International Journal of Tropical Insect Science

https://doi.org/10.1007/s42690-019-00036-3

ORIGINAL RESEARCH ARTICLE

Composition and change in the microbiome of Diaphorina citri

infected with Candidatus Liberibacter asiaticus in China
Xiao-bing Song 1,2 & Ai-tian Peng 1 & Jin-feng Ling 1 & Yi-ping Cui 1 & Bao-ping Cheng 1 & Lian-hui Zhang 2

Received: 31 January 2019 / Accepted: 8 July 2019

# African Association of Insect Scientists 2019

Abstract
Diaphorina citri Kuwayama (Hemiptera: Psyllidae) is the primary vector of Candidatus Liberibacter asiaticus (Las), which
causes the devastating disease Huanglongbing (HLB) in Asian citrus. To examine the effects of pathogens on the diversity and
structure of insect-associated bacterial communities, we carried out a molecular analysis using healthy D.citri and Las-infected
D.citri as a vector-pathogen model. 16S rRNA Illumina sequencing analysis of D.citri revealed shifts in its microbial diversity in
response to pathogen infection. The phylum Proteobacteria predominated in D.citri representing 89.40 and 91.73% of the
bacterial communities, while remaining bacterial sequences were mainly assigned to the phyla Actinobacteria, Firmicutes,
Bacteroidetes and Acidobacteria. The relative proportions of different groups of bacteria changed significantly after pathogen
infection. The relative abundance of bacterial communities between healthy D.citri and Las-infected D.citri were different, and
the relative abundance of most dominant bacteria decreased, such as Oscillospira, Lactobacillus and Rubrobacter. However, the
relative abundance of Wolbachia increased from 1.81 to 2.14%, and there was no difference in the abundance of Carsonella. In
pairwise comparisons, the clone library from healthy D.citri contained greater 16S rRNA gene diversity, as reflected by the higher
Shannon index at 2.937 versus 2.756 for the healthy and Las-infected clone libraries, respectively. These data indicated that Las
infection has a profound effect on the structure and composition of the bacterial community associated with D.citri.

Keywords Diaphorina citri . Kuwayama . Candidatus Liberibacter asiaticus . 16S ribosomal RNA . Microbiome

Introduction Previous studies have confirmed that midgut microbes ben-

Diaphorina citri Kuwayama (Hemiptera: Psyllidae) is not on-
ly an important pest on citrus but also a vector of Candidatus
Liberibacter asiaticus (Las), which causes the destructive dis-
ease Huanglongbing (HLB) in Asian citrus (Bové 2006), and
Las-infected D.citri can transmit the pathogen to citrus plants
during their entire lifetime (Inoue et al. 2009).
* Ai-tian Peng
pengait@163.com
* Lian-hui Zhang
lhzhang01@scau.edu.cn
1
Plant Protection Research Institute, Guangdong Academy of
Agricultural Sciences, Guangdong Provincial Key Laboratory of
High Technology for Plant Protection, Guangzhou, China
2
Guangdong Province Key Laboratory of Microbial Signals and
Disease Control, Agricultural College of South China Agricultural
University, Guangzhou, China
efit from insect hosts (Takatsuka and Kunimi 2000; Behar
et al. 2005), while the loss of these bacteria leads detrimental
fitness costs to the host (O’Neill et al. 1992; Kikuchi 2009).
There may be a tritrophic interaction among plants, insects
and bacteria, and intestinal bacteria may be a target for the
potential control of insects through the use of systemic anti-
bacterial materials (Lin et al. 2015). The infection of citrus by
Las has a profound effect on the structure and composition of
the endogenous bacterial community. Q-PCR analysis re-
vealed that the bacterial community was changed qualitatively
and quantitatively, and the relative proportions of different
groups of endogenous bacteria changed significantly after in-
fection with Las (Trivedi et al. 2010).
454 Pyrosequencing in Florida revealed the most populous
bacterial genera in D.citri, which included Wolbachia,
Ralstonia, and members in the family Tremblayaceae.
Staphylococcus, Pseudomonas and Enterobacteriales were
found in D.citri in low numbers (Kolora et al. 2015). D.citri
is also the host of numerous bacterial endosymbionts, includ-
ing Wolbachia, which is widely distributed among various

groups of insects, mites, crustaceans and nematodes and is one
of the most intensively studied facultative endosymbiotic bac-
teria (O'Neill et al. 1997; Surya et al. 2012). It is very interest-
ing that Wolbachia has a certain impact on host biology, and
there is potential for controlling disease-vector insects, such as
D.citri, by manipulating their resident Wolbachia strains
(Subandiyah et al. 2000; Fagen et al. 2012).
Based on differences in species, geographic locations and
even host plants, the abundant bacterial microbiome of D.citri
in China may be different from those in other locations around
the world. Additionally, the composition and relative abun-
dance of the bacterial microbiome in Las-infected D.citri
and their interactions with Las in China are not well under-
stood currently. High-throughput 16S rRNA sequencing was
used to determine the composition of and change in the bac-
terial microbiome in D.citri during infection with Las, and the
similarities and differences in the microbiota between D.citri
and citrus were also compared. Further elucidation of the link
between D.citri and its bacterial microbiome community
would lead to a more complete understanding of the acquisi-
tion and transmission of Las and the tripartite interaction
among host insects, microbiomes and Las.
Materials and methods
Source of D.citri and citrus
All experiments using live D.citri adults were performed in
the insect-proof greenhouse in the Guangdong Provincial Key
Laboratory of High Technology for Plant Protection. Clean
D.citri adults maintained in cages were fed on healthy citrus
plants (Citrus reticulate cv. Shatangju). Some insects were
transferred to a cage with an HLB-symptomatic, Las-
infected citrus plant (Citrus reticulate cv. Shatangju). After
feeding on the infected plant for 30 days, ten D.citri adults
(five males and five females) were collected using an aspira-
tor, and another ten clean D.citri adults (five males and five
females) were also collected for control. The D.citri adults
were washed with 70% ethanol via gently shaking for 30 s.
Then, the D.citri adults were rinsed three times in sterile water
to remove environmental contaminants and frozen at −80 °C
until use. Mature healthy or Las-infected citrus leaves were
also obtained, and the leaves were surface sterilized with the
aforementioned method.
Genomic DNA extraction from D.citri and citrus
Genomic DNA was extracted from D.citri adults or citrus
leaves using the Multisource Genomic DNA Miniprep Kit
according to the manufacturer’s protocols (AxyPrep,
Hangzhou, China). The extracted DNA was stored at −20 °C
until use.
Int J Trop Insect Sci
Detection of Candidatus Liberibacter asiaticus
Nested-PCR was used for Las detection in D.citri and citrus.
O I 1 / O I 2 c ( G C G C G TAT G C A ATA C G A G C G G C A /
GCCTCGCGACTTCGCAACCCAT) (Jagoueix et al. 1996)
was used as the first amplification primer pair, and CGO3F/
C G O 5 R ( R G G G A A A G AT T T TAT T G G A G
/GAAAATAYCATCTCTGATATCGT) (Zhou et al. 2007)
was used as the second amplification primer pair. Both ampli-
fication systems were carried out in a final volume of 25 μL
with the following reaction mixture: 10.5 μL of ddH2O,
0.5 μL of each primer (10 μmol/L), 12.5 μL of 2 × EasyTaq
PCR SuperMix, and 1 μL of sample DNA. The first amplifi-
cation was performed with the following programme:
preheating at 94 °C for 5 min, then 35 cycles of denaturation
at 94 °C for 30 s, annealing at 56 °C for 60 s, extension at
72 °C for 90 s, and a final extension at 72 °C for 7 min. The
second amplification was performed with the following pro-
gramme: preheating at 94 °C for 5 min, then 35 cycles of
denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s,
extension at 72 °C for 45 s, and a final extension at 72 °C for
7 min.
V4 16S rRNA amplicon sequencing and data analysis
According to the concentration, DNA was diluted to 1 ng/μl
using sterile water. The V4 region of the 16S rRNA gene was
amplified with 515F/806R primers to construct the amplicon
libraries according to a previously described method (Peiffer
et al. 2013). All reactions were carried out in a 30 μL total
volume with 15 μL of Phusion® High-Fidelity PCR Master
Mix (New England Biolabs), 0.2 μM forward and reverse
primers, and approximately 10 ng of template DNA.
Thermal cycling consisted of initial denaturation at 98 °C for
1 min, followed by 30 cycles of denaturation at 98 °C for 10 s,
annealing at 50 °C for 30 s, elongation at 72 °C for 30 s and a
final extension at 72 °C for 5 min.
PCR products were mixed in equidensity ratios. Then, the
PCR mixtures were purified with a GeneJET Gel Extraction
Kit (Thermo Scientific). Sequencing libraries were generated
using the NEB Next® Ultra™ DNA Library Prep Kit for
Illumina (NEB, USA) following the manufacturer’s recom-
mendations, and index codes were added. The library quality
was assessed on a Qubit@ 2.0 Fluorometer (Thermo
Scientific) and Agilent Bioanalyzer 2100 system. Finally, the
library was sequenced on an Illumina HiSeq platform, and
250 bp paired-end reads were generated. Raw data were
screened and assembled by QIIME 1 (Caporaso et al. 2010)
and FLASH (Magoč and Salzberg 2011) software packages.
The UCLUST method (Caporaso et al. 2010) was used to
cluster the sequences into operational taxonomic units
(OTUs) at an identity threshold of 97%. The resulting repre-
sentative sequence set was aligned and given a taxonomic
Int J Trop Insect Sci
classification using RDP (Wang et al. 2007). Additional anal-
yses, such as rarefaction curves, Shannon indices, and Good’s
coverage, were carried out with QIIME.
Results
Detection of Candidatus Liberibacter asiaticus
Nested PCR amplification with the primer pairs OI1/OI2c and
CGO3F/CGO5R was performed on DNA extracted from
healthy D.citri, Las-infected D.citri, healthy citrus and Las-
infected citrus. A band of approximately 800 bp was obtained
with DNA extracts from Las-infected D.citri and citrus, and
there was no band amplified from healthy D.citri and citrus
(Fig. 1).
Rarefaction curves
Rarefaction curves represent a random number of individuals
from the sample, the number of species represented by these
individuals, and the number of individuals and the number of
species required to build the curve. When the dilution curve is
low and flat, the amount of sequencing in the clone library is
representative of the diversity of microbes in the library.
Rarefaction curves indicated that the plateau of diversity was
achieved at approximately 10,000 reads, showing that our
sequencing had adequate depth to capture the diversity
(Fig. 2). Although the read number in the Las-infected
D.citri sample was lower than that in the healthy D.citri sam-
ple, both samples showed similar Good’s coverage rates
(0.985 vs. 0.985) (Table 1), indicating that the majority of
the microbiome of infected D.citri had been detected.
Fig. 1 1.2% agarose gel electrophoresis of the DNA amplified by nested
PCR. Lane 1: Positive control, Lane 2: healthy D.citri, Lane 3: Las-
infected D.citri, Lane 4: healthy citrus, Lane 5: Las-infected citrus
Increasing the sequencing depth could reveal additional rare
microbial species in infected D.citri, but this would have little
effect on the diversity estimation.
OTU classification
There were 503 OTUs obtained from healthy D.citri; 351
OTUs were shared with Las-infected D.citri, 405 OTUs were
shared with healthy citrus, and 316 OTUs were shared with
Las-infected citrus. There were 453 OTUs obtained from Las-
infected D.citri; 370 OTUs were shared with healthy citrus,
and 288 OTUs were shared with Las-infected citrus (Fig. 3).
The number of OTUs obtained from Las-infected D.citri
was 50 less than that of healthy D.citri, indicating that endo-
phytic bacteria species were significantly reduced after D.citri
adults fed on Las-infected citrus. There were 236 identical
OTUs in the four samples, indicating that a considerable por-
tion of the endophytic bacteria were derived from the citrus
host plant, and they may be transient bacteria in the intestines
of D.citri, while their populations may fluctuate with changes
in the host plant.
Statistical analysis of 16S rRNA MiSeq sequencing
Relative abundance in the microbiome in Las-infected D.citri
and their interactions with Las are not well known. To deter-
mine the influence of Las infection on the microbial compo-
sition of the insect host, we surveyed the microbiome associ-
ated with D.citri before and after infection with Las by 16S
rRNA amplicon sequencing analysis. Our results showed that
Las-infected D.citri share a slightly reduced Shannon diversi-
ty index with that of healthy D.citri (2.756 vs. 2.937)
(Table 1). A total of 32,854 to 62,237 effective tags were
retrieved from the samples (Table 1). The numbers of OTUs
in each healthy and Las-infected sample ranged in size from
425 to 600 (Table 1).
The number of OTUs in Las-infected D.citri was decreased
significantly (503 vs. 453) compared with that in healthy
D.citri, and the number of OTUs in Las-infected citrus was
also decreased (600 vs. 425) compared with that in healthy
citrus (Table 1). A 16S rRNA gene clone library analysis of
D.citri revealed shifts in microbial diversity in response to
pathogen infection, which indicated that the presence of Las
inhibited the survivability of other bacteria in insects or plants.
Subsequently, each OTU was assigned to a taxonomic level
by the RDP classifier, and most reads were classified to the
Proteobacteria kingdom (Fig. 4). Considering that a large
amount of bacteria was categorized into the phylum
Proteobacteria in both healthy and Las-infected D.citri sam-
ples, we defined a phylum with a relative abundance ≥0.1% as
a predominant phylum. Overall, we assigned 503 and 453
genera to healthy and Las-infected D.citri, respectively
(Table 1). In pairwise comparisons, the clone library from
 Int J Trop Insect Sci

Fig. 2 Rare faction curves

generated for the 16S rRNA gene
clone library in healthy D.citri
(MS1), Las-infected D.citri
(MS2), healthy citrus (GJ1) and
Las-infected citrus (GJ2)

healthy D.citri contained significantly higher 16S rRNA gene
diversity.
Bacterial community shifts during the infecting
process
The classification and phylogenetic analyses indicated that all
the bacterial sequences fell within 18 phyla (Table 2). The
phylum Proteobacteria predominated, representing 89.40%
and 91.73% of the bacterial communities in D.citri, and the
remaining bacterial sequences were mainly assigned to the
phyla Actinobacteria, Firmicutes, Bacteroidetes and
Acidobacteria (Fig. 4). The bacterial diversity and relative
abundance of healthy or Las-infected D.citriandcitrus are pre-
sented in Table 2. The different relative abundance of
Proteobacteria, Actinobacteria, Firmicutes, Acidobacteria,
Gemmatimonadetes, Verrucomicrobia, Chloroflexi and
Cyanobacteria between the two samples of healthy and Las-
infected D.citri were statistically significant (Table 2). For
instance, the proportions of Actinobacteria, Firmicutes,
Acidobacteria, Gemmatimonadetes, Chloroflexi and
Cyanobacteria in the Las-infected D.citri samples were
significantly reduced. However, only the proportion of
Proteobacteria in the Las-infected D.citri samples was signif-
icantly increased; the proportions of Bacteroidetes and
Nitrospirae were not significantly increased.
Proteobacteria were the dominant endophytes, accounting
for 77.76% and 84.70% of the endophytic bacterial flora in
healthy citrus and Las-infected citrus, respectively. The rest of
the endophytic bacterial flora were mainly distributed in
Actinobacteria, Firmicutes, Bacteroidetes and Acidobacteria.
It is similar to the distribution of endophytic bacterial flora in
D.citri, and the trend of changes of endophytic flora in healthy
and Las-infected citrus was also similar to that in healthy and
Las-infected D.citri (Table 2).
The classification and phylogenetic analysis indicated that
all the bacterial sequences fell within 95 high frequency gen-
era. The top 20 genera associated with healthy or Las-infected
D.citri and citrus are presented in Table 3. The clone library of
Las-infected D.citri had a majority of genera similar to healthy
D.citri. Genera with in Proteobacteria were mainly detected in
the insects, with a relative percentage of 89.40% and 91.73%,
respectively, in each D.citri sample with 40 frequently detect-
ed genera (Fig. 4). Among them, Carsonella were the most

Table 1 Statistical analysis of

16S rRNA MiSeq sequencing of Healthy D.citri Las-infected D.citri Healthy citrus Las-infected citrus
healthy D.citri, Las-infected
D.citri, healthy citrus and Las- Effective tags 57,096 32,854 62,237 48,800
infected citrus OTUs 503 453 600 425
Shannon index 2.937 2.756 3.240 2.067
Good’s coverage 0.985 0.985 0.988 0.994
Int J Trop Insect Sci

Fig. 3 Intersected Venn diagram

of OTUs of healthy D.citri
(MS1), Las-infected D.citri
(MS2), healthy citrus (GJ1) and
Las-infected citrus (GJ2)

dominant, with a relative percent of 34.94% and 34.86% in
each D.citri sample (Table 3). Wolbachia comprised 1.81%
and 2.14% of the bacterial communities. The remaining gen-
era were closely related to Sphingomonas, Kaistobacter,
DA101, Afifella, Bilophila, Halomonas, and Desulfovibrio
(Table 3). Actinobacteria, accounting for 3.66% and 3.09%
of each community, were the second most common bacteria
in the insects, with 21 frequently detected genera (Fig. 4).
Among them, Rubrobacter made up 0.43% and 0.32% of
the bacterial communities (Table 3). Firmicutes, accounting
for 3.18% and 2.10% of each community, were the third most
common bacteria in the insects, with 16 frequently detected
genera (Fig. 4). Among them, Oscillospira made up 0.92%
and 0.49% of the bacterial communities, and the remaining
genera were closely related to Lactobacillus, Ruminococcus,
Dehalobacterium, Allobaculum and Bacillus (Table 3).
The relative abundance of bacterial communities between
healthy D.citri and Las-infected D.citri were different, and the
relative abundance of most dominant bacteria decreased, such
as Oscillospira, Lactobacillus and Rubrobacter. However, the
relative abundance of Wolbachia increased from 1.81% to
2.14%, and there was no difference in the abundance of
Carsonella. Table 3 indicates that Carsonella and
Wolbachia, which were the dominant populations in D.citri,

Fig. 4 Microbial composition in

healthy D.citri (MS1) and Las-
infected D.citri (MS2), healthy
citrus (GJ1) and Las-infected cit-
rus (GJ2). Phyla with a relative
abundance ≥0.1% were defined as
predominant phyla. Sequences
that failed to be classified or phyla
with a relative abundance less
than 0.1% were assigned as
‘Other’
 Int J Trop Insect Sci

Table 2 Differentially abundant

phyla between healthy D.citri Phylum MS1 (%) MS2 (%) GJ1 (%) GJ2 (%) MS1 vs. MS2 p value
(MS1), Las-infected D.citri
(MS2), healthy citrus (GJ1) and Proteobacteria 89.40 91.73 77.76 84.70 3.78E-26
Las-infected citrus (GJ2) Actinobacteria 3.66 3.09 5.71 4.00 2.61E-05
Firmicutes 3.18 2.10 3.18 5.56 4.63E-22
Bacteroidetes 1.30 1.31 2.47 2.19 2.40E-01
Acidobacteria 1.28 1.00 3.38 1.68 3.20E-04
Gemmatimonadetes 0.47 0.36 1.19 0.59 3.55E-03
Verrucomicrobia 0.19 0.12 4.37 0.23 1.58E-02
Chloroflexi 0.19 0.12 0.71 0.28 1.62E-02
Cyanobacteria 0.10 0.01 0.51 0.31 4.07E-04
Nitrospirae 0.05 0.05 0.11 0.11 6.60E-01
AD3 0.05 0.04 0.14 0.05 9.89E-01
Armatimonadetes 0.04 0.03 0.13 0.10 3.64E-02
Planctomycetes 0.02 0.01 0.23 0.12 7.10E-01
FBP 0.02 0.01 0.00 0.02 8.43E-03
Chlorobi 0.01 0.00 0.02 0.00 3.12E-01
WS3 0.01 0.00 0.01 0.00 4.48E-01
WPS-2 0.00 0.01 0.05 0.00 6.31E-01
Crenarchaeota 0.00 0.00 0.00 0.03 2.83E-01
Others 0.05 0.02 0.02 0.02 6.44E-01

were not dominant in the healthy and Las-infected citrus. D.citri and citrus, while the relative proportions and contents
However, most endophytic flora were the same between were different.

Table 3 Top 20 genera associated with healthy D.citri, Las-infected D.citri, healthy citrus and Las-infected citrus

HealthyD.citri % Las-infected D.citri % Healthy citrus % Las-infected citrus %

[1] Carsonella 34.94 Carsonella 34.86 Akkermansia 3.19 Lactobacillus 2.33

[2] Wolbachia 1.81 Wolbachia 2.14 Lactobacillus 0.90 Oscillospira 1.32
[3] Oscillospira 0.92 Oscillospira 0.49 DA101 0.86 Rubrobacter 0.54
[4] Lactobacillus 0.82 Lactobacillus 0.32 Rubrobacter 0.77 Bacteroides 0.41
[5] Rubrobacter 0.43 Rubrobacter 0.32 Oscillospira 0.76 Phormidium 0.20
[6] Sphingomonas 0.27 Sphingomonas 0.26 Bacteroides 0.52 Pantoea 0.20
[7] Kaistobacter 0.16 Bacteroides 0.22 Sphingomonas 0.43 Ruminococcus 0.19
[8] Ruminococcus 0.15 Kaistobacter 0.17 Rhodoplanes 0.33 Dehalobacterium 0.19
[9] Bacteroides 0.14 Clostridium 0.12 Bradyrhizobium 0.23 Sphingomonas 0.18
[10] Dehalobacterium 0.12 Ruminococcus 0.10 Kaistobacter 0.23 Bradyrhizobium 0.14
[11] Afifella 0.11 Bradyrhizobium 0.10 Phormidium 0.23 Allobaculum 0.14
[12] DA101 0.10 Dehalobacterium 0.10 Methylobacterium 0.18 Bilophila 0.14
[13] Allobaculum 0.09 Janthinobacterium 0.09 Acinetobacter 0.15 DA101 0.11
[14] Bilophila 0.09 Afifella 0.08 Afifella 0.14 Desulfovibrio 0.10
[15] Desulfovibrio 0.08 Halomonas 0.06 Dehalobacterium 0.12 Odoribacter 0.10
[16] Bacillus 0.08 Arthrobacter 0.06 Pantoea 0.11 Candidatus Liberibacter 0.08
[17] Halomonas 0.08 Rhodanobacter 0.05 Clostridium 0.11 Rhodoplanes 0.07
[18] Bradyrhizobium 0.07 DA101 0.04 Ruminococcus 0.11 Kaistobacter 0.07
[19] Rhodoplanes 0.06 Desulfovibrio 0.04 Flavisolibacter 0.10 Methylobacterium 0.07
[20] Rhodanobacter 0.06 Rhodoplanes 0.04 Rhodanobacter 0.09 Clostridium 0.05

OTUs characterized to the genus level are presented

Int J Trop Insect Sci
Discussion
It is supposed that geographical location, host differences and
different sequencing methods may lead to different results. In
our study, the dominant bacteria in the four samples were the
same for the phylum-level classification. Proteobacteria,
Actinobacteria, Firmicutes, Bacteroidetes and Acidobacteriain
D.citri may be widely derived from the citrus host plant. This
suggests that some bacteria have a symbiotic relationship with
D.citri through long-term symbiosis, and some bacteria are tem-
porary, which will disappear with host replacement. Infection by
Las restructured the native microbial community associated with
D.citri and led to the reduction of most phylotypes. In pairwise
comparisons, the clone library from healthy D.citri contained
significantly greater 16S rRNA gene diversity. The sequencing
data showed that the presence of Las greatly inhibited the sur-
vival and reproduction of endogenous bacteria in D.citri and
citrus. Compared with the dominant endophyte species in citrus,
the genera Carsonella, Wolbachia occupied an absolute domi-
nant position in D.citri, while its relative content in citrus was
relatively low, which may suggest they are mutually symbiotic
with D.citri and may be passed to the next generation through
breeding. Previous research has noted that the endophytic com-
position of host plants may be the first important factor influenc-
ing Las transmission efficiency by indirectly seeding D. citri with
bacteria that affect Las establishment and transmission (Kolora
et al. 2015).
C ar s o ne l l a ru d d i i is a bacteriocyte-associated
γ-proteobacterial symbiont that appears to exist in all species of
phloem-feeding insects, such as D.citri (Thao et al. 2000).
Carsonella ruddii has a genome of 159,662 bp, with only 182
open reading frames, and it was considered to be the smallest
bacteria with one of the smallest genomes to date (Gil et al.
2006). C.ruddii was considered the primary endosymbiont of
the psyllid Pachypsylla venusta (Nakabachi et al. 2006); howev-
er, genes for the biosynthesis of three essential amino acids have
been completely lost (Tamames et al. 2007). Through a gene
repertoire functional analysis of C.ruddii, it was revealed that
its extensive genome degradation was not compatible with its
consideration as an endosymbiont or as a living organism
(Tamames et al. 2007). The Carsonella_DC genome has retained
many genes for the biosynthesis of essential amino acids, but few
genes for the biosynthesis of non-essential amino acids, corrob-
orating the mutualistic role of Carsonella in providing essential
amino acids for the host D.citri (Nakabachi et al. 2013). In our
study, there were a large number of genera of Carsonella in
D.citri, which may contain a large amount of C.ruddii. It is
presumed that Carsonella is probably present in the cell bodies
of D.citri, and whether Carsonella provides a variety of essential
amino acids to meet the intrinsic nutritional needs of the host
needs to be confirmed.
Wolbachia is not only localized in the psyllids bacteriocytes
but was also detected primarily in reproductive tissues (Werren
1997). The infection rate of Wolbachia is high in the D.citri
population at 76.2% (Subandiyah et al. 2000). An increase in
Wolbachia titre with Las infection indicates a more complicated
mechanism than a simple replacement of indigenous endosym-
bionts by Las. The Las titre within D.citri was found to have a
strong negative relationship with endosymbionts residing in the
syncytium of the mycetocytes and a positive relationship with
Wolbachia, and these correlations have implications for the ac-
quisition of Las by D.citri as well as the activities of Las within
D.citri (Fagen et al. 2012). Kolora et al. (2015) found that Las
influences microbial communities in D.citri, and our findings are
in support this. Both D.citri and citrus displayed shifts in their
microbiota in the presence of Las, and the amount of Wolbachia
in Las-infected D. citri was more abundant. The results indicate
that the presence of Las promotes the survivability of Wolbachia
in D.citri, suggesting that perhaps there is a symbiotic relation-
ship between Wolbachia and Las. In our study, a strong positive
correlation between Wolbachia and Las was also observed in
D.citri, and the relative abundance of Wolbachia increased from
1.81 to 2.14% after Las infection. Wolbachia has also been
shown to alter host insect gene expression to create a favourable
intracellular environment for Wolbachia growth (Hussain et al.
2011). It has not yet been investigated whether D.citri carrying
Wolbachia exhibit such reproductive symptoms, as a comparable
mechanism may lead to increased Wolbachia with Las infection
in D.citri. Wolbachia has also been shown to protect its hosts
against a wide range of pathogens (Hughes et al. 2012); however,
it has a probiotic effect with Huanglongbing pathogen. Another
study shows that Wolbachia may down regulate antiviral Toll-
based immunity leading to increased virus infection and can
potentially enhance a vector-borne pathogen that causes human
disease (Dodson et al. 2014).
In conclusion, the results revealed a significant differ-
ence in bacterial abundance and species composition be-
tween healthy and Las-infected D.citri. These results in-
dicate that infection of D.citri by Las has a profound
effect on the structure and composition of the bacterial
community, and further study could give a better under-
standing of the potential roles of its endogenous bacteria
and their interaction with Las, such as the role of endo-
phytic bacteria in the proliferation and metastasis of Las
in D.citri, the symbiotic or inhibitory relationship be-
tween endophytic bacteria and Las, and so on.
Funding This article was supported by the National Key R& D Program
of China (2018YFD0201500, 2017YFD0202000), the Public Research
and Capacity Building Project of Guangdong (2014B020203003), and
the Guangdong Provincial Special Fund of Modern Agricultural Industry
Technology Innovation Team (2019KJ108).
Compliance with ethical standards
Conflict of interest The authors declare that they have no conflict of
interest.

References
Behar A, Yuval B, Jurkevitch E (2005) Enterobacteria mediated nitrogen
fixation in natural populations of the fruit fly Ceratitiscapitata. Mol
Ecol 14:2637–2643
Bové JM (2006) Huanglongbing: a destructive, newly-emerging,
century-old disease of citrus. J Plant Pathol 88:7–37
Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD,
Costello EK (2010) Qiime allows analysis of high-throughput com-
munity sequencing data. Nat Methods 7:335–356
Dodson BL, Hughes GL, Paul O, Matacchiero AC, Kramer LD, Rasgon
JL (2014) Wolbachia enhances West Nile virus (WNV) infection in
the mosquito Culex tarsalis. Plos Negl Trop Dis 8(7):e2965
Fagen JR, Giongo A, Brown CT, Davis-Richardson AG, Gano KA,
Triplett EW (2012) Characterization of the relative abundance of
the Citrus pathogen Ca. Liberibacter Asiaticus in the microbiome
of its insect vector, Diaphorina citri, using high throughput 16S
rRNA sequencing. The Open Microbiology Journal 6:29–33
Gil R, Pérez-Brocal V, Latorre A, Moya A (2006) Minimal genomes
required for life. In Prokaryotic diversity Mecanisms and signifi-
cance edited by: Logan NA, Lappin-Scott HM, Oyston CF.
Cambridge University Press, 105–121
Hughes GL, Vega-Rodriguez J, Xue P, Rasgon JL (2012) Wolbachia
strain wAlbB enhances infection by the rodent malaria parasite
Plasmodium berghei in Anopheles gambiae mosquitoes. Semin
Liver Dis 13(02):126–135
Hussain M, Frentiu FD, Moreira LA, O'Neill SL., Asgari S (2011)
Wolbachia uses host microRNAs to manipulate host gene expres-
sion and facilitate colonization of the dengue vector Aedesaegypti.
Proceedings of the National Academy of Sciences of the United
States of America, 108:9250-9255
Inoue H, Ohnishi J, Ito T, Tomimura K, Miyata S, Iwanami T (2009)
Enhanced proliferation and efficient transmission of Candidatus
Liberibacter asiaticus by adult Diaphorina citri after acquisition
feeding in the nymphal stage. Ann Appl Biol 155:29–36
Jagoueix S, Bové JM, Garnier M (1996) PCR detection of the two
'Candidatus' Liberobacter species associated with greening disease
of citrus. Mol Cell Probes 10:43–50
Kikuchi Y (2009) Endosymbiotic bacteria in insects: their diversity and
culturability. Microbes Environ 24:195–204
Kolora LD, Powell CM, Hunter W, Bextine B, Lauzon CR (2015)
Internal extracellular Bacteria of Diaphorina citri, Kuwayama
(Hemiptera:Psyllidae), the Asian citrus psyllid. Curr Microbiol
70(5):710–715
Lin XL, Pan QJ, Tian HG, Douglas AE, Liu TX (2015) Bacteria abun-
dance and diversity of different life stages of Plutellaxylostella
(Lepidoptera: plutellidae), revealed by bacteria culture-dependent
and pcr-dgge methods. Insect Sci 22:375–385
Magoč T, Salzberg SL (2011) Flash: fast length adjustment of short reads
to improve genome assemblies. Bioinformatics 27:2957–2963
Int J Trop Insect Sci
Nakabachi A, Yamashita A, Toh H, Ishikawa H, Dunbar HE, Moran NA,
Hattori M (2006) The 160-kilobase genome of the
bacterialendosymbiont Carsonella. Science 314:267
Nakabachi A, Ueoka R, Oshima K, Teta R, Mangoni A, Gurgui M,
Oldham NJ, van Echten-Deckert G, Okamura K, Yamamoto K,
Inoue H, Ohkuma M, Hongoh Y, Miyagishima SY, Hattori M, Piel
J, Fukatsu T (2013) Defensive bacteriome symbiont with a drasti-
cally reduced genome. Curr Biol 23(15):1478–1484
O'Neill SL, Giordano R, Colbert AM, Karr TL, Robertson HM (1992)16s
rRNA phylogenetic analysis of the bacterial endosymbionts associ-
ated with cytoplasmic incompatibility in insects. Proceedings of the
National Academy of Sciences of the United States of America, 89:
2699-2702
O'Neill SL, Hoffman AA, Werren JH (1997) Influential passengers:
inherited microorganisms and arthropod reproduction. Q Rev Biol
4:143–144
Peiffer JA, Spor A, Koren O, Jin Z, Tringe SG, Dangl JL (2013) Diversity
and heritability of the maize rhizosphere microbiome under field
conditions. Proceedings of the National Academy of Sciences of
the United States of America, 110:6548-6553
Subandiyah S, Nikoh N, Tsuyumu S, Somowiyarjo S, Fukatsu T (2000)
Complex endosymbiotic microbiota of the citrus psyllid Diaphorina
citri (Homoptera : Psylloidea). Zool Sci 17:983–989
Surya S, Hunter WB, Justin R et al (2012) Survey of endosymbionts in
the Diaphorina citri metagenome and assembly of a Wolbachia wDi
draft genome[J]. PLoS One 7(11):e50067
Takatsuka J, Kunimi Y (2000) Intestinal bacteria affect growth of Bacillus
thuringiensis in larvae of the oriental tea tortrix, Homona
magnanima Diakonoff (Lepidoptera: tortricidae). J Invertebr
Pathol 76:222–226
Tamames J, Gil R, Latorre A, Peretó J, Silva FJ, Moya A (2007) The
frontier between cell and organelle: genome analysis of Candidatus
Carsonella ruddii. BMC Evol Biol 7:181
Thao ML, Moran NA, Abbot P, Brennan EB, Burckhardt DH, Baumann
P (2000) Cospeciation of psyllids and their primary prokaryotic
endosymbionts. Appl Environ Microbiol 66:2898–2905
Trivedi P, Duan Y, Wang N (2010) Huanglongbing, a systemic disease,
restructures the bacterial community associated with citrus roots.
Appl Environ Microbiol 76:3427–3436
Wang Q, Garrity GM, Tiedje JM, Cole JR (2007) Naive Bayesian classi-
fier for rapid assignment of rRNA sequences into the new bacterial
taxonomy. Appl Environ Microbiol 73:5261–5267
Werren JH (1997) Biology of Wolbachia. Annu Rev Entomol 42:587–
609
Zhou LJ, Gabriel DW, Duan YP, Halbert SE, Dixon WN (2007) First
report of dodder transmission of huanglongbing from naturally in-
fected murraya paniculata to citrus. Plant Dis 91:227
Publisher’s note Springer Nature remains neutral with regard to
jurisdictional claims in published maps and institutional affiliations.