Shock, Publish Ahead of Print

DOI : 10.1097/SHK.0000000000001351

TUDCA ameliorates liver injury via activation of SIRT1–FXR signaling in a rat

hemorrhagic shock model

Silei Suna#, Bing Zhaoa#, Mengzhi Qib, Yi Yaoa, Lili Xua, Ran Jia, Weiwei Chena, Jinlong

Wangc, Shunwei Huanga, Li Maa, Ying Chena, Zhitao Yanga, Huiqiu Shenga, Jian Feid,

Erzhen Chena*, Enqiang Maoa*

a
Department of Emergency

d
Department of General Surgery

Ruijin Hospital Affiliated to Shanghai Jiao Tong University School of Medicine, Shanghai,

China

b
Intensive care unit, Nanjing DrumTower Hospital, The Affiliated Hospital of Nanjing

University Medical School, Nanjing, China

c
Emergency centre, The Affiliated Hospital of Xuzhou Medical University, Xuzhou, China

#
Silei Sun and Bing Zhao contributed equally.

Address reprint requests to corresponding authors:

*
Enqiang Mao, MD, PhD

Add: Ruijin Er Road No.197, Shanghai, 200025, P.R China.

Fax: +862164333548

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
Tel: +862164370045

E-mail: maoeq@yeah.net

*
Erzhen Chen, MD, PhD

Add: Ruijin Er Road No.197, Shanghai, 200025, P.R China.

Fax: +862164333548

Tel: +862164370045

E-mail: rjchenerzhen@163.com

This study was supported by the National Natural Science Foundation of China

(No.81671901 to Enqiang Mao, No.81501643 to Bing Zhao, No.81601665 to Li Ma and

No.81600501 to Ying Chen).

All authors report no conflicts of interest.

Running head: TUDCA attenuates liver injury via SIRT1–FXR

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
Abstract

Objective: To investigate the changes of bile acids in the liver during hemorrhagic shock (HS) and

their potential to attenuate liver injury via activation of SIRT1 (sirtuin 1)–FXR (farnesoid X receptor)

signaling.

Methods: A Sprague–Dawley (SD) rat HS model was established, while HepG2 cells were

hypoxically cultured to simulate HS in vitro. Liver bile acids (BA) were profiled with ultra-

performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS). FXR expression

was detected by western blot and immunohistochemistry. The mRNA levels of SIRT1 and FXR were

detected by polymerase chain reaction. Protein expression of SIRT1, FoxM1, NF-κB, acetyl-NF-κB,

p53, and acetyl-p53 was analyzed by western blot. Hepatocyte apoptosis and proliferation were

measured by TUNEL assay and Ki-67 staining, respectively. Serum and supernatant cytokines were

analyzed using ELISA assays. Liver injury was also assessed. To investigate the possible

mechanisms, SIRT1 agonist (SRT1720), SIRT1 inhibitor (EX527), and FXR inhibitor (Z-

guggulsterone) were used.

Results: Tauroursodeoxycholic acid (TUDCA) in the liver decreased significantly after HS. SIRT1

and FXR expression was time-dependently downregulated by HS or hypoxia condition. TUDCA

upregulated SIRT1–FXR activity, which inhibited expression and acetylation of NF-κB and p53 and

increased FoxM1 expression, leading to decreased inflammatory response and apoptosis and

increased proliferative capacity in hepatocytes, and attenuation of liver injury. EX527 pretreatment

reversed the protective effect of TUDCA. Moreover, Z-guggulsterone supplementation decreased the

protective effect of TUDCA in vitro.

Conclusion: TUDCA in the liver decreased during HS. TUDCA supplementation might attenuate

HS-induced liver injury by upregulating SIRT1–FXR signaling.

Key words: hemorrhagic shock; liver injury; TUDCA; SIRT1; FXR.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
Introduction

HS is a life-threatening condition, which requires immediate intervention. It is estimated that

HS results in 1.9 million deaths per year worldwide (1). This condition is characterized by

hypoperfusion followed by tissue hypoxia, leading to oxidative stress and inflammation (2).

At the cellular level, insufficient oxygen supply results in a failure to meet the oxygen

demand of aerobic metabolism, resulting in cell death, such as necrosis and apoptosis (3). As

a result, HS is frequently associated with systemic inflammatory response syndrome and end-

organ damage.

Hepatic dysfunction is a common result of HS; if not treated effectively, it might progress to

liver failure, and even further develop into multiple organ dysfunction syndrome, which leads

to a poor prognosis. Although many attempts have been made to develop a suitable treatment

for this condition, such as remote ischemic conditioning(4), no ideal treatment has yet been

found (5). Against this background, the mechanism of hepatic dysfunction during HS needs

to be elucidated in order to develop new therapeutic strategies.

Bile acids (BA) are synthesized in the liver and function by binding to their receptors FXR

and Takeda G-protein-coupled receptor 5 (TGR5) (6). FXR, highly expressed in liver and

intestine, plays crucial roles in maintaining BA homeostasis, lipoprotein metabolism, hepatic

regeneration, and inflammation (7-9). A recent study indicated the therapeutic potential of

FXR for ischemia–reperfusion injury (10). SIRT1 belongs to the sirtuin family, which

consists of highly conserved mammalian proteins involved in cellular energy

homeostasis(11). Studies have suggested that the reduction of hepatic SIRT1 in mice leads to

impaired BA homeostasis, increased apoptosis, inhibition of hepatocyte proliferation, and

worsening of hepatic steatosis and inflammation (12, 13). In addition, SIRT1 has been shown

to modulate the activation of FXR and deletion of hepatic SIRT1 decreases FXR signaling

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
(14). Furthermore, activation of SIRT1 protects various organs from ischemia–reperfusion

injury(15, 16). A recent study showed that bile acids might modulate SIRT1 expression in

liver cholestasis and regeneration (17, 18). Our previous studies indicated that biliary tract

external drainage alleviated multiple organ injury induced by HS (19, 20); however, it failed

to improve or even aggravated liver damage. We speculated that BAs, as the main

components in bile, might have protective effects on liver function.

In this study, we hypothesized that, as protective BA decreased during HS, BA

supplementation might protect liver function via the activation of SIRT1–FXR signaling. To

test this hypothesis, we first used an established rat model of HS. BAs in HS rat liver were

profiled with UPLC-MS/MS and “reduced BAs” were identified. Next, we investigate

whether the administration of these “reduced BAs” might protect against HS-induced liver

injury. We also studied the possible mechanisms behind BA protection of liver function in

HS.

Material and Methods

Animals

Male Sprague–Dawley (SD) rats (275–325 g; Shanghai Laboratory Animal Center of the

Chinese Academy of Sciences) were housed and fed under specific pathogen-free conditions.

The animals were acclimatized to laboratory conditions (25 °C, 12 h/12 h light/dark cycle,

50% humidity, with free access to food and water) for one week prior to the start of the study.

The rats were fasted overnight prior to surgery with free access to water. The experiment was

carried out in accordance with the guidelines for the care and use of laboratory animals

established by the Animal Use and Care Committee of Shanghai Committee on Animal Care.

All surgical procedures were approved by the Institutional Animal Care and Use Committee

(IACUC) at Shanghai Jiao Tong University (Shanghai, China).

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
Hemorrhagic shock model

The HS model was established as described previously (21), with a few modifications. In

brief, after the rats had been anesthetized (i.p., sodium pentobarbital at 50 mg/kg), the right

femoral artery was dissected aseptically and then catheterized with a heparinized

polyethylene tube for blood pressure monitoring. Afterwards, the left femoral artery was

catheterized with the same technique and a heparinized syringe was attached at the end for

blood collection. The HS was initiated by withdrawing blood until the mean arterial pressure

(MAP) decreased to 30±5 mmHg and was maintained for 1 h by withdrawing or reinfusing

blood. Resuscitation was performed through the left femoral artery within 30 min by

reinfusing all lost blood with the same volume of Ringer’s solution. Sham rats underwent

pentobarbital anesthesia, laparotomy, vascular cannulation, and suturing, but no blood

withdrawal. SRT1720 (20 mg/kg, i.v.; MCE, Monmouth Junction, NJ, USA) or TUDCA (50

mg/Kg, 100 mg/Kg, or 150 mg/Kg, i.p.) was given during the resuscitation stage with

Ringer’s solution. EX527 (10 mg/Kg, i.p.; MCE) was administered 30 min before operation.

Rats were euthanized by decapitation at 6, 12, and 24 h after resuscitation. Serum and liver

samples were collected, flash-frozen, and stored at −80 °C prior to analysis.

UPLC-MS/MS

The liver samples were homogenized and the total BAs in the liver were extracted with

chloroform and methanol for detection. The UPLC-MS/MS analysis was performed on a

Waters Acquity UPLC system (Waters, Milford, MA, USA) coupled to a Triple Quad™ 5500

tandem mass spectrometer (AB Sciex, Framingham, MA, USA).

Cell culture experiments

HepG2 cells (purchased from Stem Cell Bank, Chinese Academy of Sciences) were cultured

in Dulbecco’s modified Eagle’s medium (DMEM) with 10% fetal bovine serum and 1%

penicillin–streptomycin. Hypoxic conditions (1% O2, 5% CO2, 94% N2) were applied to

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
simulate HS. Cells were cultured under hypoxia for 24 h and treated with SRT1720 (10 nM)

or TUDCA (10 μM, 20 μM, 30 μM) for the last 6 h. For FXR inhibition, Z-guggulsterone (30

μM, FXR inhibitor; Santa cruz biotechnology, Santa Cruz, CA, USA) was added 8 h before

treatment with TUDCA. Cells were collected for protein extraction or prepared for

subsequent assays.

Cell viability assay

Cell viability was assessed with the Cell Counting Kit-8 (CCK-8; Beyotime, Guangzhou,

Guangdong, China) following the manufacturer’s instructions. In brief, cells were seeded at

3×105 cells per well into 96-well plates in triplicate. Then, 10 μL of CCK-8 solution was

added to the cells in each well after the treatment with TUDCA at the indicated

concentrations, and then incubated at 37 °C for 3 h. Absorbance of the culture medium was

detected at 450 nm on a microplate reader (Lab systems, Vantaa, Finland).

Enzyme-linked immunosorbent assay

Serum IL-1β, IL-6, IL-10 and TNF-α levels were quantified using enzyme-linked

immunosorbent assay (ELISA) kits in accordance with the manufacturer’s instructions (Bio-

Rad, Berkeley, CA, USA). The concentrations were calculated using a standard curve.

Histological examination

After fixation in 4% paraformaldehyde for 24 h, liver samples were subjected to hematoxylin

and eosin (HE) staining. The slides were examined under an optical microscope by two

independent pathologists in a blinded fashion. Six fields per section were evaluated under

200× magnification. The severity of liver injury observed in tissue sections was scored as

follows: 0, minimal or no evidence of injury; 1, mild injury consisting of cytoplasmic

vacuolation and focal nuclear pyknosis; 2, moderate to severe injury with extensive nuclear

pyknosis, cytoplasmic hypereosinophilia and loss of intercellular borders; and 3, severe

necrosis with disintegration of hepatic cords, hemorrhage and neutrophil infiltration (22).

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
Immunohistochemistry

Paraffin-embedded liver sections were stained with Ki-67 or FXR antibody. The 5-μm

sections were pretreated using heat-mediated antigen retrieval with sodium citrate buffer (pH

6) for 20 min, and then washed twice with TBST [tris-buffered saline (TBS) with 0.025%

Triton X-100] for 5 min. Blocking was performed in TBS buffer with 10% nonimmune goat

serum and 1% bovine serum albumin to eliminate nonspecific staining. After blocking, the

sections were incubated overnight at 4°C with an optimally diluted rabbit polyclonal anti-rat

Ki-67 antibody (1:200; Abcam, Cambridge Science Park, Cambridge, UK) or anti-FXR

antibody (1:200; Invitrogen, Carlsbad, CA, USA). The sections were washed with phosphate-

buffered saline (PBS), and incubated with a goat anti-rabbit biotinylated secondary antibody

for 30 min, and visualized using a horseradish peroxidase (HRP)-conjugated avidin-biotin-

peroxidase technique (ABC) system with 3,3-N-diaminobenzidine tetrahydrochloride (DAB)

as the chromogen. The sections were then counterstained with hematoxylin and mounted with

p-xylene-bis-pyridinium bromide (DPX) for microscopic examination. The experimental

results were analyzed by Image J software. For Analysis of the results of FXR expression,

sum the optical density values of the positive parts of all hepatocytes nuclei, and then divide

by the sum of the areas of all nuclei. For analysis of the expression of Ki-67, count the

percentage of positive cells.

Quantitative real-time PCR

Total RNA was extracted from frozen liver tissues or HepG2 cells and reverse‐transcribed

into cDNA with a PrimeScriptTM RT Master Mix Kit following the manufacturer’s

instructions (Takara, Kusatsu, Shiga, Japan), Quantitative real‐time PCR was performed

using an SYBR Premix Ex TaqTM II Kit (Takara) to determine the expression levels of target

genes, and the results were normalized against β-actin expression. Amplification was

performed in a Step One Real‐Time PCR system (Applied Biosystems, Grand Island, NY,

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
USA). The following primers were used in this study: rat β-actin

(5′‐TCAGGTCATCACTATCGGCAAT‐3′ and 5′‐AAAGAAAGGGTGTAAAACGCA‐3′),

rat SIRT1 (5′‐GCTCGCCTTGCTGTGGACTTC‐3′ and

5′‐GTGACACAGAGATGGCTGGAACTG‐3′), rat FXR

(5′‐CGTCGGAAGTGCCAGGATTGC‐3′ and 5′‐CCTTCGCTGTCCTCATTCACTGTC‐3′),

human β-actin (5′‐CTCCATCCTGGCCTCGCTGT‐3′ and

5′‐GCTGTCACCTTCACCGTTCC‐3′), human SIRT1

(5′‐TATACCCAGAACATAGACACGC‐3′ and 5′‐CTCTGGTTTCATGATAGCAAGC‐3′),

and human FXR (5′‐TACCAAAAACGCTGTGTACAAG‐3′ and

5′‐TTCCTTAGTCGACACTCTTGAC‐3′).

TUNEL assay

DNA fragmentation in liver sections was assessed using the TUNEL assay (Cell Death

Detection Kit; Roche, Mannheim, Germany). Briefly, air-dried slides were fixed with 4%

paraformaldehyde for 30 min at room temperature (RT), washed three times with PBS for 10

min, and then permeabilized with 1% Triton X-100 for 4 min at 4°C. Then, the TdT-labeled

nucleotide mix was added to each slide and incubated at 37°C for 60 min in the dark. The

slides were washed twice with PBS and then counterstained with 10 mg/mL 4,6-diamidino-2-

phenylindole (DAPI) for 5 min at 37°C.

Western blot analysis

Liver tissues from all animals were frozen immediately in liquid nitrogen and then stored at

−80°C for western blot analysis. Briefly, samples were homogenized in RIPA lysis buffer

(Beyotime) for 1 h at 4°C and total protein was extracted by centrifugation (12,000 rpm, 10

min, 4°C). Protein concentration was determined using a BCA Protein Assay Kit (Beyotime).

Proteins were separated using SDS–polyacrylamide gel electrophoresis (PAGE) and

transferred to polyvinylidene difluoride (PVDF) membranes. TBST containing 5% skimmed

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
milk powder was used for blocking membranes at RT for 1 h. Next, the membranes were

incubated with primary antibodies overnight at 4°C. Primary antibodies were a mouse

monoclonal anti-SIRT1 (1:8000; Abcam, Cambridge, UK), a mouse monoclonal anti-FXR

(1:1000; Invitrogen), a rabbit polyclonal anti-FOXM-1 (1:1000, Abcam), anti-NF-kB p65

(1:1000; Abcam), anti-NF-kB p65(acetyl K310) (1:1000; Abcam), anti-p53 antibody (1:1000;

Abcam), anti-acetyl-p53 (acetyl K305) (1:1000; Abcam), and a mouse monoclonal anti-β-

actin (1:1000; Beyotime). The blots were incubated with an HRP-conjugated secondary

antibody for 1 h at RT and reacted with an enhanced chemiluminescence substrate

(Millipore). The resulting chemiluminescence was recorded using an imaging system

(Imagequant LAS 400; GE Healthcare, Pittsburgh, PA, USA). The enhanced

chemiluminescence signals were digitized using Adobe Photoshop CC software to quantify

the protein expression levels. Relative protein expression was normalized to β-actin, and the

results are expressed as fold change relative to the baseline levels in each group.

Statistical analysis

The measured data are expressed as the mean ± standard deviation (SD). The significance of

differences between different groups was determined via the unpaired Student’s t-test and

one-way ANOVA followed by Tukey’s post hoc test. p < 0.05 was considered statistically

significant. All data were analyzed using GraphPad Prism 6.0.

Results

SIRT1 and FXR expression was downregulated in HS rat liver or HepG2 cultured

under hypoxic conditions

The expression levels of SIRT1 and FXR proteins were detected in the liver of rats with HS.

FXR expression was also immunohistochemically detected. The results indicated that the

expression of both SIRT1 and FXR proteins was downregulated, in a time-dependent manner

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
(p < 0.05) (Fig. 1A–C, G, Fig. S1, http://links.lww.com/SHK/A867). We next cultured

HepG2 cells under hypoxic conditions, the results showed that hypoxia led to decreased

expression of SIRT1 and FXR in these cells (p < 0.05) (Fig. 1D–F). Our study indicates that

HS or hypoxia decreased the expression of SIRT1 and FXR.

The composition of BAs changed significantly in the liver of rats with HS

The concentration of BAs in the liver was quantified with UPLC-MS/MS. The results

indicated that deoxycholic acid (DCA) concentration decreased at 24 h after HS. The

concentrations of taurine-conjugated cholic acid (TCA), and taurine-conjugated (alpha +

beta) muricholic acid (T (α + β) MCA) decreased at 12 h after HS. The concentration of

TUDCA has been decreased with increasing time after HS. (Fig. 2).

To investigate the influence of TUDCA on the cell viability of HepG2 cells, TUDCA was

added to these cells, the results indicated that the survival rate of HepG2 was more than 95%,

but decreased slightly as the concentration of TUDCA increased from 5 to 20 μM. The

survival rate decreased to less than 90% when TUDCA concentration exceeded 30 μM (Fig.

3).

TUDCA increased the expression of SIRT1 and FXR both in vivo and in vitro

To investigate whether TUDCA could protect the hepatic function, it was given to the HS rats

during the resuscitation stage and to the HepG2 during hypoxic culture. SRT1720 was also

administered as a positive control. Western blot and PCR results indicated that TUDCA

upregulated the mRNA levels and protein expression of SIRT1 and FXR (p < 0.05) (Fig. 4).

However, as the results indicated, with the increase of TUDCA concentration, the expression

of FXR in the liver of hemorrhagic shock rats or HepG2 cultured under hypoxic condition

decreased.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
TUDCA attenuated liver injury in rats with HS

Histologic assessment of the liver upon HE staining revealed clear pathological changes,

including necrosis, extensive nuclear pyknosis, cytoplasmic hypereosinophilia, loss of

intercellular borders, hemorrhage, and neutrophil infiltration, in the HS-treated rats. This was

significantly improved with the administration of TUDCA (Fig. 5A, D). Biochemical markers

of liver injury showed the same trend. Specifically, treatment with TUDCA significantly

decreased serum ALT and AST levels in HS-treated rats, further documenting its protective

role against liver injury in the HS model (Fig. 6A, B).

TUDCA reduced hepatocyte apoptosis and restored hepatocyte proliferation in HS-

treated rats

Apoptosis is a common form of cell death occurring after cell damage. Liver regeneration

plays a vital role in hepatic repair after liver damage. The results in this study indicated

numerous TUNEL-positive cells seen in the HS group compared with the level in the Sham

group. Treatment with TUDCA significantly decreased TUNEL-positive cells (Fig. 5C, F).

Hepatocyte proliferation was significantly decreased in the HS-treated rats, as indicated by

Ki-67 staining, while treatment with TUDCA restored hepatocyte proliferation under HS

(Fig. 5B, E).

TUDCA reduced inflammation in the rat model of HS

Serum cytokines were analyzed to assess the systemic inflammatory response. The results

showed that serum levels of IL-1β, IL-6, IL-10, and TNF-α significantly increased after HS.

Their levels were profoundly decreased with TUDCA treatment (Fig. 6D–F).

TUDCA attenuated liver injury by modulating the SIRT1–FXR pathway and its

downstream signaling

To investigate the underlying mechanisms by which TUDCA improved liver injury in rats

with HS, we analyzed the activity of the SIRT1–FXR pathway and its downstream signaling,

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
including NF-κB, p53, and FoxM1. Our results revealed that SIRT1 and FXR were

significantly upregulated compared with the levels in the HS group, which was accompanied

by decreased expression and acetylation of NF-κB and p53, along with increased expression

of FoxM1 (Fig. 7). The administration of EX527 inhibited the expression of SIRT1 and FXR,

reversed its downstream signaling, and reduced the protective effect of TUDCA (Fig. 6, 7).

We further explored whether SIRT1 regulates NF-κB, p53, and FoxM1 via the activation of

FXR in vitro using HepG2 cells. The results indicated that hypoxic conditions downregulated

the expression of SIRT1 and FXR in HepG2, and modulated downstream signaling.

Treatment with TUDCA increased the expression of SIRT1 and FXR, which decreased the

expression and acetylation of NF-κB and p53 while increasing the expression of FoxM1,

exhibiting a protective effect. The inhibition of FXR by Z-guggulstrone did not affect the

acetylation of NF-κB and p53, but increased the expression of both, thereby impairing the

protective effect of TUDCA (Fig. 8, 9). These findings indicate that TUDCA modulated the

expression and acetylation of NF-κB and p53 and the expression of FoxM1 by upregulating

SIRT1–FXR signaling.

Discussion

HS due to trauma remains the leading cause of morbidity and mortality worldwide(23). Liver

is considered to be the most frequently affected organ after HS. It is estimated that 20% of

patients in hypovolemic shock exhibit liver dysfunction (24). Despite an increased

understanding of the mechanisms behind HS-induced hepatic injury, the treatment remains

limited to preventive and supportive care. In this study, we found that TUDCA in the liver

decreased following HS. In addition, HS led to decreased expression of SIRT1 and FXR in

rat liver and human HepG2 cells. TUDCA supplementation enhanced the expression of

SIRT1 and FXR, which downregulated the expression and acetylation of NF-κB and p53, and

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
increased the expression of FoxM1, exhibiting a protective effect on liver function.

Furthermore, the inhibition of SIRT1 or FXR attenuated the protective effect of TUDCA.

TUDCA is the taurine-conjugated form of ursodeoxycholic acid (UDCA); it has been shown

to reduce inflammation and apoptosis in ischemia–reperfusion animal models (25).

Additionally, studies have indicated that TUDCA exhibits protective effects by inhibiting

endoplasmic reticulum stress in rat models of several diseases (26, 27). These findings

indicate that TUDCA might be beneficial for liver function under HS. Our results of BA

profiling with UPLC-MS/MS demonstrated that the concentration of TUDCA in the liver

decreased significantly after HS. Furthermore, intraperitoneal supplementation of TUDCA

attenuated liver histological injury, decreased levels of serum transaminase and cytokines,

inhibited apoptosis, and restored hepatocyte proliferation.

Despite substantial efforts, the current options for treating liver dysfunction in clinical

practice are still limited. The underlying cause of this difficulty is the complex mechanism

involved in HS-induced liver damage.

HS leads to the activation of Kupffer cells in the liver, causing increased secretion of

inflammatory cytokines, which could affect multiple organs via blood and bile circulation

(28). Apoptosis is also common in liver cell damage after shock (29), but interventions

focusing on apoptosis failed to improve liver function (30). Moreover, studies focusing on the

stimulation of pathways involved in liver regeneration have shown that it can protect the liver

from ischemia-reperfusion injury (31). Therefore, we speculated that simultaneous

interventions in hepatocyte inflammatory response, apoptosis, and proliferation might be a

worthwhile approach to treat HS-induced liver injury.

SIRT1, the mammalian homolog of yeast Sir2, is an NAD-dependent protein deacetylase. It

is involved in a wide range of cellular processes, including aging, stress response,

inflammation, metabolism, cell proliferation, and apoptosis (32). It has been reported that the

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
activation of SIRT1 inhibited inflammation and apoptosis through the regulation of FXR and

its downstream signaling in a cholestatic liver injury model (33). Our studies demonstrated

that HS decreased the expression of SIRT1, downregulating the expression of FXR, which is

in consistent with previous research documenting that SIRT1 regulates the expression of FXR

(14). FXR, as a BA receptor, has been shown to regulate inflammation through inhibition of

the NLRP3 inflammasome in a sepsis model of mice (34). In addition, FXR plays an

important role in the regeneration and repair after liver injury (35). Our results indicate that

the administration of TUDCA significantly upregulated the activity of SIRT1–FXR signaling,

which exhibited a protective effect on HS-induced liver injury by modulating downstream

signaling involved in hepatocyte inflammation, apoptosis, and proliferation.

In this study, we first detected the reduction of TUDCA in rat liver under HS conditions, and

then investigated its protective effect on liver function and the potential mechanisms

involved. This provided a theoretical basis for the application of TUDCA in hepatic

dysfunction caused by HS.

However, changes in bile acids in the enterohepatic circulation during shock are complex,

and their interaction with the gut microbiota may affect the liver and other organs. In this

study, we combined the findings from reports of other researchers and our preliminary results

of BA profiling to specifically study the effects of TUDCA on liver function, which may

have certain limitations. In addition, our results showed that the expression of FXR decreased

with the increase of TUDCA concentration, which indicated that TUDCA might have a dose-

dependent biphasic effect on FXR expression via unknown mechanisms. Further research is

needed to elucidate the mechanism behind this phenomenon and to explore the optimal

strategy for treating of HS-induced liver injury by intervening in bile acid metabolism.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
In conclusion, our study indicates that supplementation of TUDCA with appropriate

concentration exhibited protective effects on HS-induced liver injury. TUDCA could enhance

the expression of SIRT1–FXR, which restored hepatocyte proliferation and inhibited

hepatocyte apoptosis and inflammatory responses by downregulating the expression and

acetylation of NF-κB and p53, as well as upregulating the expression of FoxM1. These

results demonstrate that TUDCA might be a promising therapeutic for HS-induced liver

injury.

Acknowledgements

We thank the staff of Shanghai Institute of Traumatology and Orthopedics for their technical

support. This study was supported by the National Natural Science Foundation of China

(No.81671901 to Enqiang Mao, No.81501643 to Bing Zhao, No.81601665 to Li Ma and

No.81600501 to Ying Chen). We would like to thank LetPub (www.letpub.com) for

providing linguistic assistance during the preparation of this manuscript.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
References

1. Cannon JW: Hemorrhagic Shock. N Engl J Med 378(4):370-379, 2018.

2. Tachon G, Harrois A, Tanaka S, Kato H, Huet O, Pottecher J, Vicaut E and Duranteau J:

Microcirculatory alterations in traumatic hemorrhagic shock. Crit Care Med 42(6):1433-41,

2014.

3. Barbee RW, Reynolds PS and Ward KR: Assessing shock resuscitation strategies by

oxygen debt repayment. Shock 33(2):113-22, 2010.

4. Leung CH, Caldarone CA, Guan R, Wen X-Y, Ailenberg M, Kapus A, Szaszi K and

Rotstein OD: Nrf2 Regulates the Hepatoprotective Effects of Remote Ischemic Conditioning

in Hemorrhagic Shock. Antioxid Redox Signal, 2018.

5. Leung CH, Caldarone CA, Wang F, Venkateswaran S, Ailenberg M, Vadasz B, Wen X-Y

and Rotstein OD: Remote Ischemic Conditioning Prevents Lung and Liver Injury After

Hemorrhagic Shock/Resuscitation: Potential Role of a Humoral Plasma Factor. Ann Surg

261: 1215-1225, 2015.

6. Jia W, Xie G and Jia W: Bile acid-microbiota crosstalk in gastrointestinal inflammation

and carcinogenesis. Nat Rev Gastroenterol Hepatol 15(2):111-128, 2018.

7. Schmitt J, Kong B, Stieger B, Tschopp O, Schultze SM, Rau M, Weber A, Mullhaupt B,

Guo GL and Geier A: Protective effects of farnesoid X receptor (FXR) on hepatic lipid

accumulation are mediated by hepatic FXR and independent of intestinal FGF15 signal. Liver

Int 35(4):1133-44, 2015.

8. Hao H, Cao L, Jiang C, Che Y, Zhang S, Takahashi S, Wang G and Gonzalez F: Farnesoid

X Receptor Regulation of the NLRP3 Inflammasome Underlies Cholestasis-Associated

Sepsis. Cell Metab 25(4):856-867.e5, 2017.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
9. Chen W, Wang Y, Zhang L, Shiah S, Wang M, Yang F, Yu D, Forman B and Huang W:

Farnesoid X receptor alleviates age-related proliferation defects in regenerating mouse livers

by activating forkhead box m1b transcription. Hepatology 51(3):953-62, 2010.

10. Ceulemans LJ, Verbeke L, Decuypere JP, Farre ́ R, DeHertogh G, Lenaerts K, Jochmans

I, Monbaliu D, Nevens F, Tack J, et al.: Farnesoid X Receptor Activation Attenuates

Intestinal Ischemia Reperfusion Injury in Rats. PloS one 12(1): e0169331, 2017.

11.

Nogueiras R, Habegger KM, Chaudhary N, Finan B, Banks AS, Dietrich MO, Horvath TL, Sin

clair DA, Pfluger PT, and Tschöp MH: Sirtuin 1 and sirtuin 3: physiological modulators of

metabolism. Physiological reviews 92(3):1479-514, 2012.

12. Yin H, Hu M, Liang X, Ajmo JM, Li X, Bataller R, Odena G, Stevens SM, Jr. and You

M: Deletion of SIRT1 from hepatocytes in mice disrupts lipin-1 signaling and aggravates

alcoholic fatty liver. Gastroenterology 146(3):801-11, 2014.

13. Han D, Li X, Li S, Su T, Fan L, Fan W, Qiao H, Chen J, Fan M, Li X, et al.: Reduced

silent information regulator 1 signaling exacerbates sepsis-induced myocardial injury and

mitigates the protective effect of a liver X receptor agonist. Free Radic Biol Med 113:291-

303, 2017.

14. Garcia-Rodriguez JL, Barbier-Torres L, Fernandez-Alvarez S, Gutierrez-de Juan V,

Monte MJ, Halilbasic E, Herranz D, Alvarez L, Aspichueta P, Marin JJ, et al.: SIRT1

controls liver regeneration by regulating bile acid metabolism through farnesoid X receptor

and mammalian target of rapamycin signaling. Hepatology 59(5):1972-83, 2014.

15. Qi MZ, Yao Y, Xie RL, Sun SL, Sun WW, Wang JL, Chen Y, Zhao B, Chen EZ and Mao

EQ: Intravenous Vitamin C attenuates hemorrhagic shock-related renal injury through the

induction of SIRT1 in rats. Biochem Biophys Res Commun 501(2):358-364, 2018.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
16. Hsu CP, Zhai P, Yamamoto T, Maejima Y, Matsushima S, Hariharan N, Shao D, Takagi

H, Oka S and Sadoshima J: Silent information regulator 1 protects the heart from

ischemia/reperfusion. Circulation 122(21):2170-82, 2010.

17. Kulkarni SR, Soroka CJ, Hagey LR and Boyer JL: Sirtuin 1 activation alleviates

cholestatic liver injury in a cholic acid-fed mouse model of cholestasis. Hepatology

64(6):2151-2164, 2016.

18. Blokker BA, Maijo M, Echeandia M, Galduroz M, Patterson AM, Ten A, Philo

M, Schungel R, Gutierrez-de Juan V, Halilbasic E, et al.: Fine-tuning of SIRT1 expression is

essential to protect the liver from cholestatic liver disease. Hepatology 69(2):699-716, 2019.

19. Wang L, Zhao B, Chen Y, Ma L, Chen EZ and Mao EQ: Biliary tract external drainage

protects against intestinal barrier injury in hemorrhagic shock rats. World journal of

gastroenterology 21(45):12800-13, 2015.

20. Wang L, Zhao B, Chen Y, Ma L, Chen EZ and Mao EQ: Inflammation and Edema in the

Lung and Kidney of Hemorrhagic Shock Rats Are Alleviated by Biliary Tract External

Drainage via the Heme Oxygenase-1 Pathway. Inflammation 38(6):2242-51, 2015.

21. Inoue K, Takahashi T, Uehara K, Shimuzu H, Ido K, Morimatsu H, Omori E, Katayama

H, Akagi R and Morita K: Protective role of heme oxygenase 1 in the intestinal tissue injury

in hemorrhagic shock in rats. Shock 29(2):252-61, 2008.

22. Hsu B, Lee R, Yang F, Harn H and Chen H: Post-treatment with N-acetylcysteine

ameliorates endotoxin shock-induced organ damage in conscious rats. Life Sci 79(21):2010-6,

2006.

23. Matheson PJ, Fernandez-Botran R, Smith JW, Matheson SA, Downard CD, McClain CJ

and Garrison RN: Association Between MC-2 Peptide and Hepatic Perfusion and Liver

Injury Following Resuscitated Hemorrhagic Shock. JAMA Surgery 151(3):265-72, 2016.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
24. Karmaniolou II, Theodoraki KA, Orfanos NF, Kostopanagiotou GG, Smyrniotis VE,

Mylonas AI and Arkadopoulos NF: Resuscitation after hemorrhagic shock: the effect on the

liver—a review of experimental data. Journal of Anesthesia 27(3):447-460, 2012.

25. Zhang L and Wang Y: Tauroursodeoxycholic Acid Alleviates H2O2-Induced Oxidative

Stress and Apoptosis via Suppressing Endoplasmic Reticulum Stress in Neonatal Rat

Cardiomyocytes. Dose-Response 16(3):1559325818782631, 2018.

26. Zong S, Liu T, Wan F, Chen P, Luo P and Xiao H: Endoplasmic Reticulum Stress Is

Involved in Cochlear Cell Apoptosis in a Cisplatin-Induced Ototoxicity Rat Model.

Audiology and Neurotology 22(3):160-168, 2017.

27. De Miguel C, Sedaka R, Kasztan M, Lever JM, Sonnenberger M, Abad A, Jin

C, Carmines PK, Pollock DM and Pollock JS: Tauroursodeoxycholic acid (TUDCA)

abolishes chronic high salt-induced renal injury and inflammation. Acta physiologica

30:e13227, 2018.

28. Wang L, Zhao B, Chen Y, Ma L, Chen EZ and Mao EQ: Inflammation and Edema in the

Lung and Kidney of Hemorrhagic Shock Rats Are Alleviated by Biliary Tract External

Drainage via the Heme Oxygenase-1 Pathway. Inflammation 38(6):2242-51, 2015.

29. Helling TS: The liver and hemorrhagic shock. J Am Coll Surg 201(5):774-83, 2005.

30. Mauriz J, González P, Jorquera F, Olcoz J and González-Gallego J: Caspase inhibition

does not protect against liver damage in hemorrhagic shock. Shock 19(1):33-7, 2003.

31. Kuncewitch M, Yang WL, Molmenti E, Nicastro J, Coppa GF and Wang P: Wnt agonist

attenuates liver injury and improves survival after hepatic ischemia/reperfusion. Shock

39(1):3-10, 2013.

32. Anderson KA, Green MF, Huynh FK, Wagner GR and Hirschey MD: SnapShot:

Mammalian Sirtuins. Cell 159(4):956-956.e1, 2014.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
33. Khader A, Yang W, Godwin A, Prince J, Nicastro J, Coppa G and Wang P: Sirtuin 1

Stimulation Attenuates Ischemic Liver Injury and Enhances Mitochondrial Recovery and

Autophagy. Crit. Care Med. 44(8):e651-63, 2016.

34. Hao H, Cao L, Jiang C, Che Y, Zhang S, Takahashi S, Wang G and Gonzalez FJ:

Farnesoid X Receptor Regulation of the NLRP3 Inflammasome Underlies Cholestasis-

Associated Sepsis. Cell Metab 25(4):856-867.e5, 2017.

35. Zhang L, Wang YD, Chen WD, Wang X, Lou G, Liu N, Lin M, Forman BM and Huang

W: Promotion of liver regeneration/repair by farnesoid X receptor in both liver and intestine

in mice. Hepatology 56(6):2336-43, 2012.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
Figure legends

Fig. 1. HS and hypoxic conditions decreased the expression of SIRT1 and FXR in rat

liver and HepG2, respectively. The expression of SIRT1 and FXR at 6, 12, and 24 h after

HS was detected by western blot (A–C) and the expression of FXR was also analyzed by

immunohistochemistry (G). HepG2 cells were cultured under hypoxic conditions (1% O2, 5%

CO2, 94% N2) for 12, 24, and 36 h. The expression of SIRT1 and FXR was detected by

western blot (D–F). Data are represented as mean ± SD (n = 6). *p < 0.05 compared with

sham or control. **p < 0.05 compared with HS 6h or hypoxia 12h. ***p<0.05 compared with

HS 12h or hypoxia 24h. HS stands for hemorrhagic shock and Hyp for hypoxia. The arrows

indicate FXR expression in hepatocytes.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
Fig. 2. Bile acid changes under HS.

Bile acids in rat liver at 6, 12, and 24 h after HS were profiled with UPLC-MS/MS. Data are

represented as mean ± SD (n = 6). *p < 0.05 compared with Control. un-BA stands for

unconjugated bile acids, G-BA means glycine-conjugated bile acids, and T-BA for taurine-

conjugated bile acids.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
Fig. 3. Cell viability assay.

HepG2 cells were cultured with TUDCA at different concentrations (5 μM, 10 μM, 20 μM,

30 μM, 50 μM, 100 μM). The rate of live cells relative to the control was analyzed. Data are

represented as mean ± SD (n = 6). *p < 0.05 compared with control group. **p < 0.05

compared with 5 μM group. ***p<0.05 compared with 10 μM group. ****p<0.05 compared

with 20 μM group. *****p<0.05 compared with 30 μM group.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
Fig. 4. TUDCA enhanced the expression of SIRT1 and FXR both in vivo and in vitro.

HS rats were treated with SRT1720 (20 mg/Kg) or TUDCA (i.p., 50 mg/Kg, 100 mg/Kg, 150

mg/Kg), and the mRNA and protein expression of SIRT1 and FXR was detected with RT-

PCR (I, J) and western blot (D–F). HepG2 cells were cultured under hypoxic conditions for

24 h and stimulated with TUDCA (10 μM, 20 μM, 30 μM) in the last 6 h. The mRNA and

protein expression of SIRT1 and FXR was detected by RT-PCR (G, H) and western blot (A–

C). Data are presented as mean ± SD (n = 6). *p < 0.05 compared with sham or control. **p

< 0.05 compared with HS or hypoxia. ***p < 0.05 compared with HS + SRT1720 or hypoxia

+ SRT1720. ****p < 0.05 compared with HS + TUDCA 50mg or hypoxia + TUDCA 10 μM.

****p < 0.05 compared with HS + TUDCA 100 mg or hypoxia + TUDCA 20 μM. HS stands

for hemorrhagic shock and Hyp for hypoxia.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
Fig. 5. TUDCA attenuated HS induced liver injury histologically, restored hepatocyte

proliferation and inhibited hepatocyte apoptosis. (A, D) HE staining was used for

histological assessment of the liver. (B, E) Hepatocyte proliferation were analyzed with Ki-67

immunohistochemistry. (C, F) TUNEL staining was used to identify apoptotic hepatocytes.

Data are presented as mean ± SD (n = 6). *p< 0.05 compared with sham. **p < 0.05

compared with HS. ***p <0 .05 compared with HS + TUDCA. ****p<0.05 compared with

HS + TUDCA + EX527. The arrows indicate Ki-67 expression in hepatocytes. TUDCA

concentration: 50mg/Kg. Samples were taken at 24 h after resuscitation.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
Fig. 6. TUDCA decreased the levels of serum transaminases and cytokines. (A, B) Serum

ALT and AST levels were detected. (C–F) Serum cytokines were detected with ELISA. Data

are presented as mean ± SD (n = 6). *p<0.05 compared with sham. **p <0 .05 compared with

HS. ***p < 0.05 compared with HS +T UDCA. ****p < 0.05 compared with HS + TUDCA

+ EX527.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
Fig. 7. TUDCA modulated NF-κB, p53, and FoxM1 signaling via upregulating the

expression of SIRT1 and FXR in the liver of rats with HS. Rats with HS were treated with

TUDCA with or without SIRT1 inhibition (EX527). The protein expression of SIRT1,

FoxM1, acetyl- NF-κB, NF-κB, acetyl-p53, p53, and FXR was detected by western blot. Data

are presented as mean ± SD (n = 6). *p < 0.05 compared with sham. **p < 0.05 compared

with HS. ***p < 0.05 compared with HS + TUDCA. ****p < 0.05 compared with HS +

TUDCA + EX527. HS stands for hemorrhagic shock, HS + T for HS + TUDCA, HS + T + E

for HS + TUDCA + EX527.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
Fig. 8. TUDCA modulated NF-κB, p53, and FoxM1 signaling via upregulating SIRT1–

FXR signaling in HepG2 under hypoxic conditions. HepG2 cells under hypoxic conditions

were treated with TUDCA with or without FXR inhibition (Z-guggulsterone). The protein

expression of SIRT1, FoxM1, acetyl- NF-κB, NF-κB, acetyl-p53, p53, and FXR was detected

by western blot. Data are represented as mean ± SD (n = 6). *p < 0.05 compared with control.

**p < 0.05 compared with hypoxia. ***p < 0.05 compared with hypoxia + TUDCA. ****p <

0.05 compared with Hypoxia + TUDCA + Z-GS. Hyp stands for hypoxia, Hyp + T for

Hypoxia + TUDCA, Hyp + T + Z for Hypoxia + TUDCA + Z-guggulsterone, and Z-GS for

Z-guggulsterone.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.
Fig. 9. TUDCA attenuated inflammation and apoptosis in HepG2 under hypoxic

conditions. HepG2 cells under hypoxic conditions were treated with TUDCA with or without

FXR inhibition (Z-guggulsterone). (A) TUNEL staining was used to identify apoptotic

hepatocytes. (B, C) The levels of ALT and AST in supernatant were detected. (D–G) The

cytokines in supernatant were analyzed by with ELISA. Data are represented as mean ± SD

(n = 6). *p < 0.05 compared with control. **p < 0.05 compared with hypoxia. ***p < 0.05

compared with hypoxia +T UDCA. ****p<0.05 compared with Hypoxia + TUDCA + Z-GS.

Copyright © 2019 by the Shock Society. Unauthorized reproduction of this article is prohibited.