Journal of Ayurveda and Integrative Medicine 9 (2018) 290e293

Contents lists available at ScienceDirect

Journal of Ayurveda and Integrative Medicine

journal homepage: http://elsevier.com/locate/jaim

Short Communication

Nuclear ribosomal DNA e ITS region based molecular marker to

distinguish Gmelina arborea Roxb. Ex Sm. from its substitutes and
adulterants
Jaganathan Manokar, Subramani Paranthaman Balasubramani,
Padma Venkatasubramanian*
School of Integrative Health Sciences, TransDisciplinary University (TDU), Foundation for Revitalisation of Local Health Traditions (FRLHT), 74/2
Jarakabande Kaval, Attur Post, Via Yelahanka, Bangalore 560106, India

a r t i c l e i n f o a b s t r a c t

Article history: Roots of Gmelina arborea (Gambhari) is a medicinally important raw drug traded in India. However,
Received 15 March 2017 Gmelina asiatica and Mallotus nudiflorus are also found in the raw drug markets as Gambhari. The current
Received in revised form study aims to identify molecular markers based on the nuclear ribosomal DNA e ITS1 region to
4 October 2017
distinguish the authentic species from substitute/adulterants. The nuclear ribosomal internal transcribed
Accepted 10 October 2017
spacer 1 (ITS1) was amplified to identify species-specific markers using universal primers. Based on the
Available online 3 November 2017
sequence of the ITS region, specific primers were designed for G. arborea, G. asiatica and M. nudiflorus
which efficiently amplified 142 bp, 93 bp and 150 bp of the ITS1 region of the respective species. The
Keywords:
Gmelina arborea
notable feature of this molecular method is that it is technically accurate, practically convenient and
Gambhari suitable for analyzing large numbers of samples. This study demonstrates that the ITS1 region can be
Gmelina asiatica used for reliable authentication of medicinal plants and detection of adulterants and substitutes of
Mallotus nudiflorus Gambhari.
Internal transcribed spacer (ITS) © 2017 Transdisciplinary University, Bangalore and World Ayurveda Foundation. Publishing Services by
DNA marker Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/
licenses/by-nc-nd/4.0/).

1. Introduction While demand for herbal medicinal products is surging, the

Gmelina arborea Roxb. Ex Sm. (Verbenacea) is a medicinally
important plant distributed in the deciduous forests of South East
Asia [1]. In India it is distributed in Western ghats, foot of north-
western Himalaya to Chittagong and throughout Deccan peninsula
(http://envis.frlht.org/indian-medicinal-plants-database.php). It is
one of the vital ingredients of the Dasamoola herbal formulation
with an annual trade demand of 1000 metric tons [2]. According to
Ayurvedic Pharmacopoeia of India, the root of G. arborea has been
used under the common name “Gambhari” with gmelinol as an
active chemical marker [3]. G. arborea has been reported to have
demulcent, stomachic, galactagogue, laxative, anti-helminthic, anti-
inflammatory properties, and it has also been used in the treatment
of anthrax, asthma, bronchitis, cholera, epilepsy, fever, hallucination,
leprosy, rheumatism and snake poisoning [4,5].
* Corresponding author.
E-mail: padma.venkat@tdu.edu.in
Peer review under responsibility of Transdisciplinary University, Bangalore.
distribution and availability of medicinal plants have gone down
significantly. Because of these reasons, G. arborea is often adulter-
ated or substituted with plants such as Gmelina asiatica and Mal-
lotus nudiflorus (Euphorbiaceae) [2,6]. Substitution and
adulteration of Ayurvedic herbal ingredients reduce the therapeutic
efficacy of the drug and may pose serious detrimental effects on
consumers' health [7].
It is necessary to develop simple and accurate methods for
distinguishing the authentic plants from its adulterants. Many
recent studies have employed molecular techniques based on
nucleotide sequencing in order to differentiate closely related plant
species [8]. Since DNA markers are not affected by environmental
conditions, organism age and physiological conditions, they are
more reliable than morphological or chemical traits. The nuclear
ribosomal internal transcribed spacer (ITS) region is one of the
preferred genetic marker for molecular species identification,
because it is highly repeated, contains variable regions flanked by
more conserved DNA sequences and also universal primers are
available for PCR amplification [9].

https://doi.org/10.1016/j.jaim.2017.10.001
0975-9476/© 2017 Transdisciplinary University, Bangalore and World Ayurveda Foundation. Publishing Services by Elsevier B.V. This is an open access article under the CC
BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
 J. Manokar et al. / Journal of Ayurveda and Integrative Medicine 9 (2018) 290e293
The objective of the present study was to identify different plant
species traded as ‘Gambhari’ based on nuclear ribosomal DNA in-
ternal transcribed spacer (ITS1) sequences and to develop species-
specific markers for distinguishing them.
2. Materials and methods
2.1. Plant material collection and authentication
Field and market samples of G. arborea, G. asiatica and M.
nudiflorus were collected from different parts of south India and
assigned with individual accession numbers (Supplementary
Table 1). They were identified based on Flora of Tamil Nadu Carn-
atic [10], Flora of Orissa [11] and Flora of Bangalore District [12] by
qualified field botanists at the Foundation for Revitalization of Local
Health Traditions (FRLHT), Bangalore, India. The size, shape and
arrangement of the leaves were considered as a key distinguishing
character of the three species studied (details presented in
Supplementary Table 2). The voucher samples were deposited in
the Medicinal Plants Herbarium and Raw Drug Repository, FRLHT,
Bangalore, India. The photographs of the flowering branches of the
three species are presented in Supplementary Fig. 1. Market sam-
ples of Gambhari roots are shown in Supplementary Fig. 2.
2.2. Genomic DNA extraction
The root samples of G. arborea, G. asiatica and M. nudiflorus were
cut into small pieces and dried in a dehydrator at 50
C. Dried root
samples were ground into powder with mortar and pestle in liquid
nitrogen. Total genomic DNA was extracted from 100 mg of
powdered sample following the protocol described by Milligan [13]
with modifications. Extraction buffer containing (2% w/v CTAB,
1.4 M NaCl, 20 mM EDTA, 4 M LiCl, 100 mM TriseHCl; pH 8, 1% PVP
w/v and 0.2% v/v b mercaptoethanol; pH 7.5e8.0) was added to the
powder and incubated at 60
C in a water bath with occasional
shaking. After incubation, extraction with equal volume of chloro-
form/isoamyl alcohol (24:1) was performed twice. After centrifu-
gation at 10,000 rpm for 15 min, the supernatant was collected and
precipitated with one volume of ice-cold 2-propanol and 1/10th
volume of 3 M sodium acetate at 4
C. The mixture was centrifuged
for 15 min at 10,000 rpm. The collected DNA pellet was washed
with 70% ethanol, air dried and dissolved in TE buffer (10 mM
TriseHCl, 1 mM EDTA; pH 8) after drying. The sample was treated
with RNase A (20 mg/ml) for 30 min at 37
C. Purity of DNA was
checked using UV-VIS spectrophotometer (Shimadzu, Tokyo,
Japan), by calculating the A260/280 ratio. The DNA stock concen-
tration was maintained at 30e50 ng/ml in 20
C.
2.3. Polymerase chain reaction (PCR) amplification of ITS sequence
The nuclear DNA-ITS1 sequence was amplified from the
extracted genomic DNA with the universal primers ITS 1 (forward
primer; 50 -TCCGTAGGTGAACCTCGG-30 ) and ITS 2 (reverse primer;
50 -GCTGCGTTCTTCATCGATGC-30 ) [14] as summarized in Supple-
mentary Table 3. The PCR amplicons were resolved on 2%
agarose, 1 TAE buffer gels pre-stained with ethidium bromide
(0.5 mg/ml). Simultaneously, 100 bp ladder (Bangalore Genei, Ban-
galore) was loaded to identify the size of amplicons. The gel was
visualized under UV light in a gel documentation system (Bio-Rad,
CA, USA) and image captured.
2.4. PCR product purification and sequencing
The PCR-amplified ITS1 regions of G. arborea, G. asiatica and
M. nudiflorus were purified from agarose gel using QIAquick gel
291
extraction kit (Qiagen, Maryland, USA), following manufacturer's
instruction. Direct sequencing of purified PCR product was per-
formed using primers ITS 1 and ITS 2 by means of the automatic ABI
3100 genetic sequencer (Applied Bio systems, CA, USA), in Banga-
lore Genei (Bangalore, India). Sequence quality checks were per-
formed (details in supplementary data) and the nucleotide
sequence of the ITS region for all the three species were submitted
to GenBank (http://www.ncbi.nim.nih.gov/genbank/). Simulta-
neously, sequences were analyzed using ITSx software tool (version
1.0.11; http://microbiology.se/software/itsx/) to extract the ITS1
region from the whole sequence [15]. Primers were designed
within the ITS1 region.
2.5. Designing of species-specific primers and validation
Multiple sequence alignment of the ITS1 sequence of G. arborea,
G. asiatica and M. nudiflorus was performed to observe the sequence
variations for their discrimination. Based on the sequence variation,
PCR primers capable of giving species specific amplification were
designed using Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/
primer) (Table 1). The primers were also checked using the in-sil-
ico PCR amplification tool (http://insilico.ehu.es/PCR/index.php) for
their specificity and stringency. Oligonucleotides were custom
synthesized by Bioserve biotechnologies (Hyderabad, India) and
were used to amplify DNA extracted from all three ‘Gambhari’
samples. The conditions of PCR amplification with species-specific
primers are summarized in Supplementary Table 3.
3. Results
The DNA extraction protocol described by Milligan [13] with
some modifications yielded high molecular weight genomic DNA
from the dried root samples of G. arborea, G. asiatica and
M. nudiflorus. To the extraction buffer, 4 M LiCl was added in order
to remove polyphenols and polysaccharides [16]. This DNA isola-
tion protocol yielded high quality DNA. An absorbance (A 260/
A280) ratio of 1.6e1.8 indicated insignificant levels of contami-
nating proteins and polysaccharides. The universal primers ITS 1
(forward) and ITS 2 (reverse) amplified the partial ITS1 region
yielding an amplicon of approximately 300 bp with all accessions
for the three species (Supplementary Fig. 3).
Direct sequencing of the gel purified amplicon yielded a 259
bases sequence of ITS1, partial 5.8s rRNA gene for Gmelina arborea
(Genbank accession No. KJ704774). G. asiatica yielded a 328 bases
sequence comprising of 18s ribosomal RNA gene partial, ITS1
complete and partial 5.8s rRNA gene (Genbank accession No.
KJ704775). A 290 bases sequence of 18s ribosomal RNA gene, partial
and ITS1, partial was obtained for M. nudiflorus (Genbank accession
No. KJ704776).
Species-specific primers GAR-F and GAR-R yielded 142 bp
amplicon with G. arborea accessions (Fig. 1A) and did not produce
any amplification with G. asiatica and M. nudiflorus. Similarly,
primers GAS-F and GAS-R amplified the sequence size of 93 bp only
Table 1
Details of the species-specific markers designed using ITS1 sequence.
Plant species Name of Primer sequence (50 /30 ) Expected
the marker amplicon size
G. arborea GAR-F GAGGAAGGATCAGGTCGAGA 142
GAR-R GCGGAACGCTTCATTGAGAT
G. asiatica GAS-F GGTTAACGAACCCCGGC 93
GAS-R GATCCCGCCCGATCACC
M. nudiflorus TNF-F GCTCTGCAGAACGACCC 150
TNF-R CGCCGGGGTTGGTGTTA
292 J. Manokar et al. / Journal of Ayurveda and Integrative Medicine 9 (2018) 290e293

Fig. 1. PCR amplification of genomic DNA with species-specific markers. (A) Markers GAR-F and GAR-R gave a 142-base amplicon with Gmelina arborea samples (Lanes 1e3); Lanes 4
to 6 e G. asiatica; Lanes 7 to 9 e M. nudiflores. (B) GAS-F and GAS-R markers gave a 93-base amplicon with only G. asiatica samples (Lanes 1e3); Lanes 4 to 6 e G. arborea; Lanes 7 to
9 e M. nudiflores. (C) Markers TNF-F and TNF-R gave 150-base amplicon with only M. nudiflorus samples (Lanes 1e3); Lanes 4 to 6 e G. arborea; Lanes 7 to 9 e G. asiatica. Lane M,
100 bp DNA ladder.

with G. asiatica (Fig. 1B), while TNF-F and TNF-R produced ampli-
fication 150 bp of M. nudiflorus (Fig. 1C). Thus, the primers designed
were found to be species specific.
4. Discussion
An accurate and straightforward discrimination of authentic
plant species is very important in order to ensure safety and quality
of herbal drugs [17]. Although morphological, microscopic and
chromatography based identification methods are simple, the de-
gree to which these methods accurately identify the correct species
strongly depends on the skill and expertise of the identifiers [18].
Moreover, it is very likely that the related plant species and sub-
stitutes or adulterants may share similar characters, making the
conventional approaches less accurate, particularly if the sub-
stances at hand are plant parts such as root and barks [19].
DNA-based methods have become important tool for species
identification of plants [8]. The nuclear ribosomal ITS region has
been reported to display a high degree of divergence between
species but is often highly conserved within species; hence they are
most preferred genetic markers for species level identification [20].
Because of the high copy number of the ITS region in genomic DNA,
the chances of getting amplification from the processed or old
herbal materials are good [8]. ITS1 has been successfully used in
distinguishing medicinal herbs like Amomum villosum (Zingiber-
acea) [21] and also in differentiating the species Boerhavia diffusa
(Punarnava) from Boerhavia erecta [22]. Rai et al. [23] have used
ITS2 sequences to distinguish members of Asparagaceae and
Asclepiadaceae.
5. Conclusion
The primers introduced in this study target the nuclear ribo-
somal ITS1 region, and we hope that they will be useful in assessing
the botanical identity of raw drugs traded under the name of
Gambhari.
Sources of funding
National Medicinal Plants Board (NMPB), Ministry of AYUSH and
Ministry of Environment and Forests, Govt. of India under “Centre
of Excellence” scheme.
Conflict of interest
None.
Acknowledgements
Thanks to Dr. K. Ravi Kumar and Mr. Murthy for providing plant
accessions and authentication of medicinal plant species.
Acknowledging Dr. Murugan, SASTRA University for the plant
photographs and plant description. Ms. Krithika is thankfully
acknowledged for technical inputs on sequence data analysis. Au-
thors also wish to thank Dr. K.V. Krishnamurthy and Dr. K. Sub-
rahmanya Kumar for their valuable inputs to this study.
Appendix A. Supplementary data
Supplementary data related to this article can be found at
https://doi.org/10.1016/j.jaim.2017.10.001.
References
[1] Dhakulkar S, Ganapathi TR, Bhargava S, Bapat VA. Induction of hairy roots in
Gmelina arborea Roxb. and production of verbascoside in hairy roots. Plant Sci
2005;169(5):812e8.
[2] Ved DK, Goraya GS. Demand and supply of medicinal plants in India. Dehra
Dun: Bishen Singh Mahendra Pal Singh; 2008.
[3] Anonymous. The ayurvedic Pharmacopoeia of India, Part Ivol. I. New Delhi::
Government of India, Ministry of Health & Family Welfare, Department of
AYUSH; 2008.
[4] Kirtikar KR, Basu BD. Indian medicinal plants. 2nd ed. Delhi: Taj Offset Press;
1984.
[5] Nadkarni AK. Indian materia medica. 3rd ed. Bombay: Popular Prakasan; 1976.
[6] Vaidya B. Some controversial drugs in Indian medicine. Varanasi: Chau-
khambha Orientalia; 2005.
 J. Manokar et al. / Journal of Ayurveda and Integrative Medicine 9 (2018) 290e293
[7] Newmaster SG, Grguric M, Shanmughanandhan D, Ramalingam S,
Ragupathy S. DNA barcoding detects contamination and substitution in North
American herbal products. BMC Med 2013;11:222e35.
[8] Balasubramani SP, Murugan R, Ravikumar K, Venkatasubramanian P. Devel-
opment of ITS sequence based molecular marker to distinguish, Tribulus ter-
restris L. (Zygophyllaceae) from its adulterants. Fitoter 2010;81(6):503e8.
[9] Hillis DM, Dixon MT. Ribosomal DNA: molecular evolution and phylogenetic
inference. Q Rev Biol 1991;66:411e53.
[10] Matthew KM. The Flora of Tamil Nadu Carnatic3 vols. , Tiruchirappalli, India:
The Rapinat Herbarium, St Joseph's College; 1981e84.
[11] Saxena HO, Brahman M. Flora of Orissa4 vols. Bhubaneswar, India: Regional
Research Laboratory; 1994e96.
[12] Ramaswamy SV, Razi BA. Flora of Bangalore District. India: University of
Mysore; 1973.
[13] Milligan BG. Total DNA isolation. In: Hoelzel AR, editor. Molecular genetic
analysis of populations. Oxford: IRL Press; 1998. p. 29e64.
[14] White TJ, Bruns T, Lee S, Taylor J. Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH,
Sninsky JJ, Thomas J, editors. PCR protocols: a guide to methods and appli-
cations. San Diego: Academic Press; 1990.
[15] Bengtsson-Palme J, Ryberg M, Hartmann M, Branco S, Wang Z, Godhe A, et al.
Improved software detection and extraction of ITS1 and ITS2 from ribosomal
ITS sequences of fungi and other eukaryotes for analysis of environmental
sequencing data. Methods Ecol Evol 2013;4(10):914e9.
293
[16] Pirttila AM, Hirsikorpi M, Kamarainen T, Jaakola L, Hohtola A. DNA isolation
methods for medicinal and aromatic plants. Plant Mol Biol Rep 2001;19(3):
273.
[17] WHO. Quality control methods for medicinal plant materials. Geneva: World
Health Organization; 1998.
[18] Liu Z, Zeng X, Yang D, Chu G, Yuan Z, Chen S. Applying DNA barcodes for
identification of plant species in the family Araliaceae. Gene 2012;499(1):
76e80.
[19] Joshi K, Chavan P, Warude D, Patwardhan B. Molecular markers in herbal drug
technology. Curr Sci 2004;87:159e65.
[20] Cheng T, Xu C, Lei L, Li C, Zhang Y, Zhou S. Barcoding the kingdom Plantae:
new PCR primers for ITS regions of plants with improved universality and
specificity. Mol Ecol Resour 2016;16(1):138e49.
[21] Qiao C, Han Q, Zhao Z, Wang Z, Xu L, Xu HX. Sequence analysis based on ITS1
region of nuclear ribosomal DNA of Amomum villosum and ten species of
Alpinia. J Food Drug Anal 2009;17(2):142e5.
[22] Selvaraj D, Shanmughanandhan D, Sarma RK, Joseph JC, Srinivasan RV,
Ramalingam S. DNA barcode ITS effectively distinguishes the medicinal plant
Boerhavia diffusa from its adulterants. Genom Proteom Bioinform 2012;10(6):
364e7.
[23] Rai PS, Bellampalli R, Dobriyal RM, Agarwal A, Satyamoorthy K, Narayana DA.
DNA barcoding of authentic and substitute samples of herb of the family
Asparagaceae and Asclepiadaceae based on the ITS2 region. J Ayurveda Integr
Med 2012;3(3):136e40.