Research Article

Predictive value of IL-28B rs12979860

variants for peg-IFN, sofosbuvir plus ribavirin
treatment of HCV infection in Pakistani
population
Qaisar Ali1 , Irfan Kalam1 , Sajjad Ullah1 , Arshad Jamal1 , Muhammad Imran2 , Shafi Ullah,
Khurshid Iqbal1 & Ahmed B Waqar*,1
1
Department of Medical Laboratory Sciences, Faculty of Health Allied Sciences Imperial College of Business Studies, Lahore,
Pakistan
2
Department of Microbiology, University of Health Sciences, Lahore, Pakistan
*Author for correspondence: drabwaqar@yahoo.com

Aim: The correlation of IL28-B genetic variants (rs12979860) with combinational therapy (peg-interferon,
sofosbuvir plus ribavirin) of hepatitis C virus infection were studied in 154 chronic hepatitis C patients.
Methods & results: The sustained virological response for efficient antiviral regimen was achieved in
75.32% treated individuals. Three genotypes of rs12979860 (CC, CT and TT) were compared both in sus-
tained virological response and nonresponders groups (p = 0.25, p ≤ 0.001, p = 0.10, respectively). CT
genotype demonstrated a significant correlation (p ≤ 0.001) in both groups with higher positive predic-
tive value (81.55%). Conclusion: IL28 polymorphism and positive predictive value may be considered as
the markers for the evaluation of the effectiveness of the treatment regimen. Further clinical trials are
recommended to verify the role of IL28-B in hepatitis C virus treatment.

First draft submitted: 1 February 2018; Accepted for publication: 29 June 2018; Published online:
1 November 2018

Keywords: chronic hepatitis C • IL28-B • interferon • NR • polymorphism • predictive value • restriction limit •
sofosbuvir • SVR • triple combination therapy

Hepatitis C virus (HCV) is one of the viral pathogens which cause liver disease. It is a social and economic
health burden infecting about 170–200 million people worldwide [1–4]. Persistent HCV infection can progress to
chronic hepatic disease leading to cirrhosis, fibrosis, hepatocellular carcinoma, liver failure and ultimate death [5].
Approximately, one-fifth of chronic hepatitis C (CHC) subjects lead to cirrhosis in about 20 years [6]. The standard
treatment of HCV infection till 2011 was pegylated (peg)-interferon and ribavirin for 24 weeks [7–9]. However,
the treatment was associated with a lot of adverse side effects which results in treatment discontinuation in some
subjects [10,11].
In 2014, a nucleotide analog (sofosbuvir) was tested in CHC patients to attain enhanced sustained virological
response (SVR) rate [12–14]. Due to high cost and more adverse effects of different available treatment options
of HCV infection, sofosbuvir is approved as a probable antiviral drug in combination with peg-interferon and
ribavirin to treat HCV infection [15–17]. Sofosbuvir (GS-7977) is HCV nonstructural protein 5B inhibitor which is
used as an oral drug. It directly incorporates in the synthesizing chain of nucleotides leading to chain termination
during viral replication [18]. Thus inside the host hepatocyte, sofosbuvir is phosphorylated and transformed into
active nucleoside triphosphate which causes replication termination [19].
SNP’s near IL28-B gene has been suggested to be associated with treatment response to HCV infection world-
wide [20]. IL-28B alleles are present on chromosome 19q13 and are known to code a cytokine named IFN-λ3 [21].
This cytokine act as antiviral agent and provides a natural immunity against infection. The efficacy of this immu-
nity depends on different snap’s presents in the coding region of IL28-B which vary in different populations [22].
IL28-B rs12979860 genotypes CC, CT and TT showed different treatment responses which also varies in different

10.2217/pme-2018-0012 
C 2018 Future Medicine Ltd Per. Med. (2018) 15(6), 503–510 ISSN 1741-0541 503
Research Article Ali, Kalam, Ullah et al.

**
p = 0.02
***
p = < 0.001 p = 0.25 p = 0.10

Responder

Non-responder

54.5%
14.3%
12.3% 9.7% 6.5% 2.6%

CT CC TT
IL28 rs 12979860 genotypes

p = 0.25
*** ***

p = < 0.001 p = 0.004

Responder

Non-responder
51.3%

24.0%
14.3%
10.4%

Male Female
Gender

Figure 1. Pearson χ2 test and independent t-test were used for the prediction of p-value among the responder and
nonresponder groups. (A) Shows distribution of rs12979860 polymorphism genotypes. (B) Demonstrates gender
contribution in both responders and nonresponders groups.
The result is presented as with mean p-value.

ethnic groups worldwide [23–25]. Studies have demonstrated that IL28-B rs12979860 CC genotype is significantly
associated with treatment response to combinational therapy of peg-IFN+ ribavirin (RBV) [23].
In Pakistan, the association of IL-28B polymorphism by taking peg-interferon and ribavirin in different groups
has already been reported. In this study, we investigated the association of triple combination therapy (sofosbuvir,
peg-interferon and ribavirin) with IL28-B rs12979860 in CHC subjects from the Pakistani population.

504 Per. Med. (2018) 15(6) future science group

 Predictive value of IL-28B rs12979860 for peg-IFN, sofosbuvir plus ribavirin treatment of HCV. Research Article

Chronic HCV patients treated with sofosbuvir + ribavirin or interferon + sofosbuvir + ribavirin (250)

Patients who failed to meet the inclusion

criteria were excluded (96)

Final enrolled patients of rs (12979860) with sofosbuvir-based therapy (154)

rs (12979860) CT genotype rs (12979860) CC genotype rs (12979860) TT genotype

patients 103 (66.9%) patients 37 (24.0%) patients 14 (9.1%)

SVR NR SVR NR SVR NR

84 (54.5%) 19 (12.3%) 22 (14.3%) 15 (9.7%) 10 (6.5%) 4 (2.6%)

Figure 2. Diagrammatic distribution of IL28 (rs12979860) genotypes with responders and nonresponders after treatment.
HCV: Hepatitis C virus; NR: Non responders; SVR: Sustained virological response.

M 1 2 3 4 5 6

Figure 3. The real-time polymerase chain reaction 200 bp

analysis shows an electrophoresis pattern of three 190 bp
genotypes. Lane M, 190 bp marker; Lane 1, homozygous 100 bp
C genotype; Lane 2, heterozygous C/T genotype; Lane 3,
homozygous T genotype of IL28-B gene.

Materials & methods

Patients & samples selection
A total of 154 individuals chronically infected with HCV, were included in the study and treated with triple
combination therapy, in other words, HCV nonstructural protein 5B nucleotide analog, sofosbuvir, peg-interferon
and ribavirin. This study was approved by the Institutional Ethical Review Board and written consent from each
patient was obtained. All the patients with HCV genotype 3 completed the 12 week course of triple combination
therapy. The study involved both treatment-naive and treatment-experienced CHC subjects that were randomly
selected. At the end of therapy, all the patients were categorized into two groups on the basis of treatment response,
the group of SVR included all those patients which serum possessed nondetectable virus (n = 116), while the group
of nonresponders (NRs) included all those CHC patients which serum possessed detectable virus (n = 38). The
salient features of patient’s treatment are summarized in Figure 4.

future science group www.futuremedicine.com 505

Research Article Ali, Kalam, Ullah et al.

Pakistani HCV patients treated with

sofosbuvir and interferon plus ribavirin therapy
(n = 154)

Treated with peg-interferon and sofosbuvir plus

ribavirin for 12 weeks (n = 154)

Responder (R) (n = 116) Non-responder (NR) (n = 38)

(75.3%) (24.7%)

Figure 4. Characteristics of hepatitis C virus-3 infected patients with treatment response.

HCV: Hepatitis C virus.

Quantitative analysis of HCV RNA

Blood samples from all enrolled CHC subjects were collected in EDTA vacutainers. Blood samples were briefly
centrifuged to get plasma. HCV RNA was extracted from plasma by using (Favor PrepTM viral Nucleic Acid
Extraction Kit) according to the manufacturer’s instructions. About 10 μl of extracted HCV RNA was used for the
synthesis of cDNA using AB Veriti 96-well thermocycler. The synthesized cDNA was used for HCV Quantification
by HCV Real-TM Quant (sacace biotechnologies, Como, Italy), on MJ Mini Personal Thermal Cycler Real-Time
PCR system (Bio-Rad, CA, USA) according to the manufacturer’s guidelines. The detection limit of viral RNA
was ≤50 IU/ml according to kit protocol.

Determination of IL28-B gene polymorphism

Blood was drawn from each patient and collected in EDTA tube and was further used for nucleic acid extrac-
tion. The DNA extraction was performed by non enzymatic salting out method [26]. IL-28B genotyping was
performed using a step-one real-time PCR system (Applied Bio-system, CA, USA). The 190bp DNA fragment
of IL28-B rs12979860 was amplified by using SYBR GreenER qPCR super MIX Universal kit (Bio Rad) . The
primer sequences used were; forward primer 1: 5 - AGGGAGCTCCCCGAAGGGGC -3 ; Forward primer 2: 5 -
AGGGAGCTCCCCGAAGGGGT-3 and one reverse primer: 5 - CCTATGTCAGCGCCCACAATTCCC -3 .
The total volume of PCR mixture was 20 μl containing 120–480 ng DNA template (1 μl), 1 μl of each primer
and 10 μl commercial super Mix containing Taq-polymerase, dNTPs, MgCl2, Taq buffer, Syber green fluorescent
dye. The PCR condition was as follow; initial denaturation at 95◦ C for 5 min followed by 35 cycles of denaturation
at 95◦ C for 30 s, annealing at 66◦ C for 30 s and extension at 72◦ C for 30 s. The final extension was performed at
72◦ C for 10 min.

Statistical analyses
The frequencies of different genotypes were calculated by direct counting. Categorical variables in different groups
were compared by using the χ2 test. All statistical analyses were done using SPSS 22. The independent t-test was
applied for the determination of continuous variation in both responders and NRs groups. p-value ≤ 0.05 was
considered as statistically significant.

Results
Study participants & treatment response
IL-28B polymorphism (rs12979860) genotypes were unambiguously assigned in all patients. Out of the 154
patients, 89 were males and 65 were females. At the end of the 12 week therapy, the patients with HCV RNA

506 Per. Med. (2018) 15(6) future science group

 Predictive value of IL-28B rs12979860 for peg-IFN, sofosbuvir plus ribavirin treatment of HCV. Research Article

Table 1. Demographic profile of responders and nonresponders.

Variables SVR (n = 116) NR (n = 38) Predictive value p-value
Age (Mean ± SD) 36.78 ± 10.46 39.58 ± 7.86 0.13
Gender
-Male 79 (51.3%) 22 (14.3%) ⬍0.001
-Female 37(24.0%) 16 (10.4%) 0.004
Genotypes
-CT 84 (54.5%) 19 (12.3%) 81.55% ⬍0.001
-CC 22 (14.3%) 15 (9.7%) 0.25
-TT 10 (6.5%) 4 (2.6%) 0.10
Total (n = 154) 116 (75.3%) 38 (24.7%) 0.02
† Ageis taken by mean ± SD, independent t-test is calculated as for p-value of age, spearman correlation was used for gender, pearson ␹ test used for genotypes.
2

NR: Nonresponder; SD: Standard deviation; SVR: Sustained virological response.

Table 2. Variables associated with predictve value in hepatitis C virus patients treated with sofosbuvir plus ribavirin
rs(12979860) genotypes PPV (%) NPV (%) Sensitivity (%) Specificity (%)
SVR at CT and CC 79.25 44.12 81.55 40.54
CT 81.55 37.25 72.41 50.00
CC 59.46 19.66 18.97 60.53
SVR: Sustained virological response; PPV: Positive predictive value; NPV: Negative predictive value.

less than 50 IU/ml were designated as responder’s participants of HCV genotype 3 infection. The mean age of
the patients was 37.60 ranging from 23 to 78 years. Table 1 summarizes the demographic characteristics of CHC
subjects. The SVR was achieved in 116 out of 154 (75.32%) patients who completed treatment course and 38
out of 154 (24.68%) patients were designated as NRs (Table 1). The SVR subjects were followed up to 6 months
after the end of therapy to confirm that no relapse occurs in them. All the SVR subjects were found to possess
nondetectable virus at the end of therapy.

Frequencies of IL28-B rs12979860 genotypes

The distribution of IL-28B rs12979860 CT genotype in SVR and NR group was 84 out of 116 (54.5%) and 19
out of 38 (12.3%) respectively (Figure 2). The prevalence of IL-28B rs12979860 CC genotype in SVR and NR
group was 22 out of 116 (14.3%) and 15 out of 38 (9.7%), respectively. The TT genotype is identified in 10 out
of 11 (6.5%) patients and 4 out of 38 (2.6%) patients in both SVR and NR groups, respectively (Table 1).
The electrophoresis pattern of IL28-B (rs12979860) genotypes is shown in Figure 3. The frequency of IL28-B
genotypes (i.e., CC, CT and TT) between responders (SVR) and NR were compared and showed that the frequency
of the CT genotype was significantly higher in SVR than NR groups (54.4 vs 12.3%; p < 0.001). The frequency
of the CC and TT genotypes of IL28-B polymorphism between SVR and NR groups showed a nonsignificant
difference CC = 14.3 versus 9.7% (p = 0.25) and TT = 6.5 versus 2.6% (p = 0.10), respectively with triple
combination therapy of HCV genotype 3 infected patients (Figure 1A).

Predictor of treatment response

We also studied some host factors that are associated with SVR and NR to the therapy regimen. Although, we did
not find any significant difference in age among the two groups, but we found significant statistical differences
in gender distribution of the two groups (51.3 vs 14.3%; p ≤ 0.001 and 24.0 vs 10.4%; p = 0.004), respectively
(Figure 1B). Interestingly those who got CT genotype in SVR group had a higher predictive value (81.55%; 95%
CI: 76.35–85.82%) when compared with the other genotypes CC and TT who did not attain predictive response
(Table 2).

Discussion
Sofosbuvir in combination with peg-interferon and ribavirin reflect minimal side effects with increased SVR in
HCV patients. Since 2014, this combination has been approved as a treatment of choice [27]. Numerous factors
affect the treatment of HCV patients, in other words, viral load, age, sex, BMI and co-infection. Likewise, The host

future science group www.futuremedicine.com 507

Research Article Ali, Kalam, Ullah et al.

genomic factors IL28-B polymorphism may affect the personalized treatment response. Recently, different studies
have reported SNP (rs12979860) located on chromosome 19 near IL28-B gene to be associated with SVR [28]. In
the current study, we analyzed the association of IL28-B (rs12979860) and triple combination therapy in CHC
subjects which were infected with HCVG3. Figure 1A shows three genotypes of SNP (12979860) of the IFN-λ3
gene. The overall distribution of IL28-B rs12979860 CT, CC and TT genotypes, in other words, both in SVR
and NR group was; 103 (66.9%), 37 (24.0%) and 14 (9.1%), respectively. Overall, preliminary study showed
SVR in 116 patients (75.3%). Moreover, gender differences exhibited a nonsignificant association between males
and females in responders and NRs groups (79 [51.3%], 37 [24.0%] vs (22 [14.3%], 16 [10.4%]; p = 0.25).
Furthermore, independent t-test analysis showed a nonsignificant difference in patient’s age in two groups (36.78
vs 39.58; p = 0.13).
A significant relevance of IL28-B polymorphism (rs12979860) genotypes is reported among HCV patients in
European, Asian, African populations [23]. Pakistani population has a heterogeneous and unique genetic profile.
Furthermore, due to limited availability of research data it is difficult to establish the relevance of rs12979860
genotypes with the treatment response in Pakistani HCV patients. However, in the current study we have evaluated
the genotypes of IL-28B (rs12979860) and determine the possible role of these genotypes in response to the
treatment of HCV infected patients.
Our results suggested that IL28-B rs12979860 CT genotype prevalence in SVR and NR patients was 54.5 and
12.3%, respectively and was associated with high predictive value (81.55%) and end treatment response (p ≤
0.001) (Table 2).
Khubaib et al. studied the association of rs12979860 genotypes with double therapy (peg-interferon and rib-
avirin) against HCVG3 and found rs12979860 CC genotype in SVR group as the most prevalent genotype and
demonstrated significant association with treatment response. In the current study, we evaluated the association
of IL28-B rs12979860 genotypes with triple therapy against HCVG3. The results of the current study revealed
showed that IL28-B rs12979860 genotype was the most prevalent genotype in SVR group and it showed statistically
significant association with triple combination therapy of HCV infection against HCVG3 [29]. Similarly Sheikh
et al.reported that IL28-B rs12979860 CT genotype was the most prevalent genotype in double combination ther-
apy in both SVR and NR subjects, in other words, CT (74%) in SVR and 47.5% in NR groups. The most likely
reason for this difference in the results may be the selection of treatment regimens, difference in HCV genotypes
and studied population.
Thus, IL28-B rs12979860 CT genotype could be used as a predictive marker for triple combination therapy of
CHC subjects of HCVG3 in the Pakistani population [30]. We are reporting these findings for the first time that
IL28-B rs12979860 CT genotype is most frequent genotype in SVR group. Moreover, IL28-B rs12979860 CC
genotype was reported in 14.3% of the responders and 9.1% of the NRs HCV patients (p = 0.25).
The IL28-B rs12979860 CC genotype varies among populations worldwide. Its distribution was higher in
European population, followed by the African and American population. The IL28-B rs12979860 CC genotype
showed better involvement in achieving SVR in European, Egyptian and sub-Saharan African CHC patients. It
has been evaluated in the present study that among CHC patients of Pakistani origin (154), C-allele has a potential
association with better treatment response against HCV infection.
The protective involvement of IL28-B rs12979860 CC genotype in HCV patients has been suggested previously.
However, the current analyses do not support the previously described IL28-B rs12979860 CC genotype in different
populations [31,32]. In terms of triple therapy (peg-interferon, sofosbuvir plus ribavirin) IL28-B rs12979860 CT
was the most frequent genotype in our study, while IL28-B rs12979860 CC was the most frequent genotype in
the Egyptian population, CC 22 out of 116 (14.3%), CT 84 out 116 (54.5%) and TT 10 out of 116 (6.5%)
versus CC 7 out of 8 (87.5%), CT 26 out of 33 (78.8%), TT 30 out of 41 (73.2%), respectively. Thus, IL28-B
polymorphism rs12979860 CT and CC genotypes showed a significant higher SVR in Pakistani and Egyptian
population respectively for triple combination therapy (peg-interferon, sofosbuvir plus ribavirin) [33].

Conclusion
This study suggests that I L28-B rs12979860 CT genotype may be used as a predictive marker for triple combination
therapy (peg-interferon, sofosbuvir plus ribavirin) in CHC patients. In order to reduce the cost and adverse effects,
it is recommended to test for these genetic markers for better personalized sofosbuvir and interferon-based therapy
in the Pakistani population.

508 Per. Med. (2018) 15(6) future science group

 Predictive value of IL-28B rs12979860 for peg-IFN, sofosbuvir plus ribavirin treatment of HCV. Research Article

Summary points
• Chronic hepatitis C patients (154) were investigated for IL28-B gene polymorphism rs12979860 (CC, CT and TT) by
reverse transcriptase real time PCR (qRT-PCR). The most frequent genotype in this study was CT genotype.
• The positive predictive value of sofosbuvir drug with IL28-B rs12979860 CT genotype was 81.55%.
• In terms of triple therapy and positive treatment response, IL28-B rs12979860 CT was the most frequent genetic
variant in our study, while IL28-B rs12979860 CC was the most frequent genetic variant in the Egyptian
population (CC: 22 out of 116 [14.3%], CT: 84 out 116 [54.5%] and TT: 10 out of 116 [6.5%] vs CC: 7 out of 8
[87.5%], CT: 26 out of 33 [78.8%] and TT: 30 out of 41 [73.2%], respectively).
• IL28-B rs12979860 CT genotype and combinational treatment regimen (peg-interferon, sofosbuvir plus ribavirin)
showed a significant sustained virological response in Pakistani population.
• IL28-B rs12979860 CT genotype may be recommended as a positive predictive marker for the sofosbuvir-based
combinational therapy of chronic hepatitis C infection. It is recommended to detect this genetic marker for better
personalized sofosbuvir based therapy in Pakistani population.

Financial & competing interests disclosure

The authors have no relevant affiliations or financial involvement with any organization or entity with a financial interest in or finan-
cial conflict with the subject matter or materials discussed in the manuscript. This includes employment, consultancies, honoraria,
stock ownership or options, expert testimony, grants or patents received or pending, or royalties.
No writing assistance was utilized in the production of this manuscript.

Ethical conduct of research

The authors state that they have obtained appropriate institutional review board approval or have followed the principles outlined
in the Declaration of Helsinki for all human or animal experimental investigations. In addition, for investigations involving human
subjects, informed consent has been obtained from the participants involved.

References
Papers of special note have been highlighted as: • of interest; •• of considerable interest
1. Lavanchy D. Evolving epidemiology of hepatitis C virus. Clin. Microbiol. Infect. 17(2), 107–115 (2011).
2. Hajarizadeh B, Grebely J, Dore GJ. Epidemiology and natural history of HCV infection. Nat. Rev. Gastroenterol. Hepatol. 10(9),
553–562 (2013).
3. Imran M, Manzoor S, Ashraf J et al. Role of viral and host factors in interferon based therapy of hepatitis C virus infection. Virol J. 10(1),
299 (2013).
4. Squires JE, Balistreri WF. Hepatitis C virus infection in children and adolescents. Hepatol. Comm. 1(2), 87–98 (2017).
5. Sakamoto N, Watanabe M. New therapeutic approaches to hepatitis C virus. J. Gastroenterol. 44(7), 643 (2009).
6. Jabl-onowska E, Piekarska A, Koślińska-Berkan E, Omulecka A, Szymańska B, Wójcik K. Sustained virologic response and IL28-B
single-nucleotide polymorphisms in patients with chronic hepatitis C treated with pegylated interferon alfa and ribavirin. Acta Biochim
Pol. 59(3), 333–337 (2012).
7. Hayes CN, Imamura M, Aikata H, Chayama K. Genetics of IL28-B and HCV – response to infection and treatment. Nat. Rev.
Gastroenterol. Hepatol. 9(7), 406–417 (2012).
8. Glue P, Rouzier-Panis R, Raffanel C et al. A dose-ranging study of pegylated interferon alfa-2b and ribavirin in chronic hepatitis C.
Hepatology 32(3), 647–653 (2000).
9. Kronenberger B, Zeuzem S. Current and future treatment options for HCV. Ann. Hepatol. 8(2), 103–112 (2009).
10. Coppola N, Pisaturo M, Sagnelli C, Sagnelli E, Angelillo IF. Peg-interferon plus ribavirin with or without boceprevir or telaprevir for
HCV genotype 1: a meta-analysis on the role of response predictors. PLoS ONE 9(4), e94542 (2014).
11. Rosen HR, Gretch DR. Hepatitis C virus: current understanding and prospects for future therapies. Mol. Med. Today 5(9), 393–399
(1999).
12. Dhingra A, Kapoor S, Alqahtani SA. Recent advances in the treatment of hepatitis C. Discov. Med. 18(99), 203–208 (2014).
•• Shows that sofosbuvir-based therapy can help in sustained virological response group, which was the bases of our study.
13. Jacobson IM, Dore GJ, Foster GR et al. Simeprevir with pegylated interferon alfa 2a plus ribavirin in treatment-naive patients with
chronic hepatitis C virus genotype 1 infection (QUEST-1): a Phase III, randomized, double-blind, placebo-controlled trial.
Lancet 384(9941), 403–413 (2014).

future science group www.futuremedicine.com 509

Research Article Ali, Kalam, Ullah et al.

14. Rasheed A, Ullah S, Naeem S, Zubair M, Ahmad W, Hussain Z. Occurrence of HCV genotypes in different age groups of patients from
Lahore, Pakistan. Adv. Life Sci. 1(2), 89–95 (2014).
15. Venegas SM, Villanueva RA, González LK, Brahm BJ. IL28-B polymorphisms associated with therapy responsee in Chilean chronic
hepatitis C patients. World J. Gastroenterol. 17 (31) 3636–3629 (2011).
16. Zhao SH, Chu YL, Cheng DX et al. Treatment with peginterferon plus ribavirin vs. interferon plus ribavirin for 48 weeks in Chinese
patients with chronic hepatitis C. Int. J. Clin. Pract. 63(9), 1334–1339 (2009).
17. Atif M, Arshad S, Javaid K et al. Diabetes and Hepatitis C: two sides of a coin. Adv. Life Sci. 4(3), 72–76 (2017).
18. Jacobson IM, Gordon SC, Kowdley KV et al. Sofosbuvir for hepatitis C genotype 2 or 3 in patients without treatment options. N. Engl.
J. Med. 368(20), 1867–1877 (2013).
19. Bourlière M, Khaloun A, Wartelle-Bladou C et al. Chronic hepatitis C: treatments of the future. Clin. Res. Hepatol. Gastroenterol. 35,
S84–S95 (2011).
20. Tanaka Y, Nishida N, Sugiyama M et al. Genome-wide association of IL28-B with response to pegylated interferon-α and ribavirin
therapy for chronic hepatitis C. Nat. Genet. 41(10), 1105–1109 (2009).
• Depicts the association of Snap’s near IL28-B gene in the treatment of hepatitis C virus (HCV) infection.
21. Sarrazin C, Susser S, Doehring A et al. Importance of IL28-B gene polymorphisms in hepatitis C virus genotype 2 and 3 infected
patients. J. Hepatol. 54(3), 415–421 (2011).
• The information regarding the location of IL28-B gene on chromosome 19q13 was highly relevant for our study.
22. Thio CL. Host genetic factors and antiviral immune responses to hepatitis C virus. Clin. Liver Dis. 12(3), 713–726 (2008).
23. Thomas DL, Thio CL, Martin MP et al. Genetic variation in IL28-B and spontaneous clearance of hepatitis C virus. Nature 461(7265),
798–801 (2009).
24. Dayyeh BKA, Gupta N, Sherman KE, de Bakker PI, Chung RT, Aids Clinical Trials Group A5178 Study Team. IL28-B alleles exert an
additive dose effect when applied to HCV–HIV coinfected persons undergoing peginterferon and ribavirin therapy. PLoS
ONE 6(10), e25753 (2011).
25. Rao H, Wei L, Lopez-Talavera JC et al. Distribution and clinical correlates of viral and host genotypes in Chinese patients with chronic
hepatitis C virus infection. J. Gastroenterol. Hepatol. 29(3), 545–553 (2014).
26. Suguna S, Nandal D, Kamble S, Bharatha A, Kunkulol R. Genomic DNA isolation from human whole blood samples by non enzymatic
salting out method. Int. J. Pharm. Sci. 6, 198–199 (2014).
27. Dzekova-Vidimliski P, Nikolov IG, Matevska-Geshkovska N et al. Genetic predictors of the response to the treatment of hepatitis C
virus infection. Bosn. J. Basic Med. Sci. 15(4), 55 (2015).
• Shows that sofosbuvir in combination with peg- interferon (IFN) and ribavirin (RBN) can reflect minimal side effects and
increase sustained virological response in HCV patients.
28. Aziz H, Raza A, Ali K, Khattak JZK, Irfan J, Gill ML. Polymorphism of the IL28-B gene (rs8099917, rs12979860) and virological
response of Pakistani hepatitis C virus genotype 3 patients to pegylated interferon therapy. Int. J. Infect. Dis. 30, 91–97 (2015).
• Shows that numerous host factors can affect the treatment of HCV infection with pegylated interferon therapy.
29. Khubaib B, Saleem S, Idrees M, Afzal S, Wasim M. The genotype CC of IL-28B SNP rs12979860 is significantly associated with a
sustained virological response in chronic HCV-infected Pakistani patients. J. Dig. Dis. 16(5), 293–298 (2015).
•• Suggests that the treatment with double therapy results in rs12979860 CC genotype as the most prevalent genotype in HCV
infected patients.
30. Shaikh N, Waryah AM, Devrajani BR, Rajput MI, Hayat AS, Shaikh S. IL28-B rs12980275 polymorphism shows association with
response to treatment in Pakistani patients with chronic hepatitis C. J. Med. Virol. 87(5), 814–820 (2015).
•• Suggests that CT is the most prevalent genotype in the Pakistani population.
31. Mostafak E-A, Lotiaf M, Ashrafa T et al. Association of IL28-B SNP with progression of Egyptian HCV genotype 4 patients to end stage
liver disease. Hepat. Mon. 12(4), 271–277 (2012).
32. Heidar S, Ali P, Bita B et al. Development and validation of a simple, rapid and inexpensive PCR-RFLP method for genotyping of
common IL28-B polymorphisms: a useful pharmacogenetic tool for prediction of hepatitis C treatment response. Hepat. Mon. 12(3),
190–195 (2012).
33. El-Raheem HDA, Hashem MH, Hemeida AA, Ebeed ME, Arafa UA, Yousef LM. IL28-B Polymorphism is a pharmacogenetic predictor
during sofosbuvir plus pegylated interferon and ribavirin therapy for chronic hepatitis C Egyptian patients. J. Pharmacogenomics &
Pharmacoproteomics 8(1), 1–5 (2017).
•• Suggests that the use of triple therapy results in rs12979860 CC as the most prevalent genotype in Egyptian population.

510 Per. Med. (2018) 15(6) future science group