APMIS © 2015 APMIS. Published by John Wiley & Sons Ltd.

DOI 10.1111/apm.12365

Genetic variant of IL28B rs12979860, as predictive

marker of interferon-based therapy in Pakistani
population

MUHAMMAD IMRAN, SOBIA MANZOOR, SIKANDAR AZAM and SALEHA RESHAM

Atta-ur-Rahman School of Applied Bio-Sciences, Department of Healthcare Biotechnology, National

University of Sciences and Technology (NUST), Islamabad, Pakistan

Imran M, Manzoor S, Azam S, Resham S. Genetic variant of IL28B rs12979860, as predictive marker of
interferon-based therapy in Pakistani population. APMIS 2015.
Hepatitis C virus (HCV) genotypes and genetic variants of interleukin 28B (IL28B) are significantly associated with
interferon plus ribavirin treatment of HCV infection. We investigated the distribution of HCV genotypes and single-
nucleotide polymorphisms (SNPs) of IL28B (rs12979860 and rs8099917) in Pakistani population. IL28B genotyping
was performed by allele-specific PCR and restriction fragment length polymorphism PCR in 140 chronic hepatitis C
patients (CHC) and 120 healthy controls. HCV genotype 3 (HCVG3) was the most prevalent genotype, 71.4%
(n = 100/140) and with the highest treatment response of 90% (n = 90/100). The overall treatment response of all the
HCV genotypes was 82% (n = 115/140). The distribution of IL28B rs12979860CC genotype in treatment responder
and non-responder groups was 40.8% (n = 47/115) and 16% (n = 4/25) respectively. IL28B rs12979860CC genotype
demonstrated a significant correlation (p = 0.019) with interferon-based therapy of HCV infection. However, there was
no observed association of IL28B rs8099917 polymorphism with treatment response in CHC patients (p = 0.264). In
conclusion, HCV genotypes and IL28B rs12979860 are predictive markers for the efficiency of interferon plus ribavirin
combinational therapy of HCV infection. We recommend the inclusion of testing for these markers in the clinical crite-
ria for decision making for HCV therapy in Pakistani population.
Key words: Hepatitis; polymorphism; interferon therapy; genotypes; responders.
Sobia Manzoor, Atta-ur-Rahman School of Applied Bio-Sciences, Department of Healthcare Biotechnology, National
University of Sciences and Technology (NUST), Islamabad 44000, Pakistan. E-mails: lcianunique@yahoo.com;
dr.sobiamanzoor@asab.nust.edu.pk

Hepatitis C virus (HCV) was discovered in 1989 as
a major cause of hepatitis associated with blood
transfusion (1). It is a major health burden affecting
about 200 million people throughout the world (2).
Persistent HCV infection may lead to liver inflam-
mation, cirrhosis, decompensated liver and hepato-
cellular carcinoma (3). The standard treatment of
HCVG1 infection is a combination of pegylated
interferon alpha 2a or 2b (PEG-IFN), ribavirin and
protease inhibitor (Boceprevir or Telaprevir) (4).
The combinational regime of HCV treatment is
costly and linked to serious side effects. Also, the
treatment duration and the success rate are mainly
dependent on the HCV genotypes (5, 6). The treat-
ment response to combinational therapy of PEG-
IFN and ribavirin for HCVG2 and 3 is about 80%
Received 5 September 2014. Accepted 17 December 2014
and approximately 40–52% for genotype 1 (7).
Recently, two new oral antiviral agents, simeprevir
(a protease inhibitor) and sofosbuvir (a polymerase
inhibitor), against HCV infection have been
approved by the Food and Drugs Administration
(FDA). Both drugs were administered in combina-
tion with PEG-IFN and ribavirin. The response rate
to simeprevir was 80% for HCVG1 and 90% for
sofosbuvir against HCVG1, 4, 5 and 6 (8). The dis-
tribution of HCV genotypes varies from region to
region within a country (9). Thus, information
about HCV genotype is imperative for the clinical
management of the disease. Pakistan is ranked as
the country with the second highest rate of HCV
infection in the world. Approximately, 10 million
people are living with HCV infection in Pakistan
with 3a as the most predominant sub-genotype. The
treatment response to interferon and ribavirin in

1
 IMRAN et al.
Pakistan for HCVG1 and 4 is low, however, it is
high for HCVG3 (10).
There is a strong association of both host and viral
factors with the viral clearance or persistence. A
strong immune system leads to natural clearance of
the virus (11, 12). Ethnic differences also contribute
in natural clearance of HCV infection suggesting the
involvement of host genetics (13). IL28B, also known
as interferon k (IFN-k3), belongs to type III IFNs.
The three members of this family: IFN-k1, IFN-k2
and IFN-k3, are also known as IL29, IL28A and
IL28B respectively. The signalling pathway of IFN-k
diverges from IFN-a and IFN-b by using the IL28-
R/IL-10R receptor complex which are expressed on
hepatocytes and epithelial cells (14). Antiviral activ-
ity of IFN-k is less effective than IFN-a, however,
IFN-k possesses a critical role in the host immune
system against viruses in particular (15–17). Gen-
ome-wide association studies (GWAS) have dis-
closed some important SNPs in vicinity of IL28B
gene that are strongly linked with spontaneous clear-
ance of HCV infection and treatment response (18–
21). The results of these studies were also validated
by several other worldwide studies among different
ethnic groups (22). The two major SNPs of the
IL28B genes, rs12979860 and rs8099917, are
acknowledged as the strongest predictor of natural
clearance and treatment response. It has also been
shown that both SNPs are in linkage disequilibrium
and exhibits significant ethnic diversity (18, 19, 21).
The treatment-favorable allele for IL28B rs12979860
is ‘C’ and ‘T’ for IL28B rs8099917. These small
genetic variations are also reported to influence
IL28B mRNA expression and has possible role in
the regulation of intra-hepatic expression of inter-
feron stimulated genes (ISGs) (19, 20).
Hepatitis C virus infection is the leading cause of
liver transplantation (LT) in the Western world (23).
In the last two decades, the post-transplant survival
rate has markedly increased. However, HCV recur-
rence and cirrhosis occurs in almost 30% of patients
within 5 years post-transplantation (24). The sus-
tained virological response (SVR) in recurrent HCV
patients with the setting of liver transplantation is
significantly lower (20–45%) than for non-trans-
planted patients (25–27). Therefore, the predictive
biomarkers of successful liver transplantation are
essential. A recent meta-analysis study has shown a
significant association of genetic variants of IL28B,
rs12979860CC and rs8099917TT with high SVR and
graft survival rate in recurrent HCV patients treated
with PEG-IFN and ribavirin. Moreover, there is
reported independent association of HCV genotypes
with high SVR and graft survival rate in liver trans-
planted patients possessing treatment-favorable
IL28B rs12979860CC genotype (28).
2 © 2015 APMIS. Published by John Wiley & Sons Ltd
Worldwide studies have also revealed that associ-
ation of disease-specific SNPs are mostly dependent
on ethnicity (22). The association between IL28B
SNPs and HCVG3, the most dominant HCV geno-
type in Pakistan, is still controversial (29, 30). Thus,
the current study was conducted to find any corre-
lation of IL28B genetic variants (rs12979860 and
rs8099917) and interferon plus ribavirin treatment
of HCV infection in Pakistani population.
MATERIALS AND METHODS
Subjects
The study was carried out in the Saidu Teaching Hospital,
the Gambat Institute of Medical Sciences and Islamabad.
186 CHC patients: 90 from Saidu and 96 from Gambat,
and 120 healthy control subjects from Islamabad were ini-
tially recruited in the study. However, CHC patients with
HBV or HIV, liver cirrhosis, decompensated liver, hepato-
cellular carcinoma and incomplete planned treatment were
excluded in the study. This left a total of 140 CHC
patients: 75 from Saidu and 65 from Gambat. Healthy
control subjects were all negative for hepatitis B and C
virus infection.
All the enrolled patients were followed up for a mini-
mum of 6 months post-treatment and grouped into two,
SVRs and NRs. SVR was defined as a patient who was
aviremic, both by real-time PCR and nested RT-PCR,
6 months after the completion of planned treatment per-
iod. NRs were CHC patients positive for HCV RNA at
any stage, 6 months after the end of therapy.
The study was approved by the ethics committee of the
National University of Sciences and Technology (NUST).
Subjects written informed consent was obtain before
recruitment and genetic testing for HCV and IL28B geno-
types.
HCV genotyping
HCV RNA was extracted by QIAamp RNA extraction kit
(Qiagen, Hilden, Germany) in accordance with the manu-
facturer’s guidelines. About 10 lL of HCV RNA was used
for cDNA synthesis by reverse transcription using AB Ve-
riti 96 well thermocycler. The total volume of the reaction
mixture was 20 lL containing 20 units of Moloney murine
leukaemia virus reverse transcriptase enzyme (M-MLV
RTase Fermentas), 1x M-MLV buffer, 400 lM dNTPs, 10
units RNase inhibitor (Fermentas), 1.87 lL RNase-free
water and 20 pM specific antisense primer. The sequence
of antisense primer was: 5́ -GAGACGGGTATAGTACCC
CATGAGAGTCGGC-3́ . The PCR reaction for the
cDNA synthesis was as follow: Incubation at 37 °C for
55 min followed by 95 °C for 5 min. The synthesized
cDNA was stored at 4 °C.
First round PCR (Genotyping)
The first round PCR was performed with 4 ll of the
cDNA with the following primer sequences: Forward
primer 5́ -GGGAGGTCTCGTAGACCGTGCACCATG-3́
 IL28B GENETIC VARIANTS AND HCV INFECTION
and reverse primer 5́ -GAGACGGGTATAGTACCCCAT
GAGAGTCGGC-3́ . The PCR mixture was 20 lL
containing 2 units of Taq polymerase enzyme (Fermentas),
2x M-MLV buffer, 200 lM dNTPs, 3 mM MgCl2, 8.2 lL
RNase-free water, 20 pM of each primer (Forward and
Reverse). PCR condition was as follows: denaturation at
94 °C for 04 min, 25 cycles at 94 °C for 45 s, 52 °C for
45 s, 72 °C for 55 s and final extension at 72 °C for
7 min.
Second round PCR (Genotyping)
Two reaction mixtures: Mix 1 and Mix 2, from the first
round genotyping was amplified using the primers as
shown in Table 1. Mix 1 contained primers for HCV sub-
genotype 1b, 3b, 2a and 2b while Mix 2 contained primers
for HCV sub-genotype 1a, 3a, 5a, 6a and 4. 20 µl of each
mix was used for the reaction. The PCR mixture was as
follows: 2 units of Taq polymerase enzyme (Fermentas,
Vilnius, Lithuania), 2x M-MLV buffer, 200 lM dNTPs,
3 mM MgCl2, 3.2 lL RNase-free water, 20 pM of each
primer and 5 lL of template from first round PCR prod-
uct. The PCR reaction was as in the first round PCR
genotyping. For determination of specific HCV genotypes,
3% agarose gel electrophoresis was carried on the final
PCR product along with a standard 100 bp DNA marker
(Fermentas) and visualized under UV light of the gel doc
system (Wealtec) as shown in Fig. 1A.
Genotyping of IL28B
About 5 mL of venous blood sample was collected from
each subject into EDTA tube. Genomic DNA was
extracted using Genome DNA extraction kit (Invitrogen,
California, USA; Cat no. 1820-02) according to manufac-
turer’s instructions and quantified using Nanodrop (Ep-
pendorf Biophotometer, Germany). AS-PCR and RFLP-
PCR were employed for the genetic testing of IL28B
rs12979860 polymorphism whereas for IL28B rs8099917,
only RFLP-PCR was used. Both of these techniques (AS-
PCR and RFLP-PCR) are regularly used in the study of
SNPs and proved to be dependable (31, 32). The primers
used for the genetic testing are shown in Table 1. IL28B
amplification was carried out in 25 lL reaction mixture
containing 100–500 ng DNA, 2.5 mm MgCl2 (Fermentas),
10 pM of each primer, 200 mm dNTP’s (Fermentas), 2x
PCR buffer (Fermentas), 2 units of Taq DNA polymerase
(Fermentas) and RNase-free water. The PCR reaction was
Table 1. Primers for HCV and IL28B genotyping
Name Mix 1 primers
S7 AGACCGTGCACCATGAGCAC
S2a AACACTAACCGTCGCCCACAA
G1b CCTGCCCTCGGGTTGGCTAAG
G2a CACGTGGCTGGGATCGCTCC
G2b GGCCCCAATTAGGACGAGAC
G3b CGCTCGGAAGTCTTACGTAC
IL28B Forward primers
rs8099917 RFLP-PCR GTGCATATGTTTTCTGAC
rs12979860 RFLP-PCR CCAGGGCCCCTAACCTCTGCA
rs12979860 AS-PCR AGGGAGCTCCCCGAAGGCGC
– –
© 2015 APMIS. Published by John Wiley & Sons Ltd
as follows: long denaturation at 95 °C for 5 min, 35 cycles
of denaturation at 95 °C for 30 s, annealing at 68 °C (for
rs12979860 AS-PCR), 66 °C (for rs12979860 RFLP-PCR),
58 °C (for rs8099917 RFLP-PCR) for 30 s and extensions
at 72 °C for 40 s. The final extension was carried out at
72 °C for 10 min. The AS-PCR product of rs12979860 was
run on 3% agarose gel along with 100 bp ladder (Fermen-
tas) and visualized under Wealtec gel doc system (Fig. 1B).
RFLP-PCR products of rs12979860 and rs8099917
polymorphisms were further digested with restriction
endonucleases: BstU-I (New England Bio-labs, Hitchin,
UK) and BseMI (BsrDI) (Fermentas), respectively, by
incubation at 65 °C for 4 h. About 10 lL of the digested
product was analysed on 3% agarose gel along with
100 bp ladder (Fermentas) and observed by Wealtec gel
doc system (Fig. 1C, D respectively).
Statistical analysis
Statistical analysis of the data was performed using SPSS soft-
ware version 13. Hardy–Weinberg equilibrium was applied
to find the expected distribution of IL28B genotypes. Pear-
son chi-square test was applied on IL28B genotypes to find
the association of any genotype with treatment response or
spontaneous clearance of HCV infection. The independent
T-test was applied on SVR and NR groups to find the effect
of age or baseline viral load on interferon-based therapy of
HCV infection. The Phi coefficient test was applied on SVR
and NR groups to find an association between gender and
interferon-based therapy. A two-tailed p-value ≤ 0.05 was
considered to be statistically significant.
RESULTS
The data for gender, age, viral titres, HCV and
IL28B genotypes are summarized in Table 2.
Although the mean viral titre were significantly
higher in the NR group than the SVR group, but it
was not statically significant (p = 0.241).
Distribution of HCV sub-genotypes
The distribution of HCV sub-genotypes is shown in
Fig. 2A. The majority of patients were infected with
HCV sub-genotype 3a (56.4%; n = 79/140) and
Name Mix 2 primers
S7 AGACCGTGCACCATGAGCAC
G1a GGATAGGCTGACGTCTACCT
G3a GCCCAGGACCGGCCTTCGCT
G4 CCCGGGAACTTAACGTCCAT
G5a GAACCTCGGGGGGAGAGCAA
G6a GGTCATTGGGGCCCCAATGT
Reverse primers
– GAGGCCCCTCACCCATGC
– GGGAGCGCGGAGTGCAATTCA
– AGGGAGCTCCCCGAAGGCGT
– CCTATGTCAGCGCCCACAATTCCCA
3
 IMRAN et al.

A C

B D

Fig. 1. Agarose gel electrophoresis patterns for HCV genotypes and genetic variations of IL28B gene. (A) Analysis of
genotypes of five CHC patients. Patient’s numbers are represented by ‘Numerals’. Bands in lane number 1 and 5 represent
HCV genotype 2a (fragment size190 bp, in Mix1). Lane number 3 and 4 indicate HCV genotype 3a (Size 232 bp, in Mix
2). Lane 6 represents genotype 3b (Fragment size 176 bp in Mix 1). (B) Agarose gel representing allele-specific PCR ampli-
fication of IL28B rs12979860 polymorphism of two individuals. The first individual represented by lane 1 and 2 is homozy-
gous for T allele (band size 190 bp). The second individual represented by lane 3 and 4 is heterozygous. (C) Digital print
out of gel representing RFLP-PCR amplification of IL28B rs12979860 polymorphism of three individuals. Lane 1 repre-
sents homozygous CC individual (band size 109 bp). Lane 2 represents homozygous TT individual (band size 139 bp).
Lane 3 represents heterozygous CT individual (bands size 109 bp+139 bp). (D) Electrophoresis pattern of RFLP-PCR of
detection of IL28B rs8099917 polymorphism in three different individuals. Lane 1 represents homozygous TT individual
(band size 430 bp). Lane 2 represents homozygous GG individual (band size 175 bp+255 bp). Lane 3 represents heterozy-
gous TG individual (band size 430 bp+255 bp+175 bp).

Table 2. Demographics of the patients and healthy controls

Variables SVRs NRs Healthy Controls p Values3
Numbers 115 25 120 –
Age1 36.28  12.11 37.32  8.24 25.11  8.21 0.608
Gender 72 male; 43 female 11 male; 14 female 60 male; 60 female 0.086
Baseline viral load2 1.11 9 105 5.64 9 105 – 0.241
(0.045 9 105–54.7 9 105 (0.4 9 105–98.7 9 105)
rs 12979860 genotype
CC 47 4 48 0.019
CT 53 15 58 0.207
TT 15 6 14 0.164
rs 8099917 genotype
TT 41 6 39 0.264
TG 55 13 64 0.705
GG 19 6 17 0.376
1
Age is taken as mean  SD.
2
Viral load (IU/mL) is taken as median and ranges.
3
p values are calculated by Pearson chi-square test for treatment responders and non-responders group

sub-genotype 3b (15%; n = 21/140). The response Distribution of IL28B genotypes

rates to interferon plus ribavirin treatments were
The prevalence of IL28B genetic variants
higher in HCV sub-genotypes 3a (91%; n = 72/79)
rs12979860 and rs8099917 was evaluated in CHC
and 3b (86%; n = 18/21) compared to HCV sub-
patients and healthy controls. The allelic
genotype 1a (57%; n = 8/14), as shown in Fig. 2B.

4 © 2015 APMIS. Published by John Wiley & Sons Ltd

 IL28B GENETIC VARIANTS AND HCV INFECTION

A distributions of the two SNPs were according to

Hardy–Weinberg equilibrium. The prevalence of
IL28B rs12979860 CC, CT, TT genotypes in
healthy controls and CHC patients was 40%
(n = 48/120), 48% (n = 58/120), 12% (n = 14/120),
and 36% (n = 51/140), 49% (n = 68/140), 15%
(n = 21/140) respectively. Pearson chi-square analy-
sis of the data showed that there was no significant
variation in distribution of IL28B rs12979860 geno-
types in CHC patients and healthy controls
(Fig. 3A). The results of AS-PCR of IL28B
rs12979860 polymorphism were completely matched
with RFLP-PCR analysis. Similarly, the distribu-
tion of IL28B rs8099917 genetic variation in
healthy controls and CHC patients was 32%
B (n = 39/120), 53% (n = 64/120), 14% (n = 17/120)
and 34% (n = 47/140), 48% (n = 68/140), 18%
(n = 25/140) respectively. Statistical analysis of the
data showed that the prevalence of IL28B
rs8099917 genotypes in both groups was non-signif-
icant (Fig. 3B).

Influence of IL28B SNPs on interferon-based therapy

Fig. 2. (A) Percentage distribution of HCV genotypes. (B)
Percentage response rate of different HCV genotypes to
interferon plus ribavirin treatment.
To explore any association of IL28B genetic varia-
tions with interferon-based therapy of HCV infec-
tion, the prevalence of IL28B genotypes was
studied in the SVR and NR groups of CHC
patients. The occurrence of IL28B rs12979860CC,
CT and TT genotypes in the SVR and NR groups
was 41% (n = 47/115), 46% (n53/115), 13%

A B

C D

Fig. 3. Distribution of IL28B in different groups. (A) Percentage distribution of IL28B rs12979860 genotypes in healthy
controls and CHC patients. (B) Percentage frequencies of IL28B rs8099917 genotypes in healthy controls and CHC
patients. (C) Percentage distribution and p values of IL28B rs12979860 genotypes in sustained virological responders and
non-responders. (D) Percentage frequencies and p values of IL28B rs8099917 genotypes in sustained virological responders
and non-responders.

© 2015 APMIS. Published by John Wiley & Sons Ltd 5

 IMRAN et al.
(n = 15/115) and 16% (n = 4/25), 60% (n = 15/25),
24% (n = 6/25) respectively. The Pearson chi-
square test revealed a positive association
(p = 0.019) between CHC patients with genotype
IL28B rs12979860CC and treatment response as
shown in Fig 3C. The treatment response of IL28B
rs12979860CT and TT genotypes in SVRs and NRs
groups was statistically insignificant (Table 2).
There was no association of any genotype of
IL28B rs8099917 with interferon-based therapy of
HCV infection (fig. 3D). The distribution of treat-
ment-favorable IL28B rs8099917TT genotype in
SVRs and NRs was 36% (n = 41/115) and 24%
(n = 6/25), respectively, but was not statistically sig-
nificant (p = 0.264).
DISCUSSION
Interferon-based therapy of HCV infection is costly
and comes with many side effects. It is therefore
imperative to have some biological markers that
can aid in the prediction of treatment outcome of
HCV infection with interferon-based therapy. In
the past, only HCV genotypes and baseline viral
loads were involved in defining the treatment
option and duration (5, 33–35). Recently, GWAS
have demonstrated genetic mutations in IL28B
region that are strongly correlated with natural
clearance and treatment outcomes of HCV infec-
tion (18–20). In 2011, the analysis of IL28B genetic
mutations was also included in treatment guidelines
for HCV infection in the Western world (34).
The present study focuses on evaluating the poten-
tial use of HCV genotypes, viral load and IL28B
genetic mutations as potential predictive markers in
interferon-based therapy for HCV infection. Paki-
stan is located in South Asia. It is the sixth most pop-
ulated country in the world with four provinces.
Khyber Pakhtunkhwa and Sindh are the two prov-
inces that were selected for this study. Our study
showed the HCV sub-genotype 3a as the most preva-
lent HCV genotype (56.4%; n = 79/140) with the
highest response to interferon-based therapy (91%;
n = 72/79). These results are in concordance with the
previous studies (9, 36).
The baseline viral load of the NR group
(median = 5.64 9 105 IU/mL) of CHC patients was
higher than that of the SVR group (median = 1.11 9
105 IU/mL), but it was not statically significant
(p = 0.241). Previous studies have indicated that,
patients possessing lower baseline viral load are more
likely to achieve persistent response as compared to
patients possessing higher baseline viral load (37).
Age is an important factor that influences the treat-
ment response to combinational therapy for HCV
6 © 2015 APMIS. Published by John Wiley & Sons Ltd
infection. CHC patients with lower age are more
likely to attain higher response to combinational
therapy than older CHC patients (38, 39). The
mean  SD age, in our study, of the SVR group
was lower (36.28  12.12) compared to the NR
group (37.32  8.24), but not statistically different
(p = 0.608).
The most common IL28B rs12979860 genotype
was CT followed by CC and TT in both patient
and healthy control groups. There were no signifi-
cant variations in distributions of the IL28B
rs12979860 genotypes in both groups. However, it
was observed that, IL28B rs12979860CC genotype
favours interferon-based therapy for HCV infection
(p = 0.019). Worldwide studies from different ethnic
groups also reported a strong association of IL28B
rs12979860CC genotype in achieving SVR (19–21).
It has been reported that, one of the major reasons
for the difference in treatment response to combina-
tional therapy of HCV infection between Ameri-
cans of African and European ancestry is the
unequal distribution of IL28B rs12979860 polymor-
phism. Individuals of European ancestry have a
higher prevalence of the IL28B rs12979860CC
genotype and possessed better treatment response
as compared to African Americans. Not all, it has
been found that, individuals from East Asia have
better treatment response to combinational therapy
of HCV infection than individuals from European
ancestry (40). The study of Iran (Middle East) and
India (South Asia) demonstrated a high prevalence
of IL28B rs12979860CC in their population and its
positive associations with interferon-based therapy
of HCV infection (41, 42). In both countries,
HCVG3 is one of the major genotypes.
Regarding IL28B rs8099917 polymorphism, the
major genotype was TG followed by GG and TT.
There was no association of IL28B rs8099917TT
genotype with the persistent treatment response to
HCV infection (p = 0.264). IL28B rs8099917 is also
worldwide studied and known for its positive asso-
ciation with response to interferon-based therapy
against HCV genotype 1 and 4 (43, 44). The associ-
ation of this particular SNP is more likely to be
dependent on HCV genotype (45). Moghaddam
et al. showed that the treatment-favorable geno-
type, IL28B rs8099917TT is linked with high early
viral response but not associated with persistent
response to interferon-based therapy of HCVG3
infection (46). Also, a study of Sarrazin et al. dem-
onstrated lack of association between IL28B
rs8099917TT and treatment response to HCV G3
infection (47). However, the same study demon-
strated a significant positive association of the
IL28B rs12979860CC genotype and treatment
response against HCVG3 infection. The most prob-
 IL28B GENETIC VARIANTS AND HCV INFECTION
able reason for no association of the IL28B
rs8099917TT genotype and treatment response to
HCV infection in our study may be attributed to
high distribution of HCVG3 in Pakistani popula-
tion (71.4%).
In conclusion, HCV genotypes and IL28B
rs12979860 are predictive markers for the efficiency
of interferon plus ribavirin combinational therapy
of HCV infection. We recommend the test for these
biological markers before start of interferon-based
therapy in Pakistani population.
Financial support in part by National University of Sci-
ences and Technology (NUST), H-12, Islamabad, Pakistan
and Higher education commission of Pakistan is highly
acknowledged.
REFERENCES
1. Alter HJ, Purcell RH, Shih JW, Melpolder JC,
Houghton M, Choo Q-L, et al. Detection of antibody
to hepatitis C virus in prospectively followed transfu-
sion recipients with acute and chronic non-A, non-B
hepatitis. N Engl J Med 1989;321:1494–500.
2. Shepard CW, Finelli L, Alter MJ. Global epidemiol-
ogy of hepatitis C virus infection. Lancet Infect Dis
2005;5:558–67.
3. Younossi Z, Kallman J, Kincaid J. The effects of
HCV infection and management on health-related
quality of life. Hepatology 2007;45:806–16.
4. Kieffer TL, Sarrazin C, Miller JS, Welker MW, Fores-
tier N, Reesink HW, et al. Telaprevir and pegylated
interferon–alpha-2a inhibit wild-type and resistant
genotype 1 hepatitis C virus replication in patients.
Hepatology 2007;46:631–9.
5. Fried MW, Shiffman ML, Reddy KR, Smith C, Mari-
nos G, Goncßales FL Jr, et al. Peginterferon alfa-2a
plus ribavirin for chronic hepatitis C virus infection.
N Engl J Med 2002;347:975–82.
6. Hadziyannis S, Sette H Jr, Morgan T, Balan V, Diago
M, Marcellin P, et al. PEGASYS International Study
Group: Peginterferon-alpha2a and ribavirin combina-
tion therapy in chronic hepatitis C: a randomized
study of treatment duration and ribavirin dose. Ann
Intern Med 2004;140:346–55.
7. Zeuzem S, Buti M, Ferenci P, Sperl J, Horsmans
Y, Cianciara J, et al. Efficacy of 24 weeks treatment
with peginterferon alfa-2b plus ribavirin in patients
with chronic hepatitis C infected with genotype 1
and low pretreatment viremia. J Hepatol
2006;44:97–103.
8. Shiffman ML. Hepatitis C virus therapy in the direct
acting antiviral era. Curr Opin Gastroenterol
2014;30:217–22.
9. Idrees M, Riazuddin S. Frequency distribution of hep-
atitis C virus genotypes in different geographical
regions of Pakistan and their possible routes of trans-
mission. BMC Infect Dis 2008;8:69.
© 2015 APMIS. Published by John Wiley & Sons Ltd
10. Idrees M, Riazuddin S. A study of best positive pre-
dictors for sustained virologic response to interferon
alpha plus ribavirin therapy in naive chronic hepatitis
C patients. BMC Gastroenterol 2009;9:5.
11. Cooper S, Erickson AL, Adams EJ, Kansopon J, Wei-
ner AJ, Chien DY, et al. Analysis of a successful
immune response against hepatitis C virus. Immunity
1999;10:439–49.
12. Rehermann B, Nascimbeni M. Immunology of hepati-
tis B virus and hepatitis C virus infection. Nat Rev
Immunol 2005;5:215–29.
13. Thomas DL, Astemborski J, Rai RM, Anania FA,
Schaeffer M, Galai N, et al. The natural history of
hepatitis C virus infection. J Am Med Assoc
2000;284:450–6.
14. Doyle SE, Schreckhise H, Khuu-Duong K, Henderson
K, Rosler R, Storey H, et al. Interleukin-29 uses a
type 1 interferon-like program to promote antiviral
responses in human hepatocytes. Hepatology
2006;44:896–906.
15. Ank N, West H, Bartholdy C, Eriksson K, Thomsen
AR, Paludan SR. Lambda interferon (IFN-k), a type
III IFN, is induced by viruses and IFNs and displays
potent antiviral activity against select virus infections
in vivo. J Virol 2006;80:4501–9.
16. Coccia EM, Severa M, Giacomini E, Monneron D,
Remoli ME, Julkunen I, et al. Viral infection and
Toll-like receptor agonists induce a differential expres-
sion of type I and k interferons in human plasmacy-
toid and monocyte-derived dendritic cells. Eur J
Immunol 2004;34:796–805.
17. Thomas DL, Thio CL, Martin MP, Qi Y, Ge D,
O’hUigin C, et al. Genetic variation in IL28B and
spontaneous clearance of hepatitis C virus. Nature
2009;461:798–801.
18. Ge D, Fellay J, Thompson AJ, Simon JS, Shianna
KV, Urban TJ, et al. Genetic variation in IL28B pre-
dicts hepatitis C treatment-induced viral clearance.
Nature 2009;461:399–401.
19. Suppiah V, Moldovan M, Ahlenstiel G, Berg T, Welt-
man M, Abate ML, et al. IL28B is associated with
response to chronic hepatitis C interferon-a and riba-
virin therapy. Nat Genet 2009;41:1100–4.
20. Tanaka Y, Nishida N, Sugiyama M, Kurosaki M,
Matsuura K, Sakamoto N, et al. Genome-wide associ-
ation of IL28B with response to pegylated interferon-
a and ribavirin therapy for chronic hepatitis C. Nat
Genet 2009;41:1105–9.
21. Rauch A, Kutalik Z, Descombes P, Cai T, Di Iulio J,
Mueller T, et al. Genetic variation in IL28B is associ-
ated with chronic hepatitis C and treatment failure: a
genome-wide association study. Gastroenterology
2010;138:1338–45.
22. Mangia A, Thompson AJ, Santoro R, Piazzolla V,
Tillmann HL, Patel K, et al. An IL28B polymor-
phism determines treatment response of hepatitis C
virus genotype 2 or 3 patients who do not achieve a
rapid virologic response. Gastroenterology 2010;139:
821–7.
23. Adam R, McMaster P, O’Grady JG, Castaing D, Kle-
mpnauer JL, Jamieson N, et al. Evolution of liver
transplantation in Europe: report of the European
Liver Transplant Registry. Liver Transpl 2003;9:1231–
43.
7
 IMRAN et al.
24. Watt K, Veldt B, Charlton M. A practical guide to
the management of HCV infection following liver
transplantation. Am J Transplant 2009;9:1707–13.
25. Ackefors M, Nystr€ om J, Wernerson A, Gjertsen H,
S€onnerborg A, Weiland O. Evolution of fibrosis dur-
ing HCV recurrence after liver transplantation–influ-
ence of IL-28B SNP and response to peg-IFN and
ribavirin treatment. J Viral Hepatitis 2013;20:770–8.
26. H€ornfeldt E, Gjertsen H, Weiland O. High adherence
with a low initial ribavirin dose in combination with
pegylated-IFN alpha-2a for treatment of recurrent
hepatitis C after liver transplantation. Scand J Infect
Dis 2008;40:259–65.
27. Angelico M, Petrolati A, Lionetti R, Lenci I, Burra P,
Donato MF, et al. A randomized study on Peg-inter-
feron alfa-2a with or without ribavirin in liver trans-
plant recipients with recurrent hepatitis C. J Hepatol
2007;46:1009–17.
28. Zhang L, Lu Q, Yang Z, Wang X, Cai L, Liu X,
et al. Association of rs12979860 and rs8099917 poly-
morphisms near IL28B with SVR in hepatic allograft
recipients with HCV recurrence undergoing PEG-
IFN/RBV therapy: a meta-analysis. Hum Immunol
2014;75:1268–75.
29. Rembeck K, Alsio A, Christensen PB, Farkkila M,
Langeland N, Buhl MR, et al. Impact of IL28B-
related single nucleotide polymorphisms on liver histo-
pathology in chronic hepatitis C genotype 2 and 3.
PLoS ONE 2012;7:13.
30. Rembeck K, Westin J, Lindh M, Hellstrand K, Nork-
rans G, Laging M. Association between interleukin-
28B-related genetic variants and liver histopathology
differs between hepatitis C virus genotypes. Hepatolo-
gy 2012;56:394.
31. Imran M, Manzoor S, Khattak NM, Tariq M, Khalid
M, Javed F, et al. Correlation of OAS1 Gene Poly-
morphism at Exon 7 Splice Accepter Site with Inter-
feron-Based Therapy of HCV Infection in Pakistan.
Viral Immunol 2014;27:105–11.
32. Imran M, Manzoor S, Parvaiz F. Predictive Potential
of IL-18 607 and Osteopontin 442 Polymorphism
in Interferon-Based Therapy of HCV Infection in the
Pakistani Population. Viral Immunol 2014;27:404–11.
33. Ghany MG, Strader DB, Thomas DL, Seeff LB.
Diagnosis, management, and treatment of hepatitis C:
an update. Hepatology 2009;49:1335–74.
34. McCaughan G, Omata M, Amarapurkar D, Bowden
S, Chow W, Chutaputti A. Asian Pacific Association
for the Study of the Liver (APASL) Hepatitis C
Working Party. Asian Pacific Association for the
Study of the Liver consensus statements on the diag-
nosis, management and treatment of hepatitis C virus
infection. J Gastroenterol Hepatol 2007;22:615–33.
35. Ismail MH. Prediction of sustained virologic responses
to combination therapy of pegylated interferon-a and
ribavirin in patients with chronic hepatitis C infection.
J Fam Commun Med 2013;20:35.
36. Imran M, Manzoor S, Ashraf J, Khalid M, Tariq M,
Khaliq HM, et al. Role of viral and host factors in
interferon based therapy of hepatitis C virus infection.
Virol J 2013;10:299.
37. Aziz H, Athar MA, Murtaza S, Irfan J, Waheed Y,
Bilal I, et al. Predictors of response to antiviral ther-
8 © 2015 APMIS. Published by John Wiley & Sons Ltd
apy in patients with chronic hepatitis C from Paki-
stani population. Chin Med J 2011;124:1333–7.
38. Lindh M, Arnholm B, Eilard A, F€ arkkil€
a M, Hell-
strand K, Lagging M, et al. Hepatitis C treatment
response kinetics and impact of baseline predictors. J
Viral Hepatitis 2011;18:400–7.
39. McHutchison JG. The role of genetic markers in hep-
atitis C virus therapy: a major step for individualized
care. Liver International 2011;31:29–35.
40. Yan KK, Guirgis M, Dinh T, George J, Dev A,
Lee A, et al. Treatment responses in Asians and
Caucasians with chronic hepatitis C infection.
World Journal of Gastroenterology: WJG
2008;14:3416.
41. Sivaprasad S, Rao PN, Gupta R, Ashwini K, Reddy
DN. The distribution of genotype and allelic fre-
quency of IL28B gene polymorphism in Andhra Pra-
desh, India. Journal of Clinical and Experimental
Hepatology 2012;2:112–5.
42. Sharafi H, Pouryasin A, Alavian SM, Behnava B,
Keshvari M, Mehrnoush L, et al. Development and
validation of a simple, rapid and inexpensive PCR-
RFLP method for genotyping of common IL28B
polymorphisms: a useful pharmacogenetic tool for
prediction of Hepatitis C treatment response. Hepat
Monthly 2012;12:190–5.
43. Antaki N, Bibert S, Kebbewar K, Asaad F, Baroudi
O, Alideeb S, et al. IL28B polymorphisms predict
response to therapy among chronic hepatitis C
patients with HCV genotype 4. J Viral Hepatitis
2013;20:59–64.
44. Fischer J, B€ ohm S, Scholz M, M€ uller T, Witt H,
George J, et al. Combined effects of different interleu-
kin-28B gene variants on the outcome of dual combi-
nation therapy in chronic hepatitis C virus type 1
infection. Hepatology 2012;55:1700–10.
45. Jia Z, Ding Y, Tian S, Niu J, Jiang J. Test of IL28B
polymorphisms in chronic hepatitis C patients treated
with PegIFN and ribavirin depends on HCV geno-
types: results from a meta-analysis. PLoS ONE
2012;7:e45698.
46. Moghaddam A, Melum E, Reinton N, Ring-Larsen
H, Verbaan H, Bjøro K, et al. IL28B genetic variation
and treatment response in patients with hepatitis C
virus genotype 3 infection. Hepatology 2011;53:746–
54.
47. Sarrazin C, Susser S, Doehring A, Lange CM,
Muller T, Schlecker C, et al. Importance of IL28B
gene polymorphisms in hepatitis C virus genotype
2 and 3 infected patients. J Hepatol 2011;54:415–
21.
SUPPORTING INFORMATION
Additional Supporting Information may be found
in the online version of this article:
Table S1. Features of SVR patients.
Table S2. Features of NRs patients.