers (log10 cfu) of male broilers (d 10 and 35) chal-
doses of organic acids.1 lenged with E. coli K88.

Starter Grower Finisher Treatment1 Day 10 Day 35

Treatments2 (1 to 10 d) (11 to 24 d) (25 to 35 d) E. Coli Lactobacilli E. Coli Lactobacilli
NC/PC 880.2a 837.7a 785.5a
NC 6.61b 6.53 6.21b 6.67a
S1 851.9b 796.2b 763.9a,b
PC 8.89a 5.11 8.11a 5.36b
S2 814.6c 746.6c 725.5c
S1 7.65b 5.53 6.38b 6.95a
O1 847.9b 809.2a,b 773.9a,b
S2 7.51b 6.09 6.64b 6.09a,b
O2 842.9b 783.3b 754.4b
O1 7.62b 5.80 6.84b 6.81a
P1 839.6b 799.3b 764.8a,b
O2 7.76a,b 6.58 6.43b 6.98a
P2 831.3b,c 788.8b 768.9a,b
P1 7.44b 5.66 6.49b 6.73a
P-value < 0.001 < 0.001 < 0.001
SEM3 3.90 5.44 3.90 P2 7.38b 5.44 6.32b 7.37a
P-value < 0.001 0.106 < 0.001 < 0.001
a-b
In each column, means with the same letter are not significantly SEM2 0.236 0.347 0.246 0.257
different (P < 0.05). a,b
2
Treatments include: Negative control (NC) birds received a corn- In each column, means with the same letter are not significantly
soybean meal basal diet without any organic acids and not challenged different (P < 0.05).
1
with E. coli K88; positive control (PC) birds fed the basal diet with- Treatments include: Negative control (NC) birds received a corn-
out any organic acids and orally challenged with one mL of E. coli soybean meal basal diet without any organic acids and not challenged
K88 (1 × 108 cfu/mL) on d 7; (S1) basal diet + 0.2% of an organic with E. coli K88; positive control (PC) birds fed the basal diet with-
acid mixture (Salkil) in the starter, grower, and finisher diets; (S2) out any organic acids and orally challenged with one mL of E. coli
basal diet + 0.4% of an organic acid mixture (Salkil) in the starter, K88 (1 × 108 cfu/mL) on d 7; (S1) basal diet + 0.2% of an organic
grower, and finisher diets; (O1) basal diet + 0.1, 0.075, and 0.05% of acid mixture (Salkil) in the starter, grower, and finisher diets; (S2)
an organic acid mixture (Optimax) in the starter, grower, and finisher basal diet + 0.4% of an organic acid mixture (Salkil) in the starter,
diets, respectively; (O2) basal diet + 0.1% of an organic acid mix- grower, and finisher diets; (O1) basal diet + 0.1, 0.075, and 0.05% of
ture (Optimax) in the starter, grower, and finisher diets; (P1) basal an organic acid mixture (Optimax) in the starter, grower, and finisher
diet + 0.07% of an organic acid mixture (pHorce) in the starter, and diets, respectively; (O2) basal diet + 0.1% of an organic acid mix-
0.05% in the grower and finisher diets; (P2) basal diet + 0.1, 0.07, ture (Optimax) in the starter, grower, and finisher diets; (P1) basal
and 0.05% of an organic acid mixture (pHorce) in the starter, grower, diet + 0.07% of an organic acid mixture (pHorce) in the starter, and
and finisher diets, respectively. All organic acid supplemented groups 0.05% in the grower and finisher diets; (P2) basal diet + 0.1, 0.07,
also were challenged with one mL of E. coli K88 (1 × 108 cfu/mL) and 0.05% of an organic acid mixture (pHorce) in the starter, grower,
on d 7. and finisher diets, respectively. All organic acid supplemented groups
3
SEM: Standard errors of mean (results are given as means also were challenged with one mL of E. coli K88 (1 × 108 cfu/mL) on
(n = 4) for each treatment). d 7.
2
SEM: Standard errors of mean (results are given as means [n =
5 pooled samples each from 3 birds/replicate] for each treatment).
PC and were similar to NC. For VH:CD and VW, OA
supplementation increased (P < 0.05) these parameters
for O2, P1, and P2 (and S1 for VH:CD) compared to (P < 0.05). For OA groups, these parameters were dif-
the PC, and were not different from the NC. Although ferent (P < 0.05) from non-challenged birds only for
numerically greater for these measures, the other OA S2 and O1 (primary total Ig), O1 (CBH), and O2 and
groups were not different from the PC. However, the P2 (CD4). For the latter, O2 and P2 had a higher per-
various numerical and statistical differences in villus di- centage of CD4-expressing T cells than non-challenged
mensions meant that all of the OA groups had greater broilers.
VSA than PC birds (P < 0.05), while being lower only
for S1 and S2 compared to NC birds. LPT was not DISCUSSION
different among groups. GCN was lowest in the NC
and highest in the PC birds (P < 0.05), with the OA The addition of OA to the diets of broiler chick-
groups being intermediate (other than P2, which was ens orally challenged with a sub-clinical dose of E. coli
lower than the PC and similar to the NC). K88 improved bird growth performance, while mortal-
ity was not different between any groups. Overall, all
Immune Responses OA groups had better BWG and FCR but, for 2 groups
(S1 and S2; same formulation at 0.2 and 0.4%), feed
Humoral and cellular immune responses of birds re- intake was not increased compared to the challenged
ceiving OA supplemented diets and challenged with control. In other studies, feed intake has not been stim-
ETEC are shown in Table 7. ETEC challenge reduced ulated by OA (Chowdhury et al., 2009), which suggests
primary total and IgG SRBC antibodies, secondary to- that the specific OA, combination of acids, formula-
tal, IgG and IgM SRBC antibodies, CBH response, and tion dose, and/or control feed consumption determine
increased peripheral blood CD8-expressing T cells of effects on feed intake. While ADG was improved for
broilers (P < 0.05). Dietary OA supplementation in- all OA groups (bar S1) in the first 10 d, the effects of
creased primary total and IgG SRBC antibodies, sec- OA supplementation became, generally, more apparent
ondary total, IgG and IgM SRBC antibodies, CBH re- as the study progressed. Our results are in agreement
sponse (S1, O2, P1, and P2), CD4-expressing (S1, O1, with other studies (Chowdhury et al., 2009; Giannenas
O2, P1, and P2), and reduced CD-8 expressing (S1, S2, et al., 2014a), although no growth performance effects
O2, P1, and P2) T cells of ETEC challenged broilers have been reported by other authors (Hernández et al.,
3260 KHODAMBASHI EMAMI ET AL.

Table 6. Effects of different organic acid mixtures on ileal morphology (μm) of male broilers (d 21)
challenged with E. coli K88.1

Parameters3
2
Treatments VH CD VH/CD VW VSA LPT GCN/1 mm length
a b a a a,b
NC 759.6 139.2 5.48 205.5 490086 78.86 139.6b
PC 704.9b 164.6a 4.29c 187.0b 414186d 92.84 161.2a
S1 732.4a,b 147.7a,b 4.97a,b 196.4a,b 451674c 84.98 152.5a,b
S2 742.6a,b 161.6a,b 4.60b,c 194.1a,b 452681c 89.28 155.7a,b
O1 738.9a,b 157.9a,b 4.69b,c 199.3a,b 462329b,c 90.59 148.8a,b
O2 769.1a 146.6a,b 5.25a 208.4a 503288a 85.09 141.5a,b
P1 747.5a,b 151.4a,b 4.96a,b 206.6a 485306a-c 93.11 147.3a,b
P2 773.2a 146.1a,b 5.30a 203.2a 493297a,b 87.77 137.7b
P-value 0.002 0.018 < 0.001 0.001 < 0.001 0.111 0.006
SEM4 9.65 4.67 0.109 3.04 6725.9 3.192 3.96
a-c
In each column, means with the same letter are not significantly different (P < 0.05).
1
Data represent the mean value of 10 birds (5 replicate pens × 2 birds/pen). There was one sample per chick, 3
cross-sections per sample (30 cross-sections per treatment), and 10 measurements per cross-section for a total of 300
measurements per treatment.
2
Treatments include: Negative control (NC) birds received a corn-soybean meal basal diet without any organic
acids and not challenged with E. coli K88; positive control (PC) birds fed the basal diet without any organic acids
and orally challenged with one mL of E. coli K88 (1 × 108 cfu/mL) on d 7; (S1) basal diet + 0.2% of an organic acid
mixture (Salkil) in the starter, grower, and finisher diets; (S2) basal diet + 0.4% of an organic acid mixture (Salkil) in
the starter, grower, and finisher diets; (O1) basal diet + 0.%, 0.075, and 0.05% of an organic acid mixture (Optimax)
in the starter, grower, and finisher diets, respectively; (O2) basal diet + 0.1% of an organic acid mixture (Optimax)
in the starter, grower, and finisher diets; (P1) basal diet + 0.07% of an organic acid mixture (pHorce) in the starter,
and 0.05% in the grower and finisher diets; (P2) basal diet + 0.1, 0.07, and 0.05% of an organic acid mixture (pHorce)
in the starter, grower, and finisher diets, respectively. All organic acid supplemented groups also were challenged with
one mL of E. coli K88 (1 × 108 cfu/mL) on d 7.
3
Parameters include: Villus height (VH), Crypt depth (CD), villus height/crypt depth (VH/CD), villus width
(VW), villus surface area (VSA), lamina propria thickness (LPT), and goblet cell number (GCN).
4
SEM: Standard errors of mean (results are given as means [n = 10] for each treatment).

2006; Houshmand et al., 2011). Improvements in broiler
growth performance in our study were accompanied
by enhanced nutrient digestibility (data not shown),
which is likely to explain a significant part of the OA
performance effects seen. Recently, Kaczmarek et al.,
(2016) reported that a protected OA (0.03%) improved
bird performance and nutrient digestibility. There is a
plethora of OA and OA-based products available and
used in the literature, with a wide range of inclusion
rates. Some of the early work with formic and propi-
onic acid combinations for Salmonella spp. control in
poultry feed have used inclusions of up to 3% of the
diet (Al-Tarazi and Alshawabkeh, 2003). However, as
“free” OA are considered to be rapidly absorbed or me-
tabolized in the GIT (Hume et al., 1993), then the use
of inert carriers, glycerides, and encapsulation to help
“protect” the acids has seen inclusion rates fall, partic-
ularly for more in vivo effects further along the GIT. In
addition, each OA has its own unique features (Broom,
2015), which will influence its application. Moreover,
without specific (e.g., ETEC) challenge, it can be dif-
ficult to ascertain the degree of background challenge
within a particular study. Thus, reliable comparison of
OA studies can be problematic.
The cecal microbiology data confirmed that ETEC
challenge of broilers increased E. coli numbers, which
remained through to 35 d of age. E. coli were lower in
all OA groups at 10 d of age (3 d post challenge) com-
pared to the challenge control and, by d 35, cecal E. coli
populations were up to 1.8 Log10 cfu per g of contents
lower and lactobacilli up to 2.0 Log10 cfu per g of con-
tents higher than challenged birds. These data confirm
the ability of OA supplementation to beneficially influ-
ence the GIT microbiota and are in agreement with the
work of others (Iba and Berchieri, 1995; Nava et al.,
2009; Giannenas et al., 2014a). However, how OA in-
fluence (particularly more distal) GIT microbial popu-
lations remains unclear, particularly as OA should have
lower direct antimicrobial activity in the higher pH of
distal sites (Boyen et al., 2008). This suggests that OA
initiate their microbiota-modifying effects in more prox-
imal GIT regions. In our work, the addition of the OA
supplements reduced the acid-binding capacity of the
diets, particularly in the higher ABC starter and grower
feeds. Feed/digesta pH reduction is often proposed as
an in vivo mode of action for OA. However, we found
consistent changes in cecal microbial numbers, but, for
most of these groups, there was no corresponding re-
duction in cecal pH (data not shown), and others have
observed similar effects. Thompson and Hinton (1997),
even when using relatively high concentrations of formic
and propionic acids, found that the OA did not affect
the pH of various sites of the laying hen GIT, including
the crop, but did increase the concentration of these
acids in the crop, particularly the undissociated forms,
which were shown to be antimicrobial in vitro. It is
also worth noting that while Giannenas et al. (2014b)
reported that cecal pH reductions by 2 inclusions of
an OA product were nearly identical, the growth per-
formance of the lower inclusion group was better than
the higher inclusion. Thus, while factors such as di-
etary ABC may influence intestinal pH, differences in
 ORGANIC ACID BLENDS AND BACTERIAL CHALLENGE 3261
Table 7. Effects of different organic acids on humoral and cellular immune response of male
broilers (d 21 and 35) challenged with E. coli K88.

Immune response
Humoral (log2 ) Cellular (d 35)
Primary (d 21) Secondary (d 35)
Treatments1 Total Ig2 IgG IgM Total Ig IgG IgM CBH (cm) CD4 (%)3 CD8 (%)3

NC 4.84a 2.10a 2.74 7.60a 4.88a 2.72a 0.87a,b 12.64c,d 8.14b

PC 4.13d 1.59b 2.54 6.74b 4.44b 2.30b 0.69c 11.02d 11.06a
S1 4.62a-c 1.86a 2.76 7.55a 4.70a 2.85a 0.89a,b 16.46a-c 8.80b
S2 4.46c 1.88a 2.58 7.48a 4.75a
2.73a 0.81a-c 13.46b-d 8.11b
O1 4.50b,c 1.95a 2.55 7.39a 4.68a 2.71a 0.75b,c 15.80a-c 9.50a,b
O2 4.78a,b 2.09a 2.69 7.58a 4.82a 2.76a 0.92a,b 17.48a,b 8.33b
P1 4.58a-c 2.01a 2.57 7.42a 4.78a 2.64a 0.87a,b 15.64a-c 8.98b
P2 4.65a-c 2.04a 2.61 7.51a 4.73a 2.78a 0.94a 18.54a 7.89b
P-value < 0.001 < 0.001 0.300 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001
SEM4 0.056 0.053 0.071 0.058 0.044 0.057 0.035 0.898 0.321
a-d
In each column, means with the same letter are not significantly different (P < 0.05).
1
Treatments include: Negative control (NC) birds received a corn-soybean meal basal diet without
any organic acids and not challenged with E. coli K88; positive control (PC) birds fed the basal diet
without any organic acids and orally challenged with one mL of E. coli K88 (1 × 108 cfu/mL) on d 7;
(S1) basal diet + 0.2% of an organic acid mixture (Salkil) in the starter, grower, and finisher diets; (S2)
basal diet + 0.4% of an organic acid mixture (Salkil) in the starter, grower, and finisher diets; (O1)
basal diet + 0.1, 0.075, and 0.05% of an organic acid mixture (Optimax) in the starter, grower, and
finisher diets, respectively; (O2) basal diet + 0.1% of an organic acid mixture (Optimax) in the starter,
grower, and finisher diets; (P1) basal diet + 0.07% of an organic acid mixture (pHorce) in the starter,
and 0.05% in the grower and finisher diets; (P2) basal diet + 0.1, 0.07, and 0.05% of an organic acid
mixture (pHorce) in the starter, grower, and finisher diets, respectively. All organic acid supplemented
groups also were challenged with one mL of E. coli K88 (1 × 108 cfu/mL) on d 7.
2
Ig: immunoglobulin, Ig G: immunoglobulin G, Ig M: immunoglobulin M, CBH: Cutaneous Basophil
Hypersensitivity, CD 4, 8: cluster of differentiation 4, 8.
3
Percentage positive leukocytes expressing cell surface antigens for CD4 and CD8.
4
SEM: Standard errors of mean (results are given as means [n = 10] for the humoral and CBH immune
responses, and as means [n = 5 pooled samples each from 3 birds/replicate] for each treatment) for CD4
and CD8.

pH do not explain, simply, the effects of OA on the GIT
microbiota. Taken together, it seems clear that a num-
ber of interrelated factors, such as dietary ABC, digesta
pH, concentration of OA and forms present, nutrient
digestibility and absorption, GIT immune factors, etc.,
explain the influence of OA on intestinal microbial pop-
ulations and performance.
Broiler chicken ileal morphological measures were re-
duced by sub-clinical ETEC challenge, confirming the
potentially negative effects of ETEC on the intesti-
nal architecture (DebRoy and Maddox, 2001), includ-
ing in broilers (Cao et al., 2013). Enteric infection can
damage the epithelium and reduce villus height. When
villus height is compromised, the crypt cell prolifera-
tion rate (CCPR) has been reported to increase to
counteract the loss of enterocytes, which can be re-
flected in deeper crypts (Sheng et al., 2006). Gener-
ally, the addition of OA blends to the diets of broiler
chickens challenged with a sub-clinical dose of E. coli
K88 improved numerous ileal morphological parameters
compared to challenged control birds. Specifically, sup-
plementation of birds with OA mixtures either numeri-
cally or significantly increased the VH:CD ratio, which
can be considered an indicator of a better intestinal
state (Awad et al., 2009). Moreover, the higher VSA
(than challenged birds) for all OA groups would en-
hance the surface available for nutrient digestion and
absorption, which, for most of the OA groups, was
equivalent to non-challenged birds for this study. Sub-
clinical ETEC challenge increased GCN; these cells
are responsible for the secretion of mucus mucins that
help to protect the intestinal mucosa. The similarity
in GCN between OA supplemented and non-challenged
birds indicates that OA help to lessen GC/mucin stim-
ulation induced by sub-clinical ETEC challenge. Our
findings are generally in agreement with the litera-
ture with regards to the beneficial effects of OA on in-
testinal morphology. Garcia et al. (2007) and Senkoylu
et al. (2007) both reported increased villus height, sur-
face area, and/or performance with formic acid (up
to 1% of the diet) or the combination of formic and
propionic acid (0.3% of diet). Similarly, broilers supple-
mented with OA also performed better in this experi-
ment. Proposed mechanisms for stimulation of intesti-
nal mucosal growth by OA include reduction of total
intestinal microbial populations and/or promotion and
maintenance of an optimal microbiota, which in turn
can reduce the presence of toxins that can negatively
affect intestinal morphology (Garcia et al., 2007) and
compromise intestinal integrity (Khodambashi Emami
et al., 2013). Another mechanism might be through the
trophic effects of OA stimulating GIT cell prolifera-
tion (Hernández et al., 2006). The trophic effects of
OA were reported by Frankel et al. (1994), who showed
that rats supplemented with butyric acid had increased
villus height, crypt depth, and surface area in the
3262 KHODAMBASHI EMAMI ET AL.
jejunum and colon, while the direct or indirect trophic
effects of other OA (e.g., formic acid) have already been
mentioned (Garcia et al., 2007). Others have, however,
shown that OA may not enhance intestinal structure
(Houshmand et al., 2011; Milbradt et al., 2014). In a
more recent study, feeding an encapsulated source of
butyric acid (0.03%) to male Cobb 500 broilers largely
had no effect on intestinal morphology in the duodenum
or jejunum at 42 d of age (Waguespack Levy et al.,
2015). Disparity among studies undoubtedly results
from differences in underlying microbial challenge and
bird performance, the OA used, dose, diet formulations,
etc., which must be considered for best responses in
the field.
We have shown that OA dietary supplementation can
increase most of the primary and secondary humoral,
as well as cellular, immune responses of E. coli chal-
lenged broilers, following antigen stimulation, assessed
in this study. The exceptions were that no OA group
enhanced the primary IgM response, and 2 groups (S2
and O1) did not affect some components of the cel-
lular response. In many cases, where increased, the
immune parameters of ETEC-challenged, OA supple-
mented broilers were similar to those of non-challenged
birds. Our findings are generally in agreement with
previous work. Khodambashi Emami et al. (2013) re-
ported that the addition of OA (0.2% in feed) to an ap-
parently phosphorus sufficient diet increased both the
primary and secondary IgG titer to SRBC, following
intravenous injection of broilers. In addition, the same
OA combination product at 0.4% of the diet (as per
group S2 in the present study) increased primary an-
tibody titers to both infectious bursal disease (IBD)
virus and infectious bronchitis (IB) virus following vac-
cination (Ghasemi et al., 2014). The latter work con-
firms that OA can influence the primary response but
the ability to do so is likely to be influenced by nu-
merous factors, including the antigen/stimulation used,
sampling time after administration, bird age, etc., and
so direct comparisons are probably inappropriate. For
example, in the present study, the primary response
was assessed at 21 d of age, 7 d after SRBC injec-
tion (d 14), while Ghasemi et al. (2014) measured the
primary response at 28 d of age, 14 (IBD), and 21
(IB) d after initial exposure. Likewise, the mechanisms
by which OA influence systemic, cellular immune re-
sponses are not entirely clear but other recent work
has shown that feeding OA to broilers resulted in in-
duction of systemic regulatory T cells and reduced an
inflammatory response indicator (alpha 1-acid glyco-
protein) following H9N2 vaccination (Lee et al., 2016).
It can be speculated that disparity among groups for
some parameters in the current study resulted from
(maybe even subtle) differences in overall gut health,
specific GIT microbiota, and their interaction with the
gut-associated lymphoid tissue. For example, although
cecal lactobacilli were elevated in S2, this group was
intermediate to the challenged control and other OA
groups. This could, at least partially, explain why this
group was a slight anomaly for some cellular immune
parameters.
In conclusion, this work has demonstrated that di-
etary OA supplementation can enhance various in-
testinal health and systemic immune parameters, and
thus the growth performance of broilers sub-clinically
challenged with ETEC. The findings of this study are
particularly pertinent at this time as more broiler pro-
duction systems adopt antibiotic or drug-free programs,
which are currently recognized to compromise intestinal
health and bird performance.
ACKNOWLEDGMENTS
The authors would like to thank Anpario PLC for
their financial support of this study.
REFERENCES
Alonso, M. Z., N. L. Padola, A. E. Parma, and P. M. A. Lucchesi.
2011. Enteropathogenic Escherichia coli contamination at differ-
ent stages of the chicken slaughtering process. Poult. Sci. 90:2638–
2641.
Al-Tarazi, Y. H., and K. Alshawabkeh. 2003. Effect of dietary formic
and propionic acids on Salmonella pullorum shedding and mor-
tality in layer chicks after experimental infection. J. Vet. Med.
50:112–117.
Amit-Romach, E., D. Sklan, and Z. Uni. 2004. Microflora ecology of
the chicken intestine using 16S ribosomal DNA primers. Poult.
Sci. 83:1093–1098.
Awad, W. A, K. Ghareeb, S Abdel-Raheem, and J Böhm. 2009.
Effects of dietary inclusion of probiotic and synbiotic on growth
performance, organ weights, and intestinal histomorphology of
broiler chickens. Poult. Sci. 88:49–56.
Boyen, F., F. Haesebrouck, A. Vanparys, J. Volf, M. Mahu, F. Van
Immerseel, I. Rychlik, J. Dewulf, R. Ducatelle, and F. Pasmans.
2008. Coated fatty acids alter virulence properties of salmonella
typhimurium and decrease intestinal colonization of pigs. Vet.
Microb. 132:319–327.
Broom, L. J. 2015. Organic acids for improving intestinal health of
poultry. World’s Poult. Sci. 71:630–642.
Bustin, S. A., V. Benes, J. A. Garson, J. Hellemans, J. Huggett, M.
Kubista, R. Mueller, T. Nolan, M. W. Pfaffi, G. L. Shipley, J.
Vandesompele, and C. T. Wittwer. 2009. The MIQE guidelines:
Minimum information for publication of quantitative real-time
PCR experiments. Clin. Chem. 55:611–622.
Cao, G. T., X. F. Zeng, A. G. Chen, L. Zhou, L. Zhang, Y.
P. Xiao, and C. M. Yang. 2013. Effects of a probiotic, En-
terococcus faecium, on growth performance, intestinal mor-
phology, immune response, and cecal microflora in broiler
chickens challenged with Escherichia coli K88. Poult. Sci.
92:2949–2955.
Cervantes, H. M. 2015. Antibiotic-free poultry production: Is it sus-
tainable? J. Appl. Poult. Res. 24:91–97.
Chowdhury, R., K. M. S. Islam, M. J. Khan, M. R. Karim,
M. N. Haque, M. Khatun, and G. M. Pesti. 2009. Effect of
citric acid, avilamycin, and their combination on the perfor-
mance, tibia ash, and immune status of broilers. Poult. Sci.
88:1616–1622.
DebRoy, C., and C. W. Maddox. 2001. Identification of virulence at-
tributes of gastrointestinal Escherichia coli isolates of veterinary
significance. Anim. Health Res Rev. 2:129–40.
Dibner, J. J., and J. D. Richards. 2005. Antibiotic growth promoters
in agriculture: history and mode of action. Poult. Sci. 84:634–643.
Frankel, W. L., W. Zhang, A. Singh, D. M. Klurfeld, S. Don, T.
Sakata, and J. L. Rombeau. 1994. Mediation of the trophic ef-
fects of short chain fatty acids on the rat jejunum and colon.
Gastroenterology. 106:385–390.
 ORGANIC ACID BLENDS AND BACTERIAL CHALLENGE
Garcı́a, V., P. Catalá-Gregori, F. Hernández, M. D. Megı́as, and
J. Madrid. 2007. Effect of formic acid and plant extracts on
growth, nutrient digestibility, intestine mucosa morphology, and
meat yield of broilers. J. Appl. Poult. Res. 16:555–562.
Ghasemi, H. A., H. Akhavan-Salamat, I. Hajkhodadadi, and A.
H. Khaltabadi-Farahani. 2014. Effects of dietary organic acid
blend supplementation on performance, intestinal morphology
and antibody-mediated immunity in broiler chickens. Acta Ad-
vances in Agri. Sci. 2:64–74.
Gheisari, A. A., A. H. Samie, T. Mousavi, J. Pourreza, and G. R.
Ghorbani. 2002. Effects of dietary vitamin C, E and fat on CD4
to CD8 T cell ratios in peripheral blood of heat-stressed broiler
chicks. Arch. Razi Ins. 54:65–75.
Giannenas, I., C. P. Papaneophytou, E. Tsalie, I. Pappas, E. Tri-
antafillou, D. Tontis, and G. A. Kontopidis. 2014a. Dietary sup-
plementation of benzoic acid and essential oil compounds affects
buffering capacity of the feeds, performance of turkey poults
and their antioxidant status, pH in the digestive tract, intestinal
microbiota and morphology. Asian-Australas. J. Anim. Sci. 27:
225–236.
Giannenas, I., C. P. Papaneophytou, E. Tsalie, E. Triantafillou, D.
Tontis, and G. A. Kontopidis. 2014b. The effects of benzoic acid
and essential oil compounds in combination with protease on the
performance of chickens. J. Anim. Feed Sci. 23:73–81.
Gilani, A., H. Kermanshahi, A. Golian, M. Gholizadeh, and A. A.
Mohammadpour. 2013. Measurement of acid binding capacity for
poultry feedstuffs in deionized and magnetized water. Iran. J.
Appl. Anim. Sci. 3:687–694.
Hernández, F., V. Garcı́a, J. Madrid, J. Orengo, P. Catalá, and M. D.
Megı́as. 2006. Effect of formic acid on performance, digestibility,
intestinal histomorphology and plasma metabolite levels of broiler
chickens. Br. Poult. Sci. 47:50–56.
Houshmand, M., K. Azhar, I. Zulkifli, M. H. Bejo, and A. Kamyab.
2011. Effects of nonantibiotic feed additives on performance, nu-
trient retention, gut pH, and intestinal morphology of broilers fed
different levels of energy. J. Appl. Poult. Res. 20:121–128.
Hume, M. E., D. E. Corrier, G. Wayne Ivie, and J. R. Deloach. 1993.
Metabolism of [14C] propionic acid in broiler chicks. Poult. Sci.
72:786–793.
Huyghebaert, G., R. Ducatelle, and F. Van Immerseel. 2011. An up-
date on alternatives to antimicrobial growth promoters for broil-
ers. Vet. J. 187:182–188.
Iba, A. M., and A. Berchieri, Jr. 1995. Studies on the use of a formic
acid-propionic acid mixture (BioaddTM ) to control experimen-
tal salmonella infection in broiler chickens. Avian Pathol. 24:
303–311.
Kaczmarek, S. A., A. Barri, M. Hejdysz, and A. Rutlowski. 2016.
Effect of different doses of coated butyric acid on growth perfor-
mance and energy utilization in broilers. Poult. Sci. 95:851–859.
Khan, M., and M. Katamay. 1969. Antagonistic effect of fatty acids
against salmonella in meat and bone meal. Appl. Microbiol.
17:402–404.
Khodambashi Emami, N., A. Samie, H. R. Rahmani, and C. A.
Ruiz-Feria. 2012. The effect of peppermint essential oil and fruc-
tooligosaccharides, as alternatives to virginiamycin, on growth
performance, digestibility, gut morphology and immune response
of male broilers. Anim. Feed Sci. Technol. 175:57–64.
3263
Khodambashi Emami, N., S. Zafari Naeini, and C. A. Ruiz-Feria.
2013. Growth performance, digestibility, immune response and
intestinal morphology of male broilers fed phosphorus deficient
diets supplemented with microbial phytase and organic acids.
Livest. Sci. 157:506–513.
Lee, I. K., S. Bae, M. J. Gu, S. J. You, G. Kim, S.-M. Park, W.-H.
Jeung, K. H. Ko, K. J. Cho, J. S. Kang, and C.-H. Yun. 2016.
H9N2-specific IgG and CD4+ CD25+ T cells in broilers fed a diet
supplemented with organic acids. Poult. Sci. 0:1–8.
Lee, K. W., H. S. Lillehoj, W. Jeong, H. Y. Jeoung, and D. J. An.
2011. Avian necrotic enteritis: Experimental models, host immu-
nity, pathogenesis, risk factors, and vaccine development. Poult.
Sci. 90:1381–1390.
Milbradt, E. L., A. S. Okamoto, J. C. Z. Rodrigues, E. A. Garcia, C.
Sanfelice, L. P. Centenaro, and R. L. Andreatti Filho. 2014. Use of
organic acids and competitive exclusion product as an alternative
to antibiotic as a growth promoter in the raising of commercial
turkeys. Poult. Sci. 93:1855–1861.
Nakai, S. A., and K. J. Siebert. 2003. Validation of bacterial growth
inhibition models based on molecular properties of organic acids.
Int. J. Food Microbiol. 86:249–255.
National Research Council. 1994. Nutrient requirements of poultry.
9th rev. ed. Natl. Acad. Press, Washington, DC.
Nava, G. M., M. S. Attene-Ramos, H. R. Gaskins, and J. D. Richards.
2009. Molecular analysis of microbial community structure in the
chicken ileum following organic acid supplementation. Vet. Mi-
crobiol. 137:345–353.
Ross Nutrition Supplement, 2009. Available from: http://
www.aviagen.com/.
SAS, 2004. Users Guide: Statistics SAS Institute Inc., Cary, NC,
USA.
Senkoylu, N., H. E. Samli, M. Kanter, and A. Agma. 2007. Influence
of a combination of formic and propionic acids added to wheat-
and barley-based diets on the performance and gut histomorphol-
ogy of broiler chickens. Acta Vet. Hung. 55:479–490.
Sheng, G., K. Q. Bernabe, J. Guo, and B. W. Warner. 2006.
Epidermal growth 387 factor receptor mediated proliferation of
enterocytes requires p21waf1/cip1 expression. Gastroenterology.
131:153–164.
Smirnov, A., E. Tako, P. R. Ferket, and Z. Uni. 2006. Mucin gene
expression and mucin content in the chicken intestinal goblet cells
are affected by in ovo feeding of carbohydrates. Poult. Sci. 85:
669–673.
Thompson, J. L., and M. Hinton. 1997. Antibacterial activity of
formic and propionic acids in the diet of hens on salmonellas in
the crop. Br. Poult. Sci. 38:59–65.
Waguespack Levy, A., J. W. Kessler, L. Fuller, S. Williams, G. F.
Mathis, B. Lumpkins, and F. Valdez. 2015. Effect of feeding an
encapsulated source of butyric acid (ButiPEARL) on the perfor-
mance of male Cobb broilers reared to 42 d of age. Poult. Sci.
94:1864–1870.
Wegmann, T. G., and O. Smithies. 1966. A simple hemagglutination
system requiring small amount of red blood cells and antibodies.
Transfus. 6:67–73.
Yamamoto, Y., and B. Glick. 1982. A comparison of the immune
response between two lines of chickens selected for differences in
the weight of the bursa of fabricius. Poult. Sci. 61:2129–2132.